The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	0	7083	3944627	tRNA	Tupanvirus(100.0%)	5	NA	NA
AVO85579.1|1141_2425_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVO89064.1|2585_4223_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVO85580.1|4227_4806_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
AVO85581.1|4825_5659_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AVO85582.1|6132_7083_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 2
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	11407	15436	3944627		Staphylococcus_phage(33.33%)	6	NA	NA
AVO85588.1|11407_12067_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	2.8e-41
AVO85589.1|12131_12806_-	hydrolase	NA	NA	NA	NA	NA
AVO85590.1|12903_13671_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVO85591.1|13716_14190_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AVO85592.1|14380_14617_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
AVO85593.1|14701_15436_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
>prophage 3
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	19874	25330	3944627		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AVO85600.1|19874_20471_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
AVO85601.1|20512_21436_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AVO85602.1|21499_22144_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AVO85603.1|22144_22894_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AVO85604.1|22890_24048_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	4.6e-31
AVO85605.1|24049_25330_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	7.6e-19
>prophage 4
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	31053	33090	3944627		Ralstonia_phage(100.0%)	1	NA	NA
AVO85610.1|31053_33090_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	6.0e-119
>prophage 5
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	52820	53390	3944627		Pseudomonas_phage(100.0%)	1	NA	NA
AVO85625.1|52820_53390_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 6
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	88803	98070	3944627		Bacillus_phage(40.0%)	8	NA	NA
AVO85659.1|88803_90225_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
AVO89067.1|90371_90671_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89068.1|90693_92298_-	HAMP domain-containing protein	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	1.2e-05
AVO85660.1|92375_93092_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
AVO85661.1|93088_93295_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85662.1|93624_96459_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
AVO85663.1|96514_96649_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AVO85664.1|96786_98070_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
>prophage 7
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	103132	103975	3944627		uncultured_marine_virus(100.0%)	1	NA	NA
AVO85668.1|103132_103975_-	hypothetical protein	NA	A0A0F7L647	uncultured_marine_virus	34.2	2.0e-23
>prophage 8
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	144253	145564	3944627		Burkholderia_virus(100.0%)	1	NA	NA
AVO85699.1|144253_145564_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 9
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	161506	161986	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO85711.1|161506_161986_-	glycosyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 10
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	168754	169027	3944627		uncultured_virus(100.0%)	1	NA	NA
AVO85717.1|168754_169027_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
>prophage 11
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	183443	184799	3944627		Pandoravirus(100.0%)	1	NA	NA
AVO89076.1|183443_184799_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.9	2.3e-26
>prophage 12
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	209111	211883	3944627		uncultured_virus(100.0%)	1	NA	NA
AVO85743.1|209111_211883_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.1e-65
>prophage 13
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	217321	226041	3944627	tRNA	Streptomyces_phage(25.0%)	10	NA	NA
AVO85748.1|217321_217648_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
AVO85749.1|217969_219238_+	transcription termination factor Rho	NA	NA	NA	NA	NA
AVO85750.1|219432_219558_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85751.1|219652_219898_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85752.1|220067_220364_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
AVO85753.1|220360_222742_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVO85754.1|222775_223756_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.5e-35
AVO85755.1|223913_224915_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85756.1|224921_225425_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVO85757.1|225483_226041_-	DUF1768 domain-containing protein	NA	A0A1S6UAJ7	Serratia_phage	45.3	1.1e-33
>prophage 14
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	229542	234062	3944627	tRNA	Agrobacterium_phage(33.33%)	3	NA	NA
AVO85763.1|229542_230094_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
AVO85764.1|230099_232022_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	9.1e-125
AVO85765.1|232433_234062_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.9e-28
>prophage 15
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	237988	239452	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO85772.1|237988_239452_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	31.1	3.5e-20
>prophage 16
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	244028	250165	3944627		Streptococcus_phi-m46.1-like_phage(33.33%)	4	NA	NA
AVO85777.1|244028_245420_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.6	1.4e-29
AVO85778.1|245429_246248_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AVO85779.1|246270_247185_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
AVO85780.1|247357_250165_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
>prophage 17
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	263297	264062	3944627	tRNA	Pandoravirus(100.0%)	1	NA	NA
AVO85796.1|263297_264062_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	2.0e-14
>prophage 18
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	270414	272007	3944627		Tupanvirus(100.0%)	1	NA	NA
AVO85802.1|270414_272007_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 19
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	275363	289649	3944627	tRNA	Bacillus_phage(20.0%)	10	NA	NA
AVO85806.1|275363_277418_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
AVO85807.1|277748_278765_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AVO85808.1|278797_279289_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AVO85809.1|279288_281013_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
AVO85810.1|281517_281847_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AVO85811.1|282033_284658_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	4.1e-176
AVO85812.1|284685_285195_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85813.1|285214_286204_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AVO85814.1|286311_287652_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
AVO85815.1|287654_289649_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.3e-36
>prophage 20
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	292962	295496	3944627		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
AVO85818.1|292962_293529_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
AVO85819.1|293654_294713_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AVO85820.1|294810_295227_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVO85821.1|295238_295496_+	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
>prophage 21
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	306006	307542	3944627		Catovirus(100.0%)	1	NA	NA
AVO85833.1|306006_307542_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	30.6	1.3e-57
>prophage 22
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	317024	318317	3944627	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVO85845.1|317024_318317_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	5.3e-20
>prophage 23
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	322403	327445	3944627	protease,tail	Powai_lake_megavirus(50.0%)	5	NA	NA
AVO85850.1|322403_322835_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
AVO85851.1|322948_323149_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVO85852.1|323248_323800_-	PAP2 family protein	NA	NA	NA	NA	NA
AVO85853.1|323824_325123_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVO85854.1|325261_327445_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	48.8	2.0e-184
>prophage 24
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	331251	332517	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO85857.1|331251_332517_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 25
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	346494	348515	3944627	protease	Bacillus_virus(50.0%)	2	NA	NA
AVO85868.1|346494_347808_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
AVO85869.1|347909_348515_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
>prophage 26
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	352792	353476	3944627		Cyanophage(100.0%)	1	NA	NA
AVO85872.1|352792_353476_+	PKHD-type hydroxylase	NA	A0A127KM56	Cyanophage	30.1	4.3e-21
>prophage 27
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	358221	358848	3944627		Cassava_brown_streak_virus(100.0%)	1	NA	NA
AVO85877.1|358221_358848_+	non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	8.9e-13
>prophage 28
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	369165	370562	3944627		Geobacillus_virus(50.0%)	2	NA	NA
AVO85887.1|369165_370008_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	9.2e-98
AVO85888.1|370052_370562_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	45.1	1.8e-24
>prophage 29
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	381687	394165	3944627		Bacillus_phage(25.0%)	11	NA	NA
AVO85902.1|381687_383667_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.2	6.0e-63
AVO85903.1|383783_384356_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVO85904.1|384493_385252_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85905.1|385339_387976_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
AVO85906.1|388011_388461_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85907.1|388608_388986_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AVO85908.1|389085_390096_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AVO85909.1|390143_390389_-	SlyX protein	NA	NA	NA	NA	NA
AVO85910.1|390421_392332_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.3e-46
AVO85911.1|392477_393110_+	LysE family translocator	NA	NA	NA	NA	NA
AVO85912.1|393229_394165_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.3	1.8e-41
>prophage 30
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	414996	417291	3944627		Hokovirus(100.0%)	1	NA	NA
AVO85933.1|414996_417291_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 31
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	441051	447579	3944627		Ostreococcus_lucimarinus_virus(33.33%)	9	NA	NA
AVO85950.1|441051_442350_+	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
AVO85951.1|442450_442705_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AVO85952.1|442957_443290_+	HopJ type III effector protein	NA	NA	NA	NA	NA
AVO85953.1|443718_444099_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.3	3.0e-24
AVO85954.1|444334_444745_-	GFA family protein	NA	NA	NA	NA	NA
AVO85955.1|444822_446028_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AVO85956.1|446017_446650_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVO85957.1|446743_446938_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
AVO85958.1|446934_447579_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
>prophage 32
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	465318	466275	3944627		Megavirus(100.0%)	1	NA	NA
AVO85975.1|465318_466275_+	DNA-binding protein	NA	K7YGN1	Megavirus	49.4	6.7e-12
>prophage 33
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	473000	478541	3944627		Brevibacillus_phage(50.0%)	2	NA	NA
AVO85981.1|473000_474752_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.1	2.6e-17
AVO89089.1|474860_478541_-	exonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	23.1	4.4e-11
>prophage 34
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	487020	492517	3944627		Ostreococcus_mediterraneus_virus(50.0%)	4	NA	NA
AVO85988.1|487020_488640_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.7	1.6e-29
AVO85989.1|488764_490078_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AVO85990.1|490231_491005_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AVO85991.1|491014_492517_+	DNA helicase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
>prophage 35
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	500939	503639	3944627		Bodo_saltans_virus(100.0%)	1	NA	NA
AVO86000.1|500939_503639_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 36
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	524073	524928	3944627		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVO86021.1|524073_524928_-	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	3.6e-17
>prophage 37
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	529994	530909	3944627		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVO86027.1|529994_530909_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 38
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	541764	543684	3944627		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVO86037.1|541764_543684_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.0e-119
>prophage 39
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	546761	557755	3944627		uncultured_virus(33.33%)	6	NA	NA
AVO86041.1|546761_547634_-	alpha/beta hydrolase	NA	A0A218MNI3	uncultured_virus	30.9	7.8e-07
AVO86042.1|547757_548255_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AVO86043.1|548283_548640_-	DNA transfer protein p32	NA	NA	NA	NA	NA
AVO86044.1|548853_549219_-	DNA transfer protein p32	NA	NA	NA	NA	NA
AVO86045.1|549386_553580_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
AVO86046.1|553666_557755_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
>prophage 40
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	561729	568882	3944627		Cedratvirus(33.33%)	5	NA	NA
AVO86053.1|561729_562920_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
AVO86054.1|563599_565093_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	3.0e-35
AVO86055.1|565201_565870_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AVO86056.1|565935_566565_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AVO86057.1|566605_568882_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	35.2	2.0e-30
>prophage 41
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	595172	596093	3944627		Brevibacillus_phage(100.0%)	1	NA	NA
AVO86082.1|595172_596093_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
>prophage 42
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	601852	606010	3944627		Hokovirus(50.0%)	3	NA	NA
AVO89095.1|601852_603376_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
AVO86088.1|603400_604822_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVO86089.1|604825_606010_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
>prophage 43
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	610012	618052	3944627		Staphylococcus_phage(40.0%)	9	NA	NA
AVO86093.1|610012_611461_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
AVO86094.1|611453_611861_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVO86095.1|611899_612538_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86096.1|612668_612887_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86097.1|612946_613606_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
AVO86098.1|613648_614941_-	DNA modification methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
AVO86099.1|614937_616023_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
AVO86100.1|616038_616497_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVO86101.1|616654_618052_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
>prophage 44
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	622130	622934	3944627		Hepacivirus(100.0%)	1	NA	NA
AVO89096.1|622130_622934_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
>prophage 45
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	627142	632885	3944627		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
AVO86111.1|627142_628360_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AVO86112.1|628442_630239_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86113.1|630533_632021_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
AVO86114.1|632033_632885_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
>prophage 46
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	636624	637335	3944627	transposase	Vibriophage(100.0%)	1	NA	NA
AVO86119.1|636624_637335_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 47
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	644575	655681	3944627		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
AVO86126.1|644575_645103_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
AVO86127.1|645230_645641_-	hypothetical protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
AVO86128.1|645735_646119_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86129.1|646157_647837_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
AVO86130.1|648134_650354_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
AVO86131.1|650507_651827_-	MFS transporter	NA	NA	NA	NA	NA
AVO86132.1|651909_652554_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVO86133.1|652599_653067_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86134.1|653138_654731_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
AVO89097.1|655075_655681_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
>prophage 48
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	660807	663186	3944627		Pseudomonas_phage(100.0%)	1	NA	NA
AVO86140.1|660807_663186_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 49
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	667331	668330	3944627		Lactococcus_phage(100.0%)	1	NA	NA
AVO86146.1|667331_668330_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.4	8.4e-74
>prophage 50
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	679964	683543	3944627		Synechococcus_phage(33.33%)	4	NA	NA
AVO86153.1|679964_680495_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
AVO86154.1|680617_681772_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AVO89098.1|681792_682923_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.0	2.8e-25
AVO86155.1|682973_683543_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
>prophage 51
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	697994	698783	3944627		Staphylococcus_phage(100.0%)	1	NA	NA
AVO86172.1|697994_698783_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 52
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	704322	706113	3944627	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVO86178.1|704322_706113_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.3e-16
>prophage 53
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	711194	712763	3944627		Hokovirus(100.0%)	1	NA	NA
AVO86186.1|711194_712763_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 54
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	716910	717753	3944627		Mycobacterium_phage(100.0%)	1	NA	NA
AVO86192.1|716910_717753_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.5	1.0e-11
>prophage 55
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	732732	739205	3944627		Catovirus(33.33%)	5	NA	NA
AVO86200.1|732732_734622_-	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	22.7	1.7e-11
AVO86201.1|735237_735954_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.2	7.3e-19
AVO86202.1|736713_737130_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
AVO86203.1|737193_737760_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVO86204.1|737852_739205_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.7	2.2e-53
>prophage 56
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	742296	743946	3944627		Staphylococcus_phage(100.0%)	1	NA	NA
AVO86208.1|742296_743946_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	2.6e-80
>prophage 57
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	783624	784641	3944627		Tupanvirus(100.0%)	1	NA	NA
AVO86240.1|783624_784641_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.2	8.0e-80
>prophage 58
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	787678	788554	3944627		Bacillus_phage(100.0%)	1	NA	NA
AVO86243.1|787678_788554_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.5	2.5e-61
>prophage 59
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	798132	800988	3944627		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AVO86254.1|798132_798825_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	30.2	6.4e-12
AVO86255.1|798827_799988_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	31.2	2.1e-36
AVO86256.1|799989_800988_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	36.8	1.2e-40
>prophage 60
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	804217	806404	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO86260.1|804217_806404_+	tyrosine protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	1.5e-19
>prophage 61
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	829146	829947	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO86282.1|829146_829947_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 62
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	833914	836752	3944627	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVO86287.1|833914_836752_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.9	1.0e-76
>prophage 63
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	844680	846452	3944627		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVO86291.1|844680_845238_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	33.9	1.1e-14
AVO86292.1|845381_846452_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
>prophage 64
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	850526	853715	3944627		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVO86297.1|850526_852467_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
AVO86298.1|852797_853715_+	peptidase	NA	W6JIV8	Anomala_cuprea_entomopoxvirus	46.9	7.6e-05
>prophage 65
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	858396	858909	3944627		Tetraselmis_virus(100.0%)	1	NA	NA
AVO86302.1|858396_858909_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 66
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	863440	869604	3944627		Escherichia_phage(33.33%)	6	NA	NA
AVO86307.1|863440_864397_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	1.3e-31
AVO86308.1|864585_864951_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86309.1|864972_866133_+	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.5	2.6e-95
AVO86310.1|866424_867480_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AVO86311.1|867536_868862_+	guanine deaminase	NA	NA	NA	NA	NA
AVO86312.1|869076_869604_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
>prophage 67
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	875433	886505	3944627		Staphylococcus_phage(20.0%)	10	NA	NA
AVO86319.1|875433_875754_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
AVO86320.1|875764_876157_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVO86321.1|876186_876321_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVO86322.1|876990_878388_+	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
AVO86323.1|878485_879634_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.0e-46
AVO86324.1|879648_880731_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVO86325.1|880783_883252_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
AVO86326.1|883289_883682_+	cytochrome B	NA	NA	NA	NA	NA
AVO86327.1|883765_884323_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86328.1|884573_886505_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
>prophage 68
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	890500	890836	3944627		Lake_Baikal_phage(100.0%)	1	NA	NA
AVO86332.1|890500_890836_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 69
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	905644	906607	3944627	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
AVO86341.1|905644_906607_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 70
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	912176	913472	3944627		Enterobacteria_phage(100.0%)	1	NA	NA
AVO86345.1|912176_913472_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	64.8	4.2e-150
>prophage 71
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	922250	923363	3944627		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AVO86351.1|922250_923363_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 72
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	926774	931505	3944627		Indivirus(50.0%)	6	NA	NA
AVO86356.1|926774_927578_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	7.8e-38
AVO86357.1|927698_928601_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVO86358.1|928584_928959_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86359.1|928966_929089_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86360.1|929049_930474_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AVO86361.1|930476_931505_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
>prophage 73
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	935605	943848	3944627		Moraxella_phage(20.0%)	10	NA	NA
AVO86368.1|935605_935764_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
AVO86369.1|935958_936417_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AVO89110.1|936529_937699_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AVO86370.1|937804_939070_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.0e-79
AVO86371.1|939085_939925_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	4.6e-41
AVO86372.1|940210_940414_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86373.1|940606_941326_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
AVO89111.1|941362_941965_-	lipoprotein-34 precursor (NlpB)	NA	NA	NA	NA	NA
AVO86374.1|941980_942874_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AVO86375.1|943203_943848_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	1.9e-26
>prophage 74
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	956099	957212	3944627		Gordonia_phage(100.0%)	1	NA	NA
AVO86387.1|956099_957212_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.9	4.7e-09
>prophage 75
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	960903	962442	3944627		Catovirus(100.0%)	1	NA	NA
AVO86390.1|960903_962442_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 76
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	969834	976549	3944627		Staphylococcus_phage(50.0%)	7	NA	NA
AVO86397.1|969834_971673_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.5	8.4e-128
AVO86398.1|971685_973050_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	1.7e-32
AVO86399.1|973066_973582_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AVO86400.1|973559_974477_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AVO86401.1|974492_974942_-	N utilization substance protein B	NA	NA	NA	NA	NA
AVO86402.1|974945_975416_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
AVO86403.1|975427_976549_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.7	1.2e-52
>prophage 77
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	981508	991180	3944627		Bacillus_phage(50.0%)	9	NA	NA
AVO86409.1|981508_982723_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	5.7e-48
AVO86410.1|982873_983722_+	sulfurtransferase	NA	NA	NA	NA	NA
AVO86411.1|983718_984570_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AVO86412.1|984998_986219_+	acetamidase	NA	A0A1V0S8X7	Catovirus	29.2	2.8e-18
AVO86413.1|986349_986769_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86414.1|986839_987598_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVO86415.1|987835_989032_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVO86416.1|989101_990460_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	1.3e-29
AVO86417.1|990469_991180_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
>prophage 78
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1000777	1006850	3944627		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AVO86427.1|1000777_1004104_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	75.4	0.0e+00
AVO86428.1|1004113_1006138_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	76.5	2.7e-297
AVO89113.1|1006151_1006850_+	hypothetical protein	NA	A0A2H4JCF6	uncultured_Caudovirales_phage	61.3	2.2e-76
>prophage 79
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1010223	1012107	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO86432.1|1010223_1012107_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.7e-99
>prophage 80
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1024434	1026715	3944627		Bacillus_phage(50.0%)	2	NA	NA
AVO86446.1|1024434_1025628_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	4.0e-22
AVO86447.1|1025803_1026715_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.7	1.1e-08
>prophage 81
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1043571	1044264	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO86465.1|1043571_1044264_+	M23 family peptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 82
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1055481	1063102	3944627		Klosneuvirus(33.33%)	6	NA	NA
AVO86473.1|1055481_1056948_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
AVO86474.1|1057097_1058435_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVO86475.1|1058445_1059102_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AVO86476.1|1059102_1060803_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	2.1e-64
AVO86477.1|1060847_1061615_-	putative porin	NA	NA	NA	NA	NA
AVO86478.1|1062007_1063102_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
>prophage 83
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1068799	1073167	3944627	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
AVO86485.1|1068799_1070749_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.9	1.1e-93
AVO86486.1|1070795_1071338_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVO86487.1|1071443_1071857_+	AsnC family protein	NA	NA	NA	NA	NA
AVO86488.1|1071958_1073167_+|transposase	IS256 family transposase ISAba26	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 84
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1077399	1080897	3944627		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVO86493.1|1077399_1080897_-	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 85
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1084157	1094366	3944627	holin	Vibrio_phage(25.0%)	5	NA	NA
AVO86496.1|1084157_1086125_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-26
AVO86497.1|1086183_1087083_-	carbapenem susceptibility porin CarO	NA	NA	NA	NA	NA
AVO86498.1|1088075_1089782_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	3.7e-13
AVO86499.1|1089864_1091520_+	NTPase	NA	X2KLG0	Campylobacter_phage	24.4	8.1e-21
AVO86500.1|1091534_1094366_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
>prophage 86
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1098044	1101271	3944627		Acinetobacter_phage(50.0%)	3	NA	NA
AVO86506.1|1098044_1099127_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.2	2.6e-89
AVO86507.1|1099273_1100638_+	MFS transporter	NA	NA	NA	NA	NA
AVO86508.1|1100689_1101271_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
>prophage 87
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1104756	1107705	3944627		Streptococcus_phage(50.0%)	2	NA	NA
AVO86513.1|1104756_1106301_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
AVO86514.1|1106412_1107705_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
>prophage 88
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1129493	1133205	3944627		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVO86536.1|1129493_1131371_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
AVO86537.1|1131426_1131870_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86538.1|1132101_1133205_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
>prophage 89
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1148612	1150852	3944627		Bacillus_phage(100.0%)	2	NA	NA
AVO86558.1|1148612_1150070_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
AVO86559.1|1150087_1150852_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
>prophage 90
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1157579	1160817	3944627		Pandoravirus(50.0%)	2	NA	NA
AVO86563.1|1157579_1158857_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	5.3e-12
AVO86564.1|1159155_1160817_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
>prophage 91
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1167252	1170411	3944627		Leptospira_phage(100.0%)	1	NA	NA
AVO86572.1|1167252_1170411_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	21.0	2.7e-25
>prophage 92
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1206313	1206904	3944627		Lactococcus_phage(100.0%)	1	NA	NA
AVO86600.1|1206313_1206904_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 93
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1214100	1217394	3944627		Salmonella_phage(50.0%)	3	NA	NA
AVO86608.1|1214100_1216206_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
AVO86609.1|1216413_1216692_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVO86610.1|1216764_1217394_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
>prophage 94
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1235186	1236419	3944627		Catovirus(100.0%)	1	NA	NA
AVO86627.1|1235186_1236419_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 95
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1240591	1244777	3944627		Salmonella_phage(100.0%)	3	NA	NA
AVO86633.1|1240591_1241821_+	multidrug transporter MdfA	NA	S4TR35	Salmonella_phage	22.3	4.6e-13
AVO86634.1|1241857_1244008_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVO86635.1|1244201_1244777_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	58.4	9.2e-41
>prophage 96
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1255191	1256406	3944627		Klosneuvirus(100.0%)	1	NA	NA
AVO86645.1|1255191_1256406_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.4e-25
>prophage 97
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1283014	1283617	3944627		Staphylococcus_phage(100.0%)	1	NA	NA
AVO86670.1|1283014_1283617_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 98
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1287187	1290230	3944627		Catovirus(50.0%)	2	NA	NA
AVO86673.1|1287187_1289008_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.8e-45
AVO89127.1|1289411_1290230_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
>prophage 99
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1293890	1294472	3944627		Orpheovirus(100.0%)	1	NA	NA
AVO86678.1|1293890_1294472_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 100
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1308034	1309582	3944627		Klebsiella_phage(100.0%)	1	NA	NA
AVO86690.1|1308034_1309582_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	1.2e-74
>prophage 101
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1334980	1339601	3944627		Klosneuvirus(50.0%)	2	NA	NA
AVO86730.1|1334980_1337035_-	M3 family peptidase	NA	A0A1V0SIU1	Klosneuvirus	20.8	3.3e-32
AVO86731.1|1337168_1339601_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	3.3e-71
>prophage 102
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1355433	1360243	3944627	tRNA	Pseudomonas_phage(50.0%)	3	NA	NA
AVO89130.1|1355433_1356477_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
AVO86747.1|1356559_1358011_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AVO86748.1|1358299_1360243_+	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
>prophage 103
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1377784	1378687	3944627		Mollivirus(100.0%)	1	NA	NA
AVO86762.1|1377784_1378687_+	KR domain-containing protein	NA	A0A0M4JSW6	Mollivirus	22.3	3.1e-06
>prophage 104
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1385085	1385514	3944627	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVO86768.1|1385085_1385514_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 105
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1408922	1410257	3944627		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AVO86788.1|1408922_1409819_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
AVO86789.1|1409819_1410257_+	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	1.3e-10
>prophage 106
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1418223	1424029	3944627	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
AVO86800.1|1418223_1419477_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
AVO86801.1|1419540_1420506_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
AVO86802.1|1420514_1422416_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVO86803.1|1422467_1422797_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AVO86804.1|1422895_1424029_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
>prophage 107
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1428826	1433264	3944627		Vibrio_phage(50.0%)	3	NA	NA
AVO86809.1|1428826_1430239_-	NTPase	NA	R9TRQ8	Vibrio_phage	24.7	2.4e-18
AVO86810.1|1430534_1430744_+	hypothetical protein	NA	NA	NA	NA	NA
AVO86811.1|1431995_1433264_+	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	25.2	4.6e-08
>prophage 108
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1445811	1447590	3944627	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVO86822.1|1445811_1447590_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 109
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1462141	1465620	3944627		Bacillus_phage(33.33%)	3	NA	NA
AVO86833.1|1462141_1462828_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
AVO86834.1|1462891_1464334_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
AVO86835.1|1464447_1465620_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
>prophage 110
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1503325	1503679	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO86865.1|1503325_1503679_+	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	59.8	6.1e-27
>prophage 111
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1507829	1517569	3944627		Bordetella_phage(25.0%)	9	NA	NA
AVO86871.1|1507829_1509035_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	1.4e-126
AVO86872.1|1509311_1510772_-	amino acid permease	NA	NA	NA	NA	NA
AVO86873.1|1510793_1511807_-	ribosomal RNA small subunit methyltransferase C	NA	NA	NA	NA	NA
AVO86874.1|1511869_1513228_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
AVO86875.1|1513406_1515242_+	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
AVO86876.1|1515497_1515929_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AVO89139.1|1516070_1516424_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AVO86877.1|1516434_1516725_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVO86878.1|1516744_1517569_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	3.2e-26
>prophage 112
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1530370	1543742	3944627		Leptospira_phage(20.0%)	8	NA	NA
AVO86892.1|1530370_1533469_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	27.6	1.9e-95
AVO86893.1|1533484_1534603_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVO89140.1|1534662_1535262_-	hypothetical protein	NA	NA	NA	NA	NA
AVO86894.1|1535583_1535967_+	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
AVO86895.1|1535990_1536353_+	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
AVO86896.1|1536413_1536950_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVO86897.1|1536996_1539075_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
AVO86898.1|1539221_1543742_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	39.3	4.3e-16
>prophage 113
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1555380	1556595	3944627		Salmonella_phage(100.0%)	1	NA	NA
AVO86909.1|1555380_1556595_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	27.9	1.3e-28
>prophage 114
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1560107	1561079	3944627		Klosneuvirus(100.0%)	1	NA	NA
AVO86912.1|1560107_1561079_+	alpha/beta hydrolase	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.6e-08
>prophage 115
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1595237	1596092	3944627		Pandoravirus(100.0%)	1	NA	NA
AVO86944.1|1595237_1596092_-	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 116
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1606257	1607445	3944627		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVO89145.1|1606257_1607445_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	4.9e-44
>prophage 117
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1611543	1614423	3944627	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AVO86958.1|1611543_1614423_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	3.7e-146
>prophage 118
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1630296	1631568	3944627	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVO86975.1|1630296_1631568_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.2	6.9e-97
>prophage 119
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1639378	1641265	3944627		Vibrio_phage(100.0%)	1	NA	NA
AVO86985.1|1639378_1641265_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 120
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1655654	1659307	3944627		Erysipelothrix_phage(50.0%)	3	NA	NA
AVO86999.1|1655654_1657088_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
AVO87000.1|1657235_1658402_+	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AVO87001.1|1658416_1659307_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
>prophage 121
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1663030	1664533	3944627		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVO87005.1|1663030_1664533_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 122
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1688743	1689376	3944627		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVO87011.1|1688743_1689376_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 123
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1696437	1699118	3944627		Marsac_virus(50.0%)	2	NA	NA
AVO87018.1|1696437_1697088_+	ribosomal RNA large subunit methyltransferase E	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
AVO87019.1|1697222_1699118_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
>prophage 124
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1703441	1707092	3944627		Enterococcus_phage(50.0%)	4	NA	NA
AVO87023.1|1703441_1704290_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.2e-25
AVO87024.1|1704530_1705199_+	methyltransferase	NA	NA	NA	NA	NA
AVO87025.1|1705221_1705644_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87026.1|1705760_1707092_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
>prophage 125
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1724946	1726930	3944627		uncultured_virus(100.0%)	2	NA	NA
AVO87033.1|1724946_1725237_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
AVO87034.1|1725295_1726930_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
>prophage 126
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1734955	1737228	3944627	tRNA	Geobacillus_virus(50.0%)	2	NA	NA
AVO87041.1|1734955_1735819_-	transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	53.0	7.9e-36
AVO87042.1|1736322_1737228_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
>prophage 127
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1741285	1745284	3944627		Tupanvirus(100.0%)	1	NA	NA
AVO87047.1|1741285_1745284_+	peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	3.0e-69
>prophage 128
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1751967	1753125	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO87055.1|1751967_1753125_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	3.0e-38
>prophage 129
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1757414	1759453	3944627		Streptococcus_phage(50.0%)	2	NA	NA
AVO87059.1|1757414_1758482_+	erythronate-4-phosphate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.2	9.2e-18
AVO87060.1|1758478_1759453_+	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.3	2.6e-27
>prophage 130
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1767178	1776388	3944627		Escherichia_phage(33.33%)	7	NA	NA
AVO87068.1|1767178_1768105_+	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.8e-15
AVO87069.1|1768540_1769290_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AVO87070.1|1769307_1770240_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AVO87071.1|1770605_1773320_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	8.7e-97
AVO87072.1|1773371_1775018_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AVO87073.1|1775027_1775408_-	GtrA family protein	NA	NA	NA	NA	NA
AVO87074.1|1775407_1776388_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	45.9	1.5e-67
>prophage 131
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1782666	1783746	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO87080.1|1782666_1783746_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	49.7	4.1e-90
>prophage 132
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1788061	1795943	3944627		Planktothrix_phage(20.0%)	7	NA	NA
AVO87084.1|1788061_1788748_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	35.2	7.6e-34
AVO87085.1|1788833_1791266_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	1.3e-27
AVO87086.1|1791218_1792202_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AVO87087.1|1792338_1793355_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	7.1e-12
AVO87088.1|1793373_1794183_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVO87089.1|1794246_1794876_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.4e-26
AVO87090.1|1794872_1795943_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
>prophage 133
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1804995	1805967	3944627		Klosneuvirus(100.0%)	1	NA	NA
AVO87099.1|1804995_1805967_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	9.4e-46
>prophage 134
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1816392	1827594	3944627		Burkholderia_phage(16.67%)	11	NA	NA
AVO87111.1|1816392_1820226_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.0	6.3e-109
AVO87112.1|1820308_1821514_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	28.8	3.2e-27
AVO87113.1|1821908_1822226_+	NGG1p interacting factor NIF3	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	29.4	6.5e-12
AVO87114.1|1822222_1823023_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVO87115.1|1823090_1823723_+	nicotinamide-nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	3.1e-21
AVO87116.1|1823793_1824363_-	CAP domain-containing protein	NA	NA	NA	NA	NA
AVO87117.1|1824484_1824946_-	peroxiredoxin	NA	NA	NA	NA	NA
AVO87118.1|1824963_1825650_-	ATPase	NA	NA	NA	NA	NA
AVO87119.1|1825741_1826158_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87120.1|1826171_1826855_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
AVO87121.1|1826883_1827594_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
>prophage 135
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1830612	1831674	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO87125.1|1830612_1831674_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 136
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1837284	1846268	3944627		Streptococcus_phage(50.0%)	9	NA	NA
AVO87132.1|1837284_1837884_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.1e-33
AVO87133.1|1838021_1838438_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AVO87134.1|1838492_1840136_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AVO89150.1|1840351_1841743_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
AVO87135.1|1841863_1842316_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVO87136.1|1842490_1844308_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
AVO87137.1|1844378_1845206_+	signal peptidase I	NA	NA	NA	NA	NA
AVO87138.1|1845229_1845604_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
AVO87139.1|1845575_1846268_+	ribonuclease 3	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
>prophage 137
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1855970	1859644	3944627		Pseudomonas_phage(50.0%)	3	NA	NA
AVO87152.1|1855970_1856762_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
AVO87153.1|1856941_1858963_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AVO87154.1|1859056_1859644_+	hypothetical protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
>prophage 138
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1865344	1866478	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO87158.1|1865344_1866478_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 139
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1872822	1873959	3944627		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVO87163.1|1872822_1873959_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.6	1.1e-24
>prophage 140
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1879762	1884632	3944627		Bodo_saltans_virus(50.0%)	4	NA	NA
AVO87169.1|1879762_1881205_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	33.1	6.5e-59
AVO87170.1|1881308_1881791_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVO87171.1|1881926_1883213_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVO87172.1|1883312_1884632_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.2	1.4e-36
>prophage 141
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1890252	1891509	3944627		Phage_21(100.0%)	1	NA	NA
AVO87176.1|1890252_1891509_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 142
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1897694	1900457	3944627		Tupanvirus(100.0%)	1	NA	NA
AVO87184.1|1897694_1900457_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 143
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1907432	1910270	3944627		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVO87193.1|1907432_1910270_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	5.6e-22
>prophage 144
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1916996	1918370	3944627		Klosneuvirus(100.0%)	1	NA	NA
AVO87201.1|1916996_1918370_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 145
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1922303	1931931	3944627	protease	Micromonas_sp._RCC1109_virus(25.0%)	7	NA	NA
AVO87205.1|1922303_1924025_+	pyruvate decarboxylase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	4.6e-27
AVO87206.1|1924165_1925545_+	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AVO87207.1|1926000_1927032_+	phosphonate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
AVO87208.1|1927132_1928512_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVO87209.1|1928535_1929906_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVO87210.1|1929919_1930822_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	8.0e-15
AVO87211.1|1930968_1931931_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
>prophage 146
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1935166	1936555	3944627		Bodo_saltans_virus(100.0%)	1	NA	NA
AVO87214.1|1935166_1936555_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 147
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1939748	1943780	3944627		Stx2-converting_phage(33.33%)	5	NA	NA
AVO87219.1|1939748_1940897_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
AVO87220.1|1941023_1941446_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87221.1|1941593_1941965_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87222.1|1942067_1942835_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
AVO87223.1|1942949_1943780_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
>prophage 148
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1972281	1976981	3944627		Vibrio_phage(66.67%)	3	NA	NA
AVO87243.1|1972281_1973208_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	37.0	1.2e-53
AVO87244.1|1973376_1975041_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-25
AVO87245.1|1975307_1976981_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.0	1.3e-31
>prophage 149
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1987146	1987353	3944627		Escherichia_phage(100.0%)	1	NA	NA
AVO87255.1|1987146_1987353_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	50.0	2.4e-07
>prophage 150
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	1998758	2005994	3944627		Tupanvirus(33.33%)	5	NA	NA
AVO87265.1|1998758_2000606_+	peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.7	2.1e-38
AVO87266.1|2000676_2002707_-	acinetobactin biosynthesis protein	NA	NA	NA	NA	NA
AVO87267.1|2003296_2004280_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.6	1.1e-62
AVO87268.1|2004279_2005227_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVO87269.1|2005223_2005994_+	siderophore ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.1e-17
>prophage 151
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2016497	2021096	3944627		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
AVO87275.1|2016497_2017649_+	histidine decarboxylase	NA	A7J7V4	Paramecium_bursaria_Chlorella_virus	33.7	6.1e-52
AVO87276.1|2017745_2017901_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89159.1|2017920_2019504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	1.7e-12
AVO87277.1|2019500_2021096_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	44.8	4.4e-24
>prophage 152
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2032644	2102540	3944627	tail,transposase,head,terminase,capsid	Acinetobacter_phage(97.26%)	87	NA	NA
AVO87287.1|2032644_2033199_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
AVO87288.1|2033455_2034955_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
AVO87289.1|2034956_2037332_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
AVO87290.1|2037338_2038322_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
AVO87291.1|2038332_2039028_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AVO87292.1|2039037_2039844_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
AVO89161.1|2039853_2040903_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AVO87293.1|2041258_2043991_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AVO87294.1|2044070_2046770_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AVO87295.1|2046865_2047450_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AVO87296.1|2047564_2047834_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
AVO87297.1|2047834_2048092_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	89.4	2.8e-42
AVO87298.1|2048095_2048380_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	95.7	7.5e-44
AVO87299.1|2048376_2048586_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	1.4e-31
AVO87300.1|2048582_2048990_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	97.1	2.0e-13
AVO87301.1|2048993_2049239_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVO87302.1|2049240_2050317_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	73.2	1.2e-137
AVO87303.1|2050313_2051435_-	AAA family ATPase	NA	A0A0D4DBX7	Acinetobacter_phage	99.5	4.8e-211
AVO87304.1|2051446_2051770_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AVO87305.1|2051762_2052053_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AVO87306.1|2052052_2052493_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	100.0	2.3e-76
AVO87307.1|2052693_2053722_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	36.7	1.8e-58
AVO87308.1|2053782_2054472_-	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	7.6e-58
AVO87309.1|2054599_2054776_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87310.1|2054772_2055036_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87311.1|2055083_2055356_+	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	98.9	3.7e-40
AVO87312.1|2055352_2055649_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	100.0	1.6e-49
AVO87313.1|2055645_2055999_+	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	97.5	2.0e-54
AVO87314.1|2055998_2056928_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	6.2e-172
AVO87315.1|2056920_2057670_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.0	2.6e-136
AVO87316.1|2057666_2057801_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
AVO87317.1|2057787_2058210_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AVO89162.1|2058259_2058622_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AVO87318.1|2058614_2058884_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87319.1|2059237_2059810_+	hypothetical protein	NA	A0A0P0J0G5	Acinetobacter_phage	91.7	1.9e-33
AVO87320.1|2059809_2060205_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	8.8e-67
AVO87321.1|2060201_2060699_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	96.4	6.0e-89
AVO87322.1|2060813_2061449_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87323.1|2061509_2061728_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87324.1|2061813_2062005_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
AVO87325.1|2062017_2062446_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	67.6	2.4e-46
AVO87326.1|2062414_2063056_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.5	6.1e-126
AVO87327.1|2063114_2063585_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AVO87328.1|2063574_2065002_+|terminase	terminase	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
AVO87329.1|2064998_2066450_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
AVO87330.1|2066451_2067555_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
AVO87331.1|2067563_2067992_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
AVO87332.1|2068090_2068333_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
AVO87333.1|2068550_2068742_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVO87334.1|2068855_2069623_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AVO87335.1|2069650_2070607_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
AVO87336.1|2070672_2071338_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
AVO87337.1|2071342_2071732_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
AVO87338.1|2071733_2072102_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.9	4.2e-63
AVO87339.1|2072139_2072808_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87340.1|2073028_2073433_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	90.2	9.3e-64
AVO87341.1|2073404_2073773_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	85.2	6.1e-54
AVO87342.1|2073774_2074173_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	95.5	4.2e-69
AVO87343.1|2074241_2074595_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	96.6	1.0e-58
AVO87344.1|2074594_2075950_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	97.3	8.2e-197
AVO87345.1|2076002_2076920_+	hypothetical protein	NA	A0A0P0IKN0	Acinetobacter_phage	94.8	1.8e-163
AVO87346.1|2076989_2077505_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	98.5	1.1e-72
AVO87347.1|2077432_2077762_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	62.4	3.5e-29
AVO87348.1|2078055_2078766_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
AVO87349.1|2078880_2079810_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
AVO87350.1|2080018_2080255_+	transcriptional regulator	NA	NA	NA	NA	NA
AVO87351.1|2080341_2080863_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
AVO87352.1|2080881_2081157_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87353.1|2081234_2085542_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.7	0.0e+00
AVO87354.1|2085699_2086458_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	100.0	1.6e-141
AVO87355.1|2086450_2086837_+	hypothetical protein	NA	J7I476	Acinetobacter_phage	100.0	3.3e-66
AVO87356.1|2086898_2087297_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AVO87357.1|2087296_2087803_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
AVO87358.1|2087799_2088162_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
AVO87359.1|2088154_2091601_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
AVO87360.1|2091668_2092058_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AVO87361.1|2092256_2092598_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87362.1|2092601_2092928_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87363.1|2092984_2093476_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87364.1|2093495_2093756_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVO87365.1|2093921_2094821_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AVO87366.1|2095159_2095702_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	99.4	2.0e-101
AVO87367.1|2096135_2096330_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
AVO87368.1|2096326_2097523_-	DUF4102 domain-containing protein	NA	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
AVO87369.1|2098010_2099813_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
AVO87370.1|2099934_2101024_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVO87371.1|2100986_2102540_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	8.9e-280
>prophage 153
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2110864	2113328	3944627	tRNA	Pithovirus(50.0%)	2	NA	NA
AVO87380.1|2110864_2112040_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
AVO87381.1|2112089_2113328_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
>prophage 154
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2120559	2121942	3944627		Pandoravirus(100.0%)	1	NA	NA
AVO87386.1|2120559_2121942_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.4	1.5e-41
>prophage 155
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2139718	2140336	3944627		Synechococcus_phage(100.0%)	1	NA	NA
AVO87403.1|2139718_2140336_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	2.1e-22
>prophage 156
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2143592	2156327	3944627		Vibrio_phage(20.0%)	10	NA	NA
AVO87407.1|2143592_2144405_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
AVO87408.1|2144401_2145175_-	ABC transporter permease	NA	NA	NA	NA	NA
AVO87409.1|2145171_2146107_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
AVO87410.1|2146400_2147033_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87411.1|2147180_2147867_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
AVO87412.1|2148116_2149346_+	triacylglycerol lipase	NA	NA	NA	NA	NA
AVO87413.1|2149405_2150233_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
AVO87414.1|2150392_2151646_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
AVO87415.1|2151686_2153135_-	RND transporter	NA	NA	NA	NA	NA
AVO87416.1|2153147_2156327_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
>prophage 157
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2161243	2164294	3944627		Planktothrix_phage(33.33%)	4	NA	NA
AVO87422.1|2161243_2162020_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	36.4	3.1e-23
AVO87423.1|2162091_2162421_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVO87424.1|2162657_2162921_-	(4Fe-4S)-binding protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	1.5e-17
AVO87425.1|2162923_2164294_-	U32 family peptidase	NA	Q6DW11	Phage_TP	62.9	2.6e-126
>prophage 158
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2171989	2174474	3944627		Bacillus_phage(66.67%)	3	NA	NA
AVO87431.1|2171989_2172349_+	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
AVO87432.1|2172456_2173119_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.1	5.0e-22
AVO87433.1|2173115_2174474_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.8	7.6e-17
>prophage 159
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2180300	2181314	3944627		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVO87440.1|2180300_2181314_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.2e-77
>prophage 160
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2196287	2199375	3944627		Salicola_phage(33.33%)	4	NA	NA
AVO87455.1|2196287_2197154_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
AVO87456.1|2197287_2197533_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
AVO87457.1|2197907_2198120_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
AVO87458.1|2198205_2199375_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
>prophage 161
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2205547	2214294	3944627	tRNA	Mollivirus(25.0%)	8	NA	NA
AVO87467.1|2205547_2207089_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	1.5e-85
AVO87468.1|2207167_2209057_+	peptidase M48	NA	NA	NA	NA	NA
AVO87469.1|2209157_2209808_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87470.1|2209819_2210785_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
AVO89164.1|2210931_2212359_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87471.1|2212449_2212896_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
AVO87472.1|2212922_2213138_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVO87473.1|2213283_2214294_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
>prophage 162
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2218058	2218862	3944627		Iragoides_fasciata_nucleopolyhedrovirus(100.0%)	1	NA	NA
AVO87477.1|2218058_2218862_+	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.0e-05
>prophage 163
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2245272	2246760	3944627		Burkholderia_virus(100.0%)	1	NA	NA
AVO87505.1|2245272_2246760_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.9	6.1e-60
>prophage 164
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2261856	2281693	3944627	integrase,transposase	Escherichia_phage(33.33%)	19	2261794:2261853	2280926:2281745
2261794:2261853	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVO87518.1|2261856_2262561_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVO89166.1|2262723_2263440_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.6e-138
AVO87519.1|2263330_2264290_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.3e-47
AVO87520.1|2264469_2265024_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AVO89167.1|2265116_2265749_+	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
AVO87521.1|2265806_2266598_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVO87522.1|2266761_2267109_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVO87523.1|2267102_2267942_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVO87524.1|2268346_2269888_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVO89168.1|2271286_2272060_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AVO87525.1|2272040_2272322_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87526.1|2272541_2272727_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87527.1|2272775_2273960_+|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AVO87528.1|2274358_2275834_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AVO87529.1|2275889_2276774_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVO87530.1|2277417_2278977_-|transposase	IS66 family transposase ISAba24	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
AVO87531.1|2279069_2279426_-	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
AVO87532.1|2279428_2279713_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVO89169.1|2280988_2281693_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
2280926:2281745	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 165
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2287862	2293065	3944627		Planktothrix_phage(50.0%)	4	NA	NA
AVO87538.1|2287862_2288888_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
AVO87539.1|2288963_2289830_-	NLPA lipoprotein	NA	NA	NA	NA	NA
AVO87540.1|2290078_2291365_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVO87541.1|2291490_2293065_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
>prophage 166
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2304539	2305985	3944627		Escherichia_phage(100.0%)	1	NA	NA
AVO87553.1|2304539_2305985_-	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
>prophage 167
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2313474	2315853	3944627		Hokovirus(100.0%)	1	NA	NA
AVO87563.1|2313474_2315853_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 168
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2330404	2331244	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO87577.1|2330404_2331244_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.9	1.4e-24
>prophage 169
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2335806	2345182	3944627		Staphylococcus_phage(33.33%)	8	NA	NA
AVO87582.1|2335806_2337450_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	37.5	1.8e-76
AVO87583.1|2337494_2338073_-	flavin reductase	NA	NA	NA	NA	NA
AVO87584.1|2338242_2339019_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
AVO87585.1|2339077_2340376_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.3	7.5e-107
AVO87586.1|2340391_2340772_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVO87587.1|2340728_2341166_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AVO87588.1|2341424_2343134_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVO87589.1|2343142_2345182_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.4	3.6e-39
>prophage 170
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2374498	2376451	3944627		Wolbachia_phage(100.0%)	1	NA	NA
AVO87612.1|2374498_2376451_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.5e-84
>prophage 171
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2380796	2383202	3944627	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVO87619.1|2380796_2381306_-	cyclophilin	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
AVO87620.1|2381474_2383202_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
>prophage 172
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2393807	2395520	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO87629.1|2393807_2395520_+	helicase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.7e-77
>prophage 173
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2413146	2413617	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO87644.1|2413146_2413617_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	4.9e-32
>prophage 174
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2421370	2429296	3944627		Hokovirus(33.33%)	6	NA	NA
AVO87653.1|2421370_2422954_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	25.3	1.7e-20
AVO87654.1|2423213_2423657_-	universal stress protein	NA	NA	NA	NA	NA
AVO87655.1|2423945_2424173_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87656.1|2424797_2425241_+	RDD family protein	NA	NA	NA	NA	NA
AVO87657.1|2425804_2428561_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.2	6.4e-39
AVO87658.1|2428576_2429296_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
>prophage 175
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2438761	2444497	3944627		Tupanvirus(33.33%)	4	NA	NA
AVO87667.1|2438761_2440021_+	esterase	NA	A0A2K9L1U3	Tupanvirus	23.6	2.8e-13
AVO87668.1|2440068_2440647_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVO87669.1|2440772_2442251_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.4	7.9e-28
AVO87670.1|2442424_2444497_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.6	1.1e-40
>prophage 176
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2460267	2514008	3944627	head,terminase,tail,transposase	Acinetobacter_phage(95.65%)	81	NA	NA
AVO87681.1|2460267_2461530_+	DUF4102 domain-containing protein	NA	A0A0P0IKP2	Acinetobacter_phage	99.0	3.6e-247
AVO87682.1|2461535_2461805_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AVO87683.1|2461805_2462063_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.5	3.2e-46
AVO87684.1|2462066_2462351_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.3e-43
AVO87685.1|2462343_2462754_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	100.0	7.6e-13
AVO87686.1|2462757_2463003_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVO87687.1|2463004_2464006_-	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	97.3	6.5e-183
AVO87688.1|2464002_2465124_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
AVO89178.1|2465135_2465459_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	99.1	1.5e-56
AVO87689.1|2465461_2465902_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	97.2	3.1e-73
AVO87690.1|2466108_2466612_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
AVO87691.1|2466614_2467616_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
AVO87692.1|2467666_2467882_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AVO87693.1|2467896_2468661_-	XRE family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	96.0	7.0e-137
AVO87694.1|2468738_2468924_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	98.4	1.4e-27
AVO87695.1|2468933_2469290_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AVO89179.1|2469345_2469621_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
AVO87696.1|2469617_2469914_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	95.9	1.7e-46
AVO87697.1|2469910_2470273_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.1	2.4e-55
AVO87698.1|2470265_2471195_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	100.0	4.3e-173
AVO87699.1|2471187_2471937_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
AVO87700.1|2471933_2472068_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
AVO87701.1|2472054_2472477_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AVO89180.1|2472526_2472889_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AVO87702.1|2472881_2473106_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVO87703.1|2473105_2473507_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
AVO87704.1|2473517_2474270_+	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
AVO87705.1|2474413_2474632_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87706.1|2474898_2475252_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87707.1|2475483_2476305_+|transposase	IS5 family transposase ISAba27	transposase	NA	NA	NA	NA
AVO87708.1|2476337_2476574_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87709.1|2477235_2477691_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.7	7.2e-81
AVO87710.1|2477751_2478219_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	81.9	3.6e-67
AVO87711.1|2478187_2478829_+	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	93.9	3.6e-118
AVO87712.1|2478888_2479446_+	DUF2280 domain-containing protein	NA	A0A0P0IKR0	Acinetobacter_phage	100.0	2.5e-83
AVO87713.1|2479429_2480746_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	100.0	1.6e-266
AVO87714.1|2480785_2482132_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	100.0	6.5e-255
AVO87715.1|2482141_2483248_+|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	100.0	1.2e-206
AVO87716.1|2483256_2483685_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
AVO87717.1|2483783_2484026_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	2.1e-39
AVO87718.1|2484243_2484435_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVO87719.1|2484542_2485298_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	100.0	1.6e-130
AVO87720.1|2485311_2486262_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	100.0	1.1e-179
AVO87721.1|2486306_2486642_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
AVO87722.1|2486645_2487026_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	100.0	4.8e-62
AVO87723.1|2487026_2487395_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	100.0	2.6e-65
AVO87724.1|2487403_2487808_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	100.0	4.6e-71
AVO87725.1|2487779_2488148_+	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	99.1	5.0e-56
AVO87726.1|2488149_2488548_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	100.0	2.2e-73
AVO87727.1|2488549_2488768_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	100.0	2.4e-34
AVO87728.1|2488861_2489215_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	100.0	1.2e-59
AVO87729.1|2489214_2490450_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	80.1	2.8e-188
AVO87730.1|2490502_2491420_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.4	7.3e-165
AVO87731.1|2491489_2492005_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	97.1	2.0e-71
AVO87732.1|2491932_2492262_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	59.0	1.3e-26
AVO87733.1|2492330_2492513_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AVO87734.1|2492605_2493010_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AVO87735.1|2493108_2493285_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.8e-09
AVO87736.1|2493293_2493617_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVO87737.1|2493648_2494443_+	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	42.2	1.7e-05
AVO87738.1|2494491_2494731_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVO87739.1|2494853_2495009_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVO87740.1|2495005_2495998_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.9	9.7e-22
AVO87741.1|2496067_2500375_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AVO87742.1|2500449_2501202_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AVO87743.1|2501205_2501598_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87744.1|2501662_2502061_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AVO87745.1|2502060_2502567_+	DUF1833 domain-containing protein	NA	A0A0P0IKN4	Acinetobacter_phage	95.2	5.5e-90
AVO87746.1|2502563_2502926_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	99.2	1.2e-65
AVO87747.1|2502918_2506365_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
AVO87748.1|2506432_2506822_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AVO87749.1|2507020_2507362_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87750.1|2507365_2507692_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87751.1|2507748_2508240_+	hypothetical protein	NA	NA	NA	NA	NA
AVO87752.1|2508259_2508520_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVO87753.1|2508685_2509585_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AVO87754.1|2509923_2510469_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	98.9	2.6e-101
AVO87755.1|2510658_2511339_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
AVO87756.1|2511349_2511997_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
AVO87757.1|2512003_2512597_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
AVO87758.1|2512842_2514008_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
>prophage 177
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2518866	2520195	3944627		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVO87763.1|2518866_2520195_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	1.4e-100
>prophage 178
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2540170	2542640	3944627		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
AVO87779.1|2540170_2540482_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.0e-18
AVO87780.1|2540501_2540786_-	DsrH like protein	NA	NA	NA	NA	NA
AVO87781.1|2540803_2541154_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87782.1|2541198_2541567_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	8.9e-13
AVO87783.1|2541632_2542640_+	KR domain-containing protein	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
>prophage 179
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2559711	2560464	3944627		Flavobacterium_phage(100.0%)	1	NA	NA
AVO87800.1|2559711_2560464_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	4.3e-22
>prophage 180
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2571203	2572253	3944627		Bacillus_phage(100.0%)	1	NA	NA
AVO87810.1|2571203_2572253_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 181
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2580691	2588762	3944627	protease	Tupanvirus(25.0%)	6	NA	NA
AVO87820.1|2580691_2581870_+|protease	serine protease	protease	A0A2K9L570	Tupanvirus	40.6	3.2e-32
AVO87821.1|2581917_2583372_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.3	1.0e-181
AVO87822.1|2583609_2584248_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	54.5	2.7e-57
AVO87823.1|2584602_2586045_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
AVO87824.1|2586099_2586543_-	universal stress protein	NA	NA	NA	NA	NA
AVO87825.1|2586668_2588762_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.2	1.3e-15
>prophage 182
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2594089	2596948	3944627		Hokovirus(100.0%)	1	NA	NA
AVO87830.1|2594089_2596948_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.2	5.1e-15
>prophage 183
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2633018	2637567	3944627	protease	uncultured_Mediterranean_phage(25.0%)	4	NA	NA
AVO87867.1|2633018_2633432_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
AVO87868.1|2633441_2635718_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
AVO87869.1|2635721_2636084_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
AVO87870.1|2636511_2637567_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.8	1.4e-82
>prophage 184
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2645451	2649313	3944627		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
AVO87879.1|2645451_2647089_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	8.2e-151
AVO87880.1|2647120_2647978_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
AVO87881.1|2648023_2649313_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
>prophage 185
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2660117	2660945	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO89189.1|2660117_2660945_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.8	1.1e-18
>prophage 186
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2717027	2718662	3944627		Staphylococcus_phage(100.0%)	1	NA	NA
AVO87938.1|2717027_2718662_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	24.2	2.2e-18
>prophage 187
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2724673	2730829	3944627		Mycobacterium_phage(33.33%)	6	NA	NA
AVO87944.1|2724673_2725504_+	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	29.8	4.8e-14
AVO87945.1|2725580_2727101_+	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	5.4e-96
AVO87946.1|2727124_2727388_-	hypothetical protein	NA	NA	NA	NA	NA
AVO87947.1|2727569_2728613_-	acetoacetate decarboxylase	NA	NA	NA	NA	NA
AVO87948.1|2728812_2729619_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AVO87949.1|2729818_2730829_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	38.2	4.9e-61
>prophage 188
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2750105	2758301	3944627		Moraxella_phage(100.0%)	2	NA	NA
AVO87967.1|2750105_2751851_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	29.7	1.3e-69
AVO87968.1|2751875_2758301_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	26.7	6.8e-116
>prophage 189
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2770822	2771800	3944627		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVO87981.1|2770822_2771800_-	3-phosphoglycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	31.2	1.2e-29
>prophage 190
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2794757	2806982	3944627		Bacillus_virus(33.33%)	12	NA	NA
AVO87998.1|2794757_2795810_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
AVO87999.1|2796240_2797260_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVO88000.1|2797262_2798273_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVO88001.1|2798269_2799034_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.2e-16
AVO88002.1|2799036_2799525_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVO88003.1|2799519_2800308_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVO88004.1|2800403_2801216_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVO88005.1|2801397_2802282_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	39.0	1.2e-34
AVO88006.1|2802293_2803787_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	51.1	6.3e-142
AVO88007.1|2803847_2804615_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	32.2	1.5e-25
AVO88008.1|2804688_2806083_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AVO88009.1|2806637_2806982_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	39.3	2.0e-14
>prophage 191
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2825691	2826132	3944627		Vibrio_phage(100.0%)	1	NA	NA
AVO88029.1|2825691_2826132_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	6.2e-13
>prophage 192
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2829384	2829879	3944627		Haemophilus_phage(100.0%)	1	NA	NA
AVO88033.1|2829384_2829879_+	DNA-binding protein	NA	Q7Y5W2	Haemophilus_phage	54.9	3.5e-28
>prophage 193
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2838494	2843681	3944627		Leptospira_phage(66.67%)	3	NA	NA
AVO88042.1|2838494_2839238_-	efflux system DNA-binding response regulator AdeR	NA	W8CYM9	Bacillus_phage	30.2	7.5e-27
AVO88043.1|2839383_2840574_+	AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	22.4	8.1e-07
AVO88044.1|2840570_2843681_+	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	6.1e-62
>prophage 194
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2863986	2870266	3944627	capsid	Prochlorococcus_phage(33.33%)	5	NA	NA
AVO88061.1|2863986_2865096_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	6.8e-32
AVO89200.1|2865325_2867020_-|capsid	phage capsid protein	capsid	A0A076G822	Escherichia_phage	37.5	2.0e-104
AVO88062.1|2867379_2868543_+	catalase	NA	NA	NA	NA	NA
AVO88063.1|2868620_2868986_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88064.1|2869798_2870266_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	2.3e-37
>prophage 195
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2885824	2886445	3944627		Planktothrix_phage(100.0%)	1	NA	NA
AVO88079.1|2885824_2886445_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	7.7e-17
>prophage 196
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2896034	2896820	3944627		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVO88090.1|2896034_2896820_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	1.4e-10
>prophage 197
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2919814	2923240	3944627		Burkholderia_virus(50.0%)	4	NA	NA
AVO88109.1|2919814_2921101_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	8.1e-37
AVO88110.1|2921140_2921422_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
AVO88111.1|2921405_2922404_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
AVO88112.1|2922400_2923240_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
>prophage 198
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2928593	2929943	3944627		Ochrobactrum_phage(100.0%)	1	NA	NA
AVO88118.1|2928593_2929943_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 199
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2952062	2953154	3944627		Pandoravirus(100.0%)	1	NA	NA
AVO88139.1|2952062_2953154_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 200
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2976831	2978589	3944627		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVO88169.1|2976831_2978589_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	2.8e-19
>prophage 201
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	2987222	2990826	3944627		Edwardsiella_phage(50.0%)	3	NA	NA
AVO88178.1|2987222_2988332_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	5.5e-82
AVO88179.1|2988407_2989151_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AVO88180.1|2989257_2990826_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.5	2.4e-115
>prophage 202
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3013109	3018566	3944627		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
AVO88200.1|3013109_3014483_+	ABC transporter	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
AVO88201.1|3014703_3015996_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVO88202.1|3016017_3017223_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVO88203.1|3017342_3018566_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.6	7.2e-51
>prophage 203
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3021739	3022012	3944627		Burkholderia_phage(100.0%)	1	NA	NA
AVO88206.1|3021739_3022012_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 204
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3025364	3030477	3944627		Lake_Baikal_phage(50.0%)	6	NA	NA
AVO88211.1|3025364_3025751_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
AVO88212.1|3025781_3026102_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
AVO88213.1|3026187_3026706_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVO88214.1|3026744_3028604_+	molecular chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.4	8.0e-102
AVO88215.1|3028622_3028961_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVO88216.1|3029007_3030477_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
>prophage 205
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3041187	3047832	3944627		uncultured_virus(33.33%)	5	NA	NA
AVO88228.1|3041187_3041922_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
AVO88229.1|3041954_3043685_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
AVO88230.1|3043697_3044840_-	ABC transporter permease	NA	NA	NA	NA	NA
AVO88231.1|3044847_3045786_-	ABC transporter permease	NA	NA	NA	NA	NA
AVO88232.1|3045798_3047832_-	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.7	3.1e-75
>prophage 206
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3052237	3054907	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO88235.1|3052237_3054907_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.4	1.6e-42
>prophage 207
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3066805	3067108	3944627		Burkholderia_phage(100.0%)	1	NA	NA
AVO88247.1|3066805_3067108_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 208
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3070249	3072594	3944627	tRNA	Pandoravirus(50.0%)	3	NA	NA
AVO88251.1|3070249_3070753_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	6.5e-06
AVO88252.1|3070759_3071884_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AVO88253.1|3071880_3072594_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
>prophage 209
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3080631	3085151	3944627		Bacillus_phage(33.33%)	5	NA	NA
AVO88265.1|3080631_3082359_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.6	5.0e-58
AVO88266.1|3082355_3082784_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AVO88267.1|3082799_3083435_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
AVO88268.1|3083484_3084372_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
AVO88269.1|3084368_3085151_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	5.7e-17
>prophage 210
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3101520	3108054	3944627		Bacillus_phage(33.33%)	6	NA	NA
AVO88286.1|3101520_3103368_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
AVO88287.1|3103367_3103808_+	dehydratase	NA	NA	NA	NA	NA
AVO88288.1|3103916_3104942_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVO88289.1|3104980_3105355_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AVO88290.1|3105457_3106156_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.1	1.9e-32
AVO88291.1|3106563_3108054_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
>prophage 211
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3120081	3121248	3944627		Staphylococcus_phage(100.0%)	1	NA	NA
AVO88302.1|3120081_3121248_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 212
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3143812	3145045	3944627		Moraxella_phage(100.0%)	1	NA	NA
AVO88326.1|3143812_3145045_-	DUF4102 domain-containing protein	NA	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
>prophage 213
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3151032	3151776	3944627		Planktothrix_phage(100.0%)	1	NA	NA
AVO88333.1|3151032_3151776_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 214
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3161528	3162605	3944627		Planktothrix_phage(100.0%)	1	NA	NA
AVO88343.1|3161528_3162605_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
>prophage 215
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3175355	3175841	3944627		Fowlpox_virus(100.0%)	1	NA	NA
AVO88356.1|3175355_3175841_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 216
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3181667	3185231	3944627		Streptomyces_phage(100.0%)	1	NA	NA
AVO88361.1|3181667_3185231_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	6.7e-174
>prophage 217
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3190114	3191680	3944627		Lactococcus_phage(100.0%)	1	NA	NA
AVO88365.1|3190114_3191680_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.3e-25
>prophage 218
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3195172	3196015	3944627		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AVO88370.1|3195172_3195502_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
AVO88371.1|3195586_3196015_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.1	2.6e-40
>prophage 219
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3205271	3206066	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO88381.1|3205271_3206066_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	37.1	9.8e-33
>prophage 220
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3230388	3231879	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO88405.1|3230388_3231879_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.4	4.2e-21
>prophage 221
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3239446	3242315	3944627		Tupanvirus(50.0%)	2	NA	NA
AVO88414.1|3239446_3240379_+	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
AVO88415.1|3240353_3242315_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	5.0e-94
>prophage 222
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3246534	3253719	3944627		Planktothrix_phage(50.0%)	7	NA	NA
AVO88421.1|3246534_3247266_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
AVO88422.1|3247268_3247934_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVO88423.1|3247923_3248559_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVO88424.1|3248647_3248761_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88425.1|3248870_3249155_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVO88426.1|3249298_3250258_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVO88427.1|3250254_3253719_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	8.6e-33
>prophage 223
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3256883	3267376	3944627		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
AVO88431.1|3256883_3257495_-	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	2.2e-48
AVO88432.1|3257777_3258014_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88433.1|3258074_3259247_-	stress-induced protein	NA	NA	NA	NA	NA
AVO88434.1|3259731_3260145_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88435.1|3260286_3261165_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.4	3.8e-54
AVO88436.1|3261221_3263366_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
AVO88437.1|3263420_3264830_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
AVO88438.1|3265145_3265625_+	damage-inducible protein CinA	NA	A0A218MNG4	uncultured_virus	50.3	1.8e-34
AVO88439.1|3265909_3266131_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88440.1|3266236_3266554_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88441.1|3266638_3266860_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88442.1|3266947_3267376_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
>prophage 224
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3273620	3282702	3944627		Staphylococcus_phage(33.33%)	7	NA	NA
AVO88447.1|3273620_3275315_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.2e-26
AVO89211.1|3275426_3276020_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVO88448.1|3276188_3277361_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVO88449.1|3277385_3278987_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
AVO88450.1|3278996_3279800_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVO88451.1|3279811_3281803_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
AVO88452.1|3281799_3282702_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.6	7.9e-47
>prophage 225
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3298803	3299565	3944627		Bacillus_phage(100.0%)	1	NA	NA
AVO88464.1|3298803_3299565_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 226
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3316937	3318140	3944627		Bacillus_virus(100.0%)	1	NA	NA
AVO88479.1|3316937_3318140_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	6.4e-28
>prophage 227
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3376249	3377470	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO88538.1|3376249_3377470_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.7	1.2e-32
>prophage 228
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3392917	3396094	3944627		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVO88547.1|3392917_3396094_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	64.1	9.7e-257
>prophage 229
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3399457	3399916	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO88551.1|3399457_3399916_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
>prophage 230
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3407324	3408257	3944627		Morganella_phage(100.0%)	1	NA	NA
AVO88559.1|3407324_3408257_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 231
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3411964	3437358	3944627	head,tRNA	Acinetobacter_phage(25.0%)	26	NA	NA
AVO88563.1|3411964_3414610_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
AVO89214.1|3414674_3415205_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVO88564.1|3415549_3415873_+	ferredoxin family protein	NA	NA	NA	NA	NA
AVO88565.1|3416053_3416725_+	peptidase M15	NA	NA	NA	NA	NA
AVO88566.1|3416864_3417533_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
AVO88567.1|3417649_3418492_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
AVO88568.1|3418647_3419259_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
AVO88569.1|3419251_3419851_-	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
AVO88570.1|3419943_3421134_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVO88571.1|3421130_3423272_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
AVO88572.1|3423268_3424735_-	RND transporter	NA	NA	NA	NA	NA
AVO88573.1|3425009_3425756_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
AVO88574.1|3425755_3426304_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVO88575.1|3426287_3426836_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVO88576.1|3426873_3427413_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AVO88577.1|3427416_3428394_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
AVO88578.1|3428607_3430029_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
AVO88579.1|3430529_3431159_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88580.1|3431543_3432137_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
AVO88581.1|3432716_3432863_-	peptidoglycan-binding protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
AVO89215.1|3432876_3433143_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88582.1|3433292_3433739_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO88583.1|3433850_3435065_+	MFS transporter	NA	NA	NA	NA	NA
AVO88584.1|3435059_3436166_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	66.9	4.5e-145
AVO88585.1|3436263_3436608_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88586.1|3436899_3437358_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
>prophage 232
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3440527	3453207	3944627	transposase	Acinetobacter_phage(57.14%)	17	NA	NA
AVO88591.1|3440527_3440743_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
AVO88592.1|3441262_3441880_+	LysE family translocator	NA	NA	NA	NA	NA
AVO88593.1|3441946_3442492_-	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	7.8e-74
AVO88594.1|3442529_3442919_-	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
AVO88595.1|3443086_3443284_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88596.1|3443519_3444191_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	55.2	3.1e-64
AVO88597.1|3444342_3444576_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO88598.1|3445081_3446344_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.8	1.9e-14
AVO88599.1|3446336_3446531_+	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
AVO88600.1|3446755_3446980_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88601.1|3447030_3447624_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AVO88602.1|3447856_3448039_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88603.1|3448065_3448395_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
AVO88604.1|3448874_3449231_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AVO88605.1|3449823_3450231_-	GFA family protein	NA	NA	NA	NA	NA
AVO88606.1|3450258_3450660_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVO88607.1|3450735_3453207_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	1.0e-96
>prophage 233
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3464322	3472238	3944627		Catovirus(50.0%)	6	NA	NA
AVO88618.1|3464322_3468180_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
AVO88619.1|3468532_3469096_+	peroxiredoxin	NA	NA	NA	NA	NA
AVO88620.1|3469288_3469504_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVO88621.1|3469568_3470156_-	O-methyltransferase	NA	NA	NA	NA	NA
AVO88622.1|3470192_3470411_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
AVO88623.1|3470672_3472238_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	3.0e-25
>prophage 234
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3486127	3490360	3944627		uncultured_virus(33.33%)	3	NA	NA
AVO88636.1|3486127_3486616_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
AVO88637.1|3486672_3489252_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
AVO88638.1|3489553_3490360_+	M23 family peptidase	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
>prophage 235
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3497425	3510390	3944627	tRNA	Megavirus(20.0%)	11	NA	NA
AVO88647.1|3497425_3498745_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
AVO88648.1|3498809_3499976_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVO88649.1|3500251_3501277_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVO88650.1|3501546_3504183_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AVO88651.1|3504248_3505529_+	aspartate kinase	NA	NA	NA	NA	NA
AVO88652.1|3505775_3506030_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AVO88653.1|3506099_3506666_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
AVO88654.1|3506731_3507121_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88655.1|3507359_3507917_+	cytochrome b	NA	NA	NA	NA	NA
AVO88656.1|3507960_3508959_-	adenosine deaminase	NA	NA	NA	NA	NA
AVO88657.1|3509070_3510390_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
>prophage 236
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3519527	3523178	3944627	transposase	Escherichia_phage(50.0%)	4	NA	NA
AVO88666.1|3519527_3520232_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO88667.1|3520243_3520453_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AVO88668.1|3520851_3521946_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AVO88669.1|3521942_3523178_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.2e-23
>prophage 237
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3537608	3545571	3944627		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AVO88685.1|3537608_3542306_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	4.4e-40
AVO88686.1|3542376_3545571_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	51.9	2.0e-278
>prophage 238
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3554880	3559376	3944627		Dickeya_phage(33.33%)	4	NA	NA
AVO88692.1|3554880_3556224_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
AVO88693.1|3556282_3557545_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
AVO88694.1|3557694_3558729_+	dihydroorotase	NA	NA	NA	NA	NA
AVO88695.1|3558713_3559376_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
>prophage 239
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3563256	3564846	3944627		Planktothrix_phage(100.0%)	1	NA	NA
AVO88698.1|3563256_3564846_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
>prophage 240
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3568766	3573594	3944627		Lactobacillus_phage(50.0%)	2	NA	NA
AVO88700.1|3568766_3571982_-	lytic transglycosylase	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
AVO89220.1|3572214_3573594_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
>prophage 241
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3578387	3579224	3944627		Streptococcus_phage(100.0%)	1	NA	NA
AVO88705.1|3578387_3579224_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
>prophage 242
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3588811	3590185	3944627		Moraxella_phage(100.0%)	1	NA	NA
AVO88718.1|3588811_3590185_+	DUF4102 domain-containing protein	NA	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
>prophage 243
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3595801	3624475	3944627	terminase,tail,head	Acinetobacter_phage(93.75%)	38	NA	NA
AVO89222.1|3595801_3596347_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
AVO88722.1|3596388_3596778_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AVO88723.1|3596845_3600271_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
AVO88724.1|3600263_3600626_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
AVO88725.1|3600622_3601129_-	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
AVO88726.1|3601128_3601527_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
AVO88727.1|3601619_3602207_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88728.1|3602297_3606608_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AVO88729.1|3606735_3606999_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88730.1|3607000_3607681_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVO88731.1|3607785_3608244_-	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AVO88732.1|3608252_3608552_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AVO88733.1|3608797_3609127_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
AVO88734.1|3609054_3609570_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AVO88735.1|3609639_3610557_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
AVO88736.1|3610609_3611788_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
AVO88737.1|3611787_3612141_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AVO88738.1|3612237_3612759_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AVO88739.1|3612867_3613086_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AVO88740.1|3613087_3613531_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
AVO88741.1|3613487_3613856_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
AVO88742.1|3613827_3614238_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
AVO88743.1|3614289_3614583_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88744.1|3614590_3614788_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88745.1|3614856_3615225_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AVO88746.1|3615225_3615606_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AVO88747.1|3615609_3615945_-	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
AVO88748.1|3615989_3616940_-	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AVO88749.1|3616953_3617745_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AVO88750.1|3617831_3618146_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AVO88751.1|3618365_3618596_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88752.1|3618592_3619699_-|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AVO88753.1|3619708_3621049_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AVO88754.1|3621088_3622381_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
AVO88755.1|3622340_3622856_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AVO88756.1|3622914_3623556_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AVO88757.1|3623524_3623959_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
AVO88758.1|3624019_3624475_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 244
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3628433	3640781	3944627		Acinetobacter_phage(95.65%)	24	NA	NA
AVO88765.1|3628433_3628910_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVO88766.1|3628906_3629308_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
AVO88767.1|3629307_3629700_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
AVO88768.1|3629692_3630031_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
AVO88769.1|3630027_3630828_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
AVO88770.1|3630830_3631712_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
AVO88771.1|3631704_3631929_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
AVO88772.1|3632000_3632279_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.2	6.6e-37
AVO88773.1|3632334_3632655_-	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
AVO88774.1|3632665_3632854_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88775.1|3632958_3633711_+	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
AVO88776.1|3633725_3633941_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVO88777.1|3633992_3635000_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVO88778.1|3635001_3635505_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVO88779.1|3635643_3635847_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVO88780.1|3635853_3636096_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AVO88781.1|3636289_3636733_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
AVO88782.1|3636732_3637023_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AVO88783.1|3637015_3637339_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AVO88784.1|3637350_3638472_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AVO88785.1|3638468_3639401_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AVO88786.1|3639402_3639654_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AVO88787.1|3639654_3640062_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AVO88788.1|3640058_3640781_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 245
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3651767	3654197	3944627	protease	Moraxella_phage(100.0%)	1	NA	NA
AVO88795.1|3651767_3654197_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 246
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3681035	3687132	3944627	tRNA	Hokovirus(50.0%)	5	NA	NA
AVO88822.1|3681035_3682649_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
AVO88823.1|3682679_3683588_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AVO88824.1|3683580_3683712_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88825.1|3683970_3685413_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
AVO89226.1|3685602_3687132_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	7.1e-88
>prophage 247
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3699250	3702568	3944627		Planktothrix_phage(50.0%)	4	NA	NA
AVO88836.1|3699250_3699943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.6e-31
AVO88837.1|3699987_3700611_+	arylesterase	NA	NA	NA	NA	NA
AVO88838.1|3700643_3701258_-	carbonic anhydrase	NA	NA	NA	NA	NA
AVO88839.1|3701542_3702568_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
>prophage 248
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3716318	3720005	3944627		Dickeya_phage(100.0%)	1	NA	NA
AVO88849.1|3716318_3720005_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 249
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3730597	3739628	3944627		Synechococcus_phage(25.0%)	8	NA	NA
AVO88859.1|3730597_3731080_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.7	3.7e-19
AVO88860.1|3731314_3732613_+	MFS transporter	NA	NA	NA	NA	NA
AVO89230.1|3732675_3733851_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88861.1|3734027_3735668_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	9.1e-25
AVO88862.1|3735706_3737173_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVO88863.1|3737186_3737978_-	L-aspartate dehydrogenase	NA	NA	NA	NA	NA
AVO88864.1|3737993_3738788_-	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
AVO88865.1|3738803_3739628_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.3	5.2e-13
>prophage 250
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3748764	3749346	3944627		Raoultella_phage(100.0%)	1	NA	NA
AVO88877.1|3748764_3749346_-	nicotinamide riboside transporter PnuC	NA	A0A2H4YHF9	Raoultella_phage	28.6	1.4e-07
>prophage 251
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3760148	3768063	3944627	holin	Vibrio_phage(66.67%)	5	NA	NA
AVO88888.1|3760148_3762215_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
AVO88889.1|3762332_3763955_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
AVO88890.1|3764208_3764844_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVO88891.1|3764836_3766309_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVO88892.1|3766404_3768063_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
>prophage 252
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3784484	3785348	3944627		Yellowstone_lake_mimivirus(100.0%)	1	NA	NA
AVO88909.1|3784484_3785348_-	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	26.5	6.9e-16
>prophage 253
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3791919	3792690	3944627		Acinetobacter_phage(100.0%)	1	NA	NA
AVO88915.1|3791919_3792690_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	100.0	1.4e-153
>prophage 254
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3796178	3822202	3944627		Escherichia_phage(33.33%)	16	NA	NA
AVO88921.1|3796178_3800009_-	methyltransferase type 11	NA	A0A1Y0T2N3	Pseudomonas_phage	43.2	1.3e-199
AVO88922.1|3800084_3801596_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	43.1	3.0e-83
AVO88923.1|3801595_3803548_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88924.1|3803621_3804275_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88925.1|3804274_3805810_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	9.4e-32
AVO88926.1|3805969_3806164_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88927.1|3806216_3806981_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88928.1|3806981_3807272_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88929.1|3807316_3817675_-	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	26.8	7.4e-80
AVO88930.1|3817684_3818578_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88931.1|3818577_3819027_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88932.1|3819026_3819671_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88933.1|3819797_3820064_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.2	5.2e-15
AVO88934.1|3820026_3820302_-	antitoxin	NA	NA	NA	NA	NA
AVO88935.1|3820847_3821099_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO88936.1|3821305_3822202_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	46.2	4.3e-45
>prophage 255
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3828579	3836825	3944627	terminase	Escherichia_phage(50.0%)	10	NA	NA
AVO88945.1|3828579_3829710_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	32.0	1.1e-21
AVO88946.1|3829711_3829990_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88947.1|3830004_3831543_-	sperm-activating peptide	NA	NA	NA	NA	NA
AVO88948.1|3831615_3833607_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
AVO88949.1|3833626_3834139_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88950.1|3834150_3834351_-	conjugal transfer protein TraR	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
AVO88951.1|3834343_3835147_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88952.1|3835149_3836055_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88953.1|3836127_3836355_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88954.1|3836366_3836825_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
>prophage 256
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3850030	3869202	3944627	integrase	Acinetobacter_phage(58.33%)	32	3856320:3856334	3871375:3871389
AVO88968.1|3850030_3850486_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
AVO88969.1|3850941_3851475_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88970.1|3851471_3852236_-	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
AVO88971.1|3852232_3853276_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
AVO88972.1|3853279_3854758_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
AVO89233.1|3854754_3855141_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88973.1|3855146_3855707_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88974.1|3855706_3856348_-	hypothetical protein	NA	R9VWB9	Serratia_phage	40.8	1.6e-30
3856320:3856334	attL	GAATTAAATAAAATT	NA	NA	NA	NA
AVO88975.1|3856344_3856800_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88976.1|3856796_3856982_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88977.1|3856978_3857179_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88978.1|3857213_3857588_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88979.1|3857620_3857854_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVO88980.1|3857990_3858689_+	XRE family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	35.8	7.8e-26
AVO88981.1|3858699_3858987_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88982.1|3859198_3859531_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88983.1|3859571_3860375_+	DUF2303 domain-containing protein	NA	NA	NA	NA	NA
AVO88984.1|3860460_3860721_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88985.1|3860779_3861109_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88986.1|3861105_3861477_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.6	1.4e-10
AVO88987.1|3861647_3862328_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AVO88988.1|3862340_3863369_+	hypothetical protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
AVO88989.1|3863509_3863800_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88990.1|3863800_3863980_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88991.1|3863972_3864509_+	hypothetical protein	NA	NA	NA	NA	NA
AVO88992.1|3864505_3865015_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
AVO88993.1|3865011_3865221_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
AVO88994.1|3865217_3865433_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
AVO88995.1|3865610_3866603_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AVO88996.1|3866717_3867173_-	hypothetical protein	NA	NA	NA	NA	NA
AVO88997.1|3867163_3868048_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVO88998.1|3868044_3869202_-|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
3871375:3871389	attR	GAATTAAATAAAATT	NA	NA	NA	NA
>prophage 257
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3882111	3885708	3944627		Lactobacillus_virus(100.0%)	1	NA	NA
AVO89009.1|3882111_3885708_+	ATP-dependent dsDNA exonuclease	NA	Q5ULP4	Lactobacillus_virus	27.4	3.4e-08
>prophage 258
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3895017	3899152	3944627		Bacillus_phage(66.67%)	3	NA	NA
AVO89020.1|3895017_3896436_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	1.3e-40
AVO89021.1|3896635_3897088_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
AVO89022.1|3897112_3899152_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
>prophage 259
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3906233	3910483	3944627		Mycobacterium_phage(50.0%)	2	NA	NA
AVO89032.1|3906233_3909266_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
AVO89033.1|3909535_3910483_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
>prophage 260
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3914973	3918397	3944627		Cedratvirus(50.0%)	2	NA	NA
AVO89039.1|3914973_3916164_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
AVO89040.1|3916258_3918397_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
>prophage 261
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3925169	3926795	3944627		Agrobacterium_phage(100.0%)	1	NA	NA
AVO89047.1|3925169_3926795_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
>prophage 262
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3931771	3934410	3944627		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
AVO89052.1|3931771_3932746_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.1	7.3e-30
AVO89053.1|3932757_3934410_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
>prophage 263
CP027607	Acinetobacter baumannii strain AR_0102 chromosome, complete genome	3944627	3938536	3939905	3944627		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
AVO89057.1|3938536_3938800_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
AVO89058.1|3938801_3939293_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
AVO89059.1|3939428_3939905_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
>prophage 1
CP027608	Acinetobacter baumannii strain AR_0102 plasmid unnamed1, complete sequence	106967	13747	45975	106967		Pseudomonas_phage(50.0%)	40	NA	NA
AVO89256.1|13747_15805_+	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	44.2	3.6e-71
AVO89257.1|15944_17144_+	porphyrin biosynthesis protein	NA	L7TKP0	Rhizobium_phage	40.3	3.7e-76
AVO89258.1|17173_17857_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89259.1|17932_18622_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89260.1|18653_22109_+	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	42.3	2.4e-253
AVO89261.1|22193_23300_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	30.9	7.8e-12
AVO89262.1|23450_24338_+	regulator	NA	A0A2H4P7I7	Pseudomonas_phage	40.5	1.1e-40
AVO89263.1|24394_25459_+	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	7.7e-49
AVO89264.1|25469_26966_+	recombinase	NA	A0A2H4P740	Pseudomonas_phage	29.4	3.0e-51
AVO89265.1|27038_27392_+	hypothetical protein	NA	A0A2H4P744	Pseudomonas_phage	37.9	1.3e-08
AVO89266.1|27388_27787_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89267.1|27786_28224_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89268.1|28220_28739_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89269.1|28735_29101_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89270.1|29135_29384_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AVO89271.1|29383_29782_+	cell wall hydrolase	NA	W8FWV7	Vibrio_phage	34.1	1.4e-08
AVO89272.1|29843_30938_+	serine/threonine protein phosphatase	NA	A0A2H4P756	Pseudomonas_phage	38.7	5.2e-69
AVO89273.1|30937_32890_+	hypothetical protein	NA	L7TNH6	Rhizobium_phage	39.7	1.3e-118
AVO89274.1|32990_33623_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89275.1|33626_34220_+	hypothetical protein	NA	A0A2H4P7J7	Pseudomonas_phage	46.5	1.5e-33
AVO89276.1|34317_34908_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89277.1|34901_35222_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89278.1|35267_37658_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	49.1	1.1e-201
AVO89279.1|37737_38730_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	37.7	4.8e-53
AVO89280.1|38756_39176_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AVO89281.1|39175_39538_-	hypothetical protein	NA	NA	NA	NA	NA
AVO89282.1|39768_40629_+	hypothetical protein	NA	W6ASM9	Erwinia_phage	48.4	6.6e-75
AVO89283.1|40625_40919_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89284.1|40918_41377_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	51.7	4.2e-36
AVO89285.1|41376_42060_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89286.1|42152_42356_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89287.1|42690_43086_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89288.1|43072_43261_+	hypothetical protein	NA	A0A2I7R1N0	Vibrio_phage	52.5	8.0e-10
AVO89289.1|43257_43566_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	39.0	3.2e-08
AVO89290.1|43562_43799_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89291.1|43788_43992_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89292.1|43984_44407_+	hypothetical protein	NA	A0A2H4J8D3	uncultured_Caudovirales_phage	78.8	3.0e-41
AVO89293.1|44498_44774_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89294.1|44783_45149_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89295.1|45123_45975_+	hypothetical protein	NA	G3KB14	Pseudomonas_phage	57.6	3.1e-45
>prophage 2
CP027608	Acinetobacter baumannii strain AR_0102 plasmid unnamed1, complete sequence	106967	66654	106860	106967	capsid,tail,terminase	Salmonella_phage(41.67%)	33	NA	NA
AVO89329.1|66654_68370_-	ATP-dependent helicase	NA	L7TNS5	Rhizobium_phage	45.7	1.5e-123
AVO89330.1|68400_69081_+	chromosome partitioning protein ParB	NA	L7TL04	Rhizobium_phage	40.9	1.8e-43
AVO89331.1|69092_69614_+	hypothetical protein	NA	A0A2I7QK91	Vibrio_phage	39.4	4.2e-24
AVO89332.1|69621_70263_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	42.8	4.3e-31
AVO89333.1|70259_70916_+	ABC transporter	NA	J9Q807	Salmonella_phage	60.3	1.6e-65
AVO89334.1|70926_71280_+	thioredoxin	NA	NA	NA	NA	NA
AVO89335.1|71323_72274_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	44.1	3.5e-61
AVO89336.1|72263_72590_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89337.1|72692_73088_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89338.1|73207_73798_+	winged helix-turn-helix domain-containing protein	NA	J9Q6D4	Salmonella_phage	26.2	6.2e-08
AVO89339.1|73800_75045_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	60.1	1.3e-148
AVO89340.1|75084_76785_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	52.4	1.4e-153
AVO89341.1|76834_77686_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	32.0	6.4e-30
AVO89342.1|77856_78759_+|capsid	phage major capsid protein	capsid	A0A2H4P701	Pseudomonas_phage	55.0	1.9e-88
AVO89343.1|78881_79379_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	27.0	2.9e-06
AVO89344.1|79378_80152_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89345.1|80151_80628_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89346.1|80614_80980_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.4	3.5e-09
AVO89347.1|80957_81347_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89348.1|81347_81848_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89349.1|81917_82445_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	55.2	2.5e-48
AVO89350.1|82533_82857_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89351.1|82913_83192_+	hypothetical protein	NA	NA	NA	NA	NA
AVO89352.1|83208_88953_+|tail	phage tail protein	tail	G8C7Q6	Escherichia_phage	38.3	1.6e-07
AVO89353.1|88988_89318_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	35.8	2.2e-15
AVO89354.1|89326_90037_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	52.2	3.1e-70
AVO89355.1|90023_90782_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	38.2	5.3e-44
AVO89356.1|90771_91392_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	29.6	3.9e-13
AVO89357.1|91360_103036_+|tail	phage tail protein	tail	A0A0R6PH26	Moraxella_phage	36.2	1.2e-158
AVO89358.1|103035_103593_+	DUF4376 domain-containing protein	NA	A0A172Q083	Acinetobacter_phage	40.4	5.1e-28
AVO89359.1|104276_104594_+	hypothetical protein	NA	I3PUY0	Vibrio_phage	34.1	1.6e-07
AVO89360.1|104593_105163_+	TIGR02594 family protein	NA	A0A0B5KZH1	Acinetobacter_phage	100.0	1.3e-111
AVO89361.1|106011_106860_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	26.2	9.2e-13
