The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027657	Pseudomonas mendocina strain NEB698 chromosome, complete genome	5773548	265	41240	5773548	protease,tail,head,capsid,tRNA,terminase,portal,integrase,holin	Marinobacter_phage(14.29%)	52	19105:19121	42248:42264
AVO51218.1|265_1297_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	40.4	5.9e-62
AVO51219.1|1353_1704_-|head	head decoration protein	head	NA	NA	NA	NA
AVO51220.1|1703_3020_-|protease	Clp protease ClpP	protease	A0A2D1GN02	Marinobacter_phage	48.5	1.2e-96
AVO51221.1|3028_4609_-|portal	phage portal protein	portal	A0A2D1GMV5	Marinobacter_phage	60.0	2.4e-179
AVO51222.1|4605_4815_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVO51223.1|4814_6851_-|terminase	terminase	terminase	A0A2D1GMT1	Marinobacter_phage	49.5	2.0e-170
AVO51224.1|6774_7284_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51225.1|7418_7739_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AVO51226.1|7731_8088_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51227.1|8361_8985_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51228.1|9333_12114_-	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	57.5	0.0e+00
AVO51229.1|12110_12821_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	47.8	2.1e-42
AVO51230.1|12954_13305_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51231.1|13301_13505_-	hypothetical protein	NA	A5X9I2	Aeromonas_virus	65.8	8.0e-08
AVO51232.1|13497_14007_-	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	53.7	7.2e-29
AVO51233.1|14366_14597_-	hypothetical protein	NA	A0A0R6PIJ0	Moraxella_phage	42.7	5.2e-11
AVO56176.1|15232_15583_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	54.7	1.9e-25
AVO51234.1|15670_15925_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51235.1|15921_16218_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51236.1|16214_16760_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51237.1|16770_17055_+	hypothetical protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	39.4	7.1e-10
AVO51238.1|17051_17429_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51239.1|17425_17665_+	transcriptional regulator PrtN	NA	NA	NA	NA	NA
AVO51240.1|17786_18128_+	hypothetical protein	NA	C5IHK2	Burkholderia_virus	46.7	6.1e-16
AVO51241.1|18161_18983_+	hypothetical protein	NA	I6WAZ8	Burkholderia_virus	41.8	9.1e-42
19105:19121	attL	CCCTGCTCGGCCTGGCC	NA	NA	NA	NA
AVO56177.1|19610_19844_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51242.1|19840_20071_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51243.1|20067_20769_+	phosphohydrolase	NA	A0A2D2W2R9	Escherichia_phage	33.3	3.2e-19
AVO51244.1|20765_21428_+	hypothetical protein	NA	A0A1C9IHU7	Salmonella_phage	33.0	2.4e-08
AVO51245.1|21514_22138_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51246.1|22189_22816_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51247.1|22925_23231_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51248.1|23227_24034_+	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	48.3	4.1e-55
AVO51249.1|24043_24544_+	hypothetical protein	NA	A0A0H5AU93	Pseudomonas_phage	34.2	2.5e-18
AVO51250.1|24540_24819_+	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	71.3	1.1e-28
AVO51251.1|24829_25951_-|integrase	integrase	integrase	L7TP61	Pseudomonas_virus	65.7	1.2e-137
AVO51252.1|26055_27066_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVO51253.1|27035_27371_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AVO51254.1|27564_28491_+	transaldolase	NA	NA	NA	NA	NA
AVO56178.1|28576_29059_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AVO51255.1|29067_30252_-	fused response regulator/phosphatase	NA	NA	NA	NA	NA
AVO51256.1|30462_30762_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AVO51257.1|30817_31522_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51258.1|31626_32037_+	thioesterase	NA	NA	NA	NA	NA
AVO51259.1|32099_32819_+	phosphatase	NA	NA	NA	NA	NA
AVO51260.1|32937_33204_+	DUF4404 domain-containing protein	NA	NA	NA	NA	NA
AVO51261.1|33280_34111_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	37.9	7.3e-31
AVO51262.1|34400_37469_-	multidrug transporter AcrB	NA	NA	NA	NA	NA
AVO51263.1|37465_38488_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVO51264.1|38699_39494_-	ABC transporter permease	NA	NA	NA	NA	NA
AVO51265.1|39490_40423_-	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	4.4e-24
AVO51266.1|40577_41240_-|protease	cysteine protease	protease	NA	NA	NA	NA
42248:42264	attR	CCCTGCTCGGCCTGGCC	NA	NA	NA	NA
>prophage 2
CP027657	Pseudomonas mendocina strain NEB698 chromosome, complete genome	5773548	2785356	2807672	5773548	plate,tail,transposase	Pseudomonas_phage(27.27%)	27	NA	NA
AVO53637.1|2785356_2786475_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	6.6e-27
AVO56283.1|2787282_2787768_-	hypothetical protein	NA	A0A2H4JDM4	uncultured_Caudovirales_phage	46.2	3.5e-25
AVO53638.1|2787764_2788265_-	hypothetical protein	NA	A0A2H4JF49	uncultured_Caudovirales_phage	56.0	2.9e-30
AVO53639.1|2788261_2789776_-	hypothetical protein	NA	A0A0B5A596	Achromobacter_phage	41.7	4.3e-37
AVO53640.1|2789777_2790461_-	hypothetical protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	32.0	1.9e-24
AVO53641.1|2790388_2791438_-|plate	baseplate J protein	plate	B5TK75	Pseudomonas_phage	37.8	2.4e-55
AVO53642.1|2791427_2791877_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	55.6	1.8e-31
AVO53643.1|2791876_2792410_-|plate	baseplate assembly protein	plate	U5P081	Shigella_phage	45.4	2.2e-28
AVO53644.1|2792403_2793465_-	hypothetical protein	NA	A0A2P9JZK3	Alteromonadaceae_phage	37.5	2.5e-60
AVO53645.1|2793457_2794705_-	hypothetical protein	NA	Q8W619	Enterobacteria_phage	24.2	9.7e-19
AVO53646.1|2794786_2796427_-	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	30.0	3.2e-14
AVO53647.1|2796547_2796904_-	hypothetical protein	NA	NA	NA	NA	NA
AVO53648.1|2796907_2797264_-|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	41.4	3.4e-17
AVO53649.1|2797279_2798767_-|tail	phage tail protein	tail	A0A2P9JZJ8	Alteromonadaceae_phage	54.2	4.1e-149
AVO53650.1|2798766_2798994_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AVO53651.1|2798990_2799587_-	hypothetical protein	NA	NA	NA	NA	NA
AVO53652.1|2799971_2800220_+	hypothetical protein	NA	NA	NA	NA	NA
AVO53653.1|2800229_2800613_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	44.2	1.1e-16
AVO56284.1|2800638_2800908_-	hypothetical protein	NA	Q6QIC5	Burkholderia_phage	47.1	5.9e-06
AVO53654.1|2801223_2801679_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	69.6	9.5e-49
AVO53655.1|2801915_2802317_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO53656.1|2802516_2803176_-	sulfate transporter	NA	A0A0A1IVF8	Pseudomonas_phage	65.5	8.0e-73
AVO53657.1|2803198_2803585_-	hypothetical protein	NA	A0A125RN97	Pseudomonas_phage	49.6	1.3e-27
AVO53658.1|2803584_2804307_-	DNA transposition protein	NA	A0A2H4J809	uncultured_Caudovirales_phage	71.7	1.9e-91
AVO56285.1|2804323_2806375_-|transposase	transposase	transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	50.4	5.4e-192
AVO56286.1|2806468_2806813_-	nucleotide excision repair protein	NA	A0A1C6ZDH3	Pseudomonas_phage	55.9	2.0e-27
AVO53659.1|2806976_2807672_+	c repressor	NA	A0A076FRF7	Pseudomonas_phage	55.5	6.7e-70
>prophage 3
CP027657	Pseudomonas mendocina strain NEB698 chromosome, complete genome	5773548	5011833	5018954	5773548	tRNA	uncultured_Caudovirales_phage(85.71%)	9	NA	NA
AVO55538.1|5011833_5013114_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	56.0	3.6e-101
AVO55539.1|5013257_5014646_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVO55540.1|5014695_5015700_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
AVO55541.1|5015773_5016769_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	75.8	3.8e-143
AVO55542.1|5016765_5017101_-	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	2.8e-42
AVO55543.1|5017097_5017397_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.6	1.3e-25
AVO55544.1|5017396_5017756_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	3.1e-34
AVO55545.1|5017756_5018149_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	74.4	6.7e-51
AVO55546.1|5018285_5018954_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	83.9	1.7e-94
>prophage 4
CP027657	Pseudomonas mendocina strain NEB698 chromosome, complete genome	5773548	5203569	5283236	5773548	protease,tail,head,portal,capsid,plate,terminase,integrase,holin	uncultured_Caudovirales_phage(56.52%)	85	5242352:5242378	5281780:5281806
AVO55690.1|5203569_5204442_+|protease	protease HtpX	protease	NA	NA	NA	NA
AVO55691.1|5204499_5205156_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
AVO55692.1|5205260_5206028_+	dioxygenase	NA	NA	NA	NA	NA
AVO55693.1|5206024_5206609_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVO55694.1|5206712_5207150_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AVO55695.1|5207189_5208179_-	oxidoreductase	NA	NA	NA	NA	NA
AVO55696.1|5208254_5209271_-|protease	protease SohB	protease	NA	NA	NA	NA
AVO55697.1|5209471_5210170_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AVO55698.1|5210226_5210538_+	SCP-2 family sterol carrier protein	NA	NA	NA	NA	NA
AVO55699.1|5210758_5211826_+	phosphotransferase family protein	NA	NA	NA	NA	NA
AVO55700.1|5211842_5212610_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AVO55701.1|5212739_5213387_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55702.1|5213489_5214269_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55703.1|5214360_5215185_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
AVO55704.1|5215184_5216864_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AVO55705.1|5216901_5217714_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AVO55706.1|5217916_5220160_-	lysine decarboxylase	NA	NA	NA	NA	NA
AVO55707.1|5220281_5221040_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	3.0e-39
AVO55708.1|5221110_5221563_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.1e-36
AVO55709.1|5221604_5222363_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVO55710.1|5222435_5223209_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVO55711.1|5223319_5224894_+	lytic transglycosylase	NA	A0A0S2SXN2	Bacillus_phage	36.1	2.3e-09
AVO55712.1|5225108_5226938_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVO55713.1|5226934_5229106_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55714.1|5229107_5230181_+	microcin ABC transporter permease	NA	NA	NA	NA	NA
AVO55715.1|5230184_5231204_+	ABC transporter permease	NA	NA	NA	NA	NA
AVO55716.1|5231205_5232819_+	microcin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.6e-18
AVO55717.1|5232847_5233642_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVO55718.1|5233791_5235639_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVO55719.1|5235833_5236106_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	59.6	7.2e-20
AVO55720.1|5236241_5238638_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	1.7e-221
AVO55721.1|5238789_5240070_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	2.8e-138
AVO55722.1|5240177_5240819_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.0	1.3e-56
AVO55723.1|5240913_5242224_-	trigger factor	NA	NA	NA	NA	NA
5242352:5242378	attL	ATGGTGCGGACGGAGAGACTCGAACTC	NA	NA	NA	NA
AVO55724.1|5243155_5244175_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.7	3.8e-146
AVO56384.1|5244174_5245929_-|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	81.7	9.4e-278
AVO55725.1|5246072_5246915_+|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	57.8	1.3e-80
AVO55726.1|5246954_5248001_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	64.8	1.2e-118
AVO55727.1|5248004_5248703_+|terminase	terminase	terminase	A0A2H4J948	uncultured_Caudovirales_phage	58.4	1.5e-64
AVO55728.1|5248802_5249267_+|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	57.7	2.6e-41
AVO55729.1|5249266_5249476_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	72.5	7.0e-23
AVO55730.1|5249466_5249964_+	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	64.5	5.2e-48
AVO55731.1|5249956_5250271_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	56.7	3.2e-27
AVO55732.1|5250267_5251119_+	peptidoglycan-binding protein	NA	Q9ZXL6	Pseudomonas_virus	62.0	1.3e-83
AVO55733.1|5251115_5251298_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55734.1|5251294_5251738_+	DUF2570 domain-containing protein	NA	Q9ZXL5	Pseudomonas_virus	44.4	1.1e-20
AVO55735.1|5251846_5252257_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	73.5	2.0e-50
AVO55736.1|5252253_5252706_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	68.6	2.1e-48
AVO55737.1|5253807_5254017_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55738.1|5254184_5255288_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55739.1|5255379_5255955_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	57.7	3.1e-52
AVO55740.1|5255951_5256305_+|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	70.2	6.5e-37
AVO55741.1|5256301_5257213_+|plate	baseplate assembly protein	plate	A0A2H4JG47	uncultured_Caudovirales_phage	83.3	2.8e-132
AVO55742.1|5257212_5257836_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	77.5	1.1e-76
AVO55743.1|5259008_5259434_+|tail	phage tail protein	tail	A0A2H4J924	uncultured_Caudovirales_phage	72.9	6.8e-41
AVO55744.1|5259593_5260784_+|tail	phage tail protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	80.1	9.7e-186
AVO55745.1|5260830_5261346_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	74.3	1.2e-68
AVO55746.1|5261423_5261774_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	60.2	5.8e-22
AVO55747.1|5261782_5261905_+|tail	GpE family phage tail protein	tail	A0A2H4JFK5	uncultured_Caudovirales_phage	66.7	2.8e-08
AVO55748.1|5261894_5264459_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	47.2	1.9e-194
AVO55749.1|5264478_5264931_+	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	73.4	1.5e-54
AVO56385.1|5264954_5266181_+	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	73.7	8.0e-175
AVO55750.1|5266236_5267349_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55751.1|5268105_5268399_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55752.1|5268437_5268623_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55753.1|5268702_5269962_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	51.3	6.2e-114
AVO55754.1|5269961_5270393_-	DNA polymerase V	NA	A0A218MND2	uncultured_virus	46.1	5.3e-25
AVO55755.1|5270472_5270955_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55756.1|5271086_5271338_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55757.1|5271446_5272001_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55758.1|5272085_5272805_-	hypothetical protein	NA	NA	NA	NA	NA
AVO55759.1|5272840_5273215_-	transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	50.0	6.0e-25
AVO55760.1|5273265_5273478_+	hypothetical protein	NA	A0A1B0VRL1	Pseudomonas_phage	51.7	4.2e-07
AVO56386.1|5273507_5273978_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	57.5	2.4e-47
AVO55761.1|5273974_5274280_+	transcriptional regulator	NA	A0A2H4JAW0	uncultured_Caudovirales_phage	86.6	3.3e-37
AVO55762.1|5274276_5274501_+	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	56.9	9.5e-10
AVO55763.1|5274572_5274821_+	hypothetical protein	NA	NA	NA	NA	NA
AVO56387.1|5274826_5277673_+	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	60.2	0.0e+00
AVO55764.1|5277869_5278436_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55765.1|5278432_5278747_+	hypothetical protein	NA	A0A2R3UAY3	Myoviridae_environmental_samples	43.0	1.6e-15
AVO55766.1|5278803_5279763_+	hypothetical protein	NA	NA	NA	NA	NA
AVO55767.1|5279821_5280076_+	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	58.7	4.5e-16
AVO55768.1|5280065_5280272_+	hypothetical protein	NA	A0A2H4JE76	uncultured_Caudovirales_phage	77.2	9.0e-15
AVO55769.1|5280479_5281646_+|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	69.2	1.5e-159
AVO55770.1|5282381_5283236_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.6	1.9e-29
5281780:5281806	attR	ATGGTGCGGACGGAGAGACTCGAACTC	NA	NA	NA	NA
>prophage 5
CP027657	Pseudomonas mendocina strain NEB698 chromosome, complete genome	5773548	5749670	5758320	5773548		Pseudomonas_phage(33.33%)	10	NA	NA
AVO56146.1|5749670_5752052_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SD84	Indivirus	24.5	4.9e-11
AVO56147.1|5752471_5753740_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.0	2.7e-109
AVO56148.1|5753732_5754170_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	40.2	1.2e-16
AVO56149.1|5754356_5754587_-	hypothetical protein	NA	H2BDA2	Pseudomonas_phage	45.9	1.0e-06
AVO56150.1|5754676_5755480_-	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	65.0	2.5e-100
AVO56151.1|5755733_5756027_+	hypothetical protein	NA	NA	NA	NA	NA
AVO56152.1|5756026_5756794_+	hypothetical protein	NA	NA	NA	NA	NA
AVO56153.1|5756790_5757162_+	hypothetical protein	NA	NA	NA	NA	NA
AVO56154.1|5757325_5757847_-	hypothetical protein	NA	NA	NA	NA	NA
AVO56155.1|5757843_5758320_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	62.8	2.0e-49
