The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	1764125	1773590	5394870	tRNA,protease	Dickeya_phage(16.67%)	9	NA	NA
AVO16212.1|1764125_1765241_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVO16213.1|1765237_1767178_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVO16214.1|1767117_1767300_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16215.1|1767254_1767476_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVO16216.1|1767801_1768119_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVO16217.1|1768149_1770429_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVO16218.1|1770550_1770769_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVO16219.1|1771122_1771824_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVO16220.1|1771868_1773590_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	2167670	2227392	5394870	holin,transposase,integrase,tail,terminase	Klebsiella_phage(21.31%)	74	2170350:2170365	2227596:2227611
AVO16576.1|2167670_2168480_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AVO16577.1|2168481_2169474_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVO16578.1|2169473_2170364_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2170350:2170365	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
AVO16579.1|2170540_2171728_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	4.6e-119
AVO16580.1|2171624_2171939_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
AVO16581.1|2171948_2172188_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	67.5	8.8e-22
AVO16582.1|2172228_2173338_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.2	1.1e-183
AVO16583.1|2173350_2176389_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
AVO16584.1|2176526_2176682_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
AVO16585.1|2176690_2176882_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVO16586.1|2177178_2177487_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
AVO16587.1|2178654_2178774_-	hypothetical protein	NA	NA	NA	NA	NA
AVO16588.1|2178995_2179391_-	XRE family transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
AVO16589.1|2179495_2179729_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AVO16590.1|2179731_2180268_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
AVO16591.1|2180355_2180544_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16592.1|2180558_2181467_+	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
AVO16593.1|2181469_2182219_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AVO16594.1|2182226_2182562_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
AVO16595.1|2182554_2183340_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
AVO16596.1|2183336_2183540_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
AVO16597.1|2183532_2183787_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
AVO16598.1|2183783_2184005_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
AVO16599.1|2184008_2184437_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16600.1|2184532_2184832_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16601.1|2185582_2185816_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AVO16602.1|2185911_2186160_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	69.1	5.0e-28
AVO16603.1|2186194_2186791_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
AVO16604.1|2186790_2186997_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
AVO16605.1|2186999_2187296_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
AVO16606.1|2187292_2187649_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
AVO16607.1|2187645_2187768_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16608.1|2187764_2188586_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	9.0e-98
AVO16609.1|2188920_2189178_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
AVO16610.1|2189339_2190122_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
AVO16611.1|2190118_2191141_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
AVO16612.1|2192091_2192403_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.6e-47
AVO16613.1|2192399_2192939_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
AVO16614.1|2192935_2193283_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
AVO16615.1|2193279_2193555_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
AVO16616.1|2193505_2193700_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	1.2e-24
AVO16617.1|2194513_2194759_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AVO16618.1|2194887_2195073_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16619.1|2195621_2196614_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
AVO16620.1|2196591_2197899_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AVO16621.1|2197898_2199299_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
AVO16622.1|2199282_2200395_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
AVO16623.1|2200925_2201711_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
AVO16624.1|2201721_2202675_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AVO16625.1|2202996_2203392_+	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
AVO16626.1|2203393_2203648_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AVO16627.1|2203657_2203891_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
AVO16628.1|2203877_2204261_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AVO16629.1|2204262_2204814_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
AVO16630.1|2204810_2205203_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVO16631.1|2205226_2206399_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
AVO16632.1|2206452_2206935_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16633.1|2207102_2207279_+	hypothetical protein	NA	NA	NA	NA	NA
AVO16634.1|2207355_2207712_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AVO16635.1|2207708_2208191_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	2.4e-18
AVO16636.1|2208264_2211147_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
AVO16637.1|2211146_2211611_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
AVO16638.1|2211791_2212274_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
AVO16639.1|2212283_2212664_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AVO16640.1|2212660_2215729_+	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
AVO19678.1|2215823_2218958_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
AVO16641.1|2219044_2219791_-	hypothetical protein	NA	NA	NA	NA	NA
AVO16642.1|2219801_2221565_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	85.0	6.1e-51
AVO16643.1|2221657_2222206_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	95.6	6.0e-90
AVO16644.1|2222283_2222706_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	3.1e-25
AVO16645.1|2223255_2223675_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AVO16646.1|2223676_2224942_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.0	7.6e-205
AVO19679.1|2225893_2226523_+	reverse transcriptase	NA	NA	NA	NA	NA
AVO16647.1|2226723_2227392_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.0e-80
2227596:2227611	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 3
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	2495704	2502133	5394870		Escherichia_phage(100.0%)	7	NA	NA
AVO16892.1|2495704_2496325_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AVO16893.1|2496317_2497583_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AVO16894.1|2497594_2498497_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVO16895.1|2498757_2499519_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVO16896.1|2499539_2500400_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVO16897.1|2500697_2500958_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AVO16898.1|2501044_2502133_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 4
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3364188	3417151	5394870	transposase,lysis,portal,capsid,integrase,head,tail,terminase	Enterobacteria_phage(26.67%)	60	3376509:3376526	3426699:3426716
AVO19732.1|3364188_3364683_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AVO17717.1|3364663_3366097_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	8.9e-101
AVO17718.1|3366140_3366848_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AVO17719.1|3366890_3367172_-	hypothetical protein	NA	NA	NA	NA	NA
AVO17720.1|3367710_3368856_+	porin	NA	Q1MVN1	Enterobacteria_phage	58.7	8.4e-118
AVO17721.1|3369460_3369832_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	5.4e-26
AVO17722.1|3369788_3370028_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
AVO17723.1|3370591_3371428_+	hypothetical protein	NA	NA	NA	NA	NA
AVO17724.1|3371460_3372204_-	hypothetical protein	NA	NA	NA	NA	NA
AVO17725.1|3372218_3373979_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	83.3	6.7e-50
AVO17726.1|3374056_3377134_-	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
3376509:3376526	attL	GCCACATTATCGCCGGGC	NA	NA	NA	NA
AVO17727.1|3377130_3377511_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
AVO17728.1|3377523_3378000_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
AVO17729.1|3377986_3378460_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
AVO17730.1|3378480_3381870_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
AVO17731.1|3381930_3382164_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
AVO17732.1|3382297_3383797_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AVO17733.1|3383793_3384549_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
AVO17734.1|3384653_3384959_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
AVO17735.1|3384961_3385366_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
AVO17736.1|3385396_3386101_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
AVO17737.1|3386157_3386505_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
AVO17738.1|3386501_3386951_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
AVO17739.1|3386947_3387286_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
AVO17740.1|3387297_3387624_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
AVO17741.1|3387962_3389180_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
AVO19733.1|3389189_3390038_-	peptidase S14	NA	K7PH05	Enterobacteria_phage	84.6	1.0e-128
AVO17742.1|3390050_3391358_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
AVO17743.1|3391357_3393100_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
AVO17744.1|3393053_3393518_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
AVO17745.1|3393700_3394042_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
AVO17746.1|3394097_3394343_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
AVO17747.1|3394542_3394938_+	hypothetical protein	NA	NA	NA	NA	NA
AVO17748.1|3395274_3395433_-	rz1 lytic protein	NA	NA	NA	NA	NA
AVO17749.1|3395727_3396066_+	hypothetical protein	NA	NA	NA	NA	NA
AVO17750.1|3396140_3396605_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
AVO17751.1|3396601_3397132_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
AVO17752.1|3397134_3397383_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVO17753.1|3398090_3398669_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AVO17754.1|3398682_3399663_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
AVO17755.1|3399675_3400053_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
AVO17756.1|3400062_3400872_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
AVO17757.1|3400868_3401783_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
AVO17758.1|3401739_3401952_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
AVO17759.1|3402189_3402651_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
AVO17760.1|3402685_3402928_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AVO17761.1|3403025_3403721_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
AVO17762.1|3404434_3405352_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
AVO17763.1|3405441_3405741_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
AVO17764.1|3405740_3406526_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
AVO19734.1|3407125_3407956_+	hypothetical protein	NA	NA	NA	NA	NA
AVO17765.1|3407995_3408223_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
AVO17766.1|3408224_3409217_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
AVO17767.1|3409512_3410310_+	protein MtfA	NA	NA	NA	NA	NA
AVO17768.1|3410895_3411591_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVO17769.1|3411891_3412128_+	hypothetical protein	NA	NA	NA	NA	NA
AVO17770.1|3412326_3413268_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AVO17771.1|3413346_3414297_-	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AVO17772.1|3414403_3415321_-	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AVO17773.1|3415888_3417151_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
3426699:3426716	attR	GCCCGGCGATAATGTGGC	NA	NA	NA	NA
>prophage 5
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3529431	3542748	5394870		Escherichia_phage(22.22%)	12	NA	NA
AVO17865.1|3529431_3530436_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
AVO17866.1|3530504_3530699_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19737.1|3531649_3531754_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19738.1|3531968_3532976_-	acyltransferase	NA	NA	NA	NA	NA
AVO17867.1|3533368_3534535_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AVO17868.1|3534714_3535269_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AVO17869.1|3535283_3536174_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AVO17870.1|3536205_3537075_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
AVO19739.1|3537088_3538153_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AVO17871.1|3538307_3539678_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AVO17872.1|3539699_3541115_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AVO17873.1|3541341_3542748_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 6
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3586091	3592996	5394870		Bacillus_phage(33.33%)	6	NA	NA
AVO17901.1|3586091_3587570_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AVO17902.1|3587566_3588289_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVO17903.1|3588607_3589969_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	1.1e-206
AVO19741.1|3590214_3591108_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVO17904.1|3591348_3592122_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
AVO19742.1|3592132_3592996_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3985621	4073595	5394870	transposase,holin,tRNA,portal,tail	Klebsiella_phage(24.44%)	83	NA	NA
AVO18246.1|3985621_3986896_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVO18247.1|3986987_3988109_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin)	NA	NA	NA	NA	NA
AVO18248.1|3988135_3989131_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AVO18249.1|3989407_3990574_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AVO18250.1|3991057_3991489_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
AVO18251.1|3991649_3993974_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AVO18252.1|3993974_3998924_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18253.1|3999129_3999987_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
AVO18254.1|4000213_4001056_+	hypothetical protein	NA	NA	NA	NA	NA
AVO18255.1|4001126_4001903_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
AVO18256.1|4002002_4003289_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
AVO18257.1|4003359_4003560_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVO18258.1|4003561_4003897_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVO18259.1|4003898_4005749_-	molecular chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
AVO18260.1|4005764_4006280_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVO18261.1|4006354_4006678_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AVO18262.1|4006695_4007082_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AVO18263.1|4007108_4008323_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	4.2e-35
AVO18264.1|4008501_4008993_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AVO18265.1|4009227_4009962_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVO18266.1|4010082_4010886_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AVO18267.1|4010932_4011769_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18268.1|4011868_4012849_-	nickel transporter	NA	NA	NA	NA	NA
AVO18269.1|4012839_4013478_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AVO18270.1|4013602_4014880_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AVO18271.1|4014876_4016013_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AVO18272.1|4016095_4016929_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AVO18273.1|4016928_4018365_-	MFS transporter	NA	NA	NA	NA	NA
AVO18274.1|4018434_4021710_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
AVO18275.1|4021822_4023019_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AVO19755.1|4023092_4023515_+	DoxX family protein	NA	NA	NA	NA	NA
AVO18276.1|4023570_4024824_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
AVO18277.1|4025149_4026340_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVO18278.1|4026414_4026753_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVO18279.1|4026818_4028156_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AVO18280.1|4028142_4028850_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVO18281.1|4028858_4030280_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AVO18282.1|4030870_4034758_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AVO18283.1|4034933_4036550_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AVO18284.1|4036546_4037089_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AVO18285.1|4037118_4037754_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVO18286.1|4037967_4038816_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVO18287.1|4039237_4040491_+	hypothetical protein	NA	NA	NA	NA	NA
AVO18288.1|4040501_4040705_+	hypothetical protein	NA	NA	NA	NA	NA
AVO18289.1|4040742_4040946_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18290.1|4043455_4046524_-	kinase	NA	A0A286S259	Klebsiella_phage	65.7	0.0e+00
AVO18291.1|4046520_4046907_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
AVO18292.1|4046914_4047397_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
AVO18293.1|4047383_4047857_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.8	6.6e-53
AVO18294.1|4047856_4050553_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.1	3.0e-198
AVO18295.1|4050533_4050851_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AVO18296.1|4050871_4051267_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
AVO18297.1|4051309_4051792_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AVO18298.1|4051799_4052198_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AVO18299.1|4052194_4052746_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
AVO18300.1|4052735_4053029_-	ATP-binding protein	NA	NA	NA	NA	NA
AVO18301.1|4053021_4053348_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.4e-33
AVO18302.1|4055460_4056723_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVO18303.1|4057049_4058549_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	1.2e-246
AVO18304.1|4058545_4058761_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
AVO18305.1|4058757_4060866_-	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	83.0	0.0e+00
AVO18306.1|4060865_4061357_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AVO18307.1|4061674_4061920_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	58.0	8.8e-17
AVO18308.1|4061990_4062290_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVO18309.1|4062370_4062523_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.7	2.7e-16
AVO18310.1|4062512_4062788_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.0	2.4e-07
AVO18311.1|4062784_4063129_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	1.8e-39
AVO18312.1|4063125_4063665_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
AVO18313.1|4063667_4064015_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	71.0	1.5e-38
AVO18314.1|4064159_4065212_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.1	7.8e-171
AVO18315.1|4065362_4065554_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	87.3	5.8e-24
AVO18316.1|4065732_4066137_-	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	1.6e-31
AVO18317.1|4066126_4066771_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	3.4e-84
AVO18318.1|4066767_4067412_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
AVO18319.1|4067381_4068353_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	7.8e-109
AVO18320.1|4068349_4069879_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
AVO18321.1|4069871_4070147_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18322.1|4070308_4070587_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18323.1|4070629_4071160_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
AVO18324.1|4071188_4071449_-	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
AVO19756.1|4071554_4072259_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
AVO18325.1|4072316_4073351_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
AVO18326.1|4073388_4073595_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
>prophage 8
CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	4641098	4691607	5394870	plate,holin,tRNA,portal,capsid,integrase,head,tail,terminase	Escherichia_phage(24.44%)	62	4661125:4661140	4692144:4692159
AVO18858.1|4641098_4642340_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
AVO18859.1|4642351_4643173_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVO18860.1|4643371_4643755_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVO18861.1|4643862_4644480_+	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVO18862.1|4644741_4644888_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AVO18863.1|4644877_4645702_+	urease accessory protein	NA	NA	NA	NA	NA
AVO18864.1|4645711_4646014_+	urease subunit gamma	NA	NA	NA	NA	NA
AVO18865.1|4646023_4646344_+	urease subunit beta	NA	NA	NA	NA	NA
AVO18866.1|4646336_4648040_+	urease subunit alpha	NA	NA	NA	NA	NA
AVO18867.1|4648049_4648526_+	urease accessory protein UreE	NA	NA	NA	NA	NA
AVO18868.1|4648527_4649202_+	urease accessory protein UreF	NA	NA	NA	NA	NA
AVO18869.1|4649210_4649828_+	urease accessory protein UreG	NA	NA	NA	NA	NA
AVO18870.1|4649981_4651589_+	allantoin permease	NA	NA	NA	NA	NA
AVO18871.1|4651633_4652647_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AVO18872.1|4652655_4652886_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18873.1|4652884_4653100_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVO18874.1|4653211_4654957_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AVO18875.1|4655175_4657017_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVO18876.1|4657116_4657623_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVO18877.1|4657981_4658200_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
AVO18878.1|4658293_4658701_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
AVO18879.1|4658741_4659902_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
AVO18880.1|4659901_4660381_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
AVO18881.1|4660397_4662836_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
4661125:4661140	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
AVO18882.1|4662828_4662966_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AVO18883.1|4662980_4663256_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
AVO18884.1|4663316_4663832_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
AVO18885.1|4663845_4665027_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
AVO18886.1|4665136_4666216_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
AVO18887.1|4666227_4666956_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18888.1|4666961_4669226_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.0e-108
AVO18889.1|4669227_4669830_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	57.6	1.0e-53
AVO18890.1|4669822_4670731_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
AVO18891.1|4670735_4671083_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
AVO18892.1|4671079_4671721_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
AVO18893.1|4672063_4673107_-	hypothetical protein	NA	NA	NA	NA	NA
AVO18894.1|4673435_4673885_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
AVO18895.1|4673877_4674345_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
AVO18896.1|4674440_4674872_-	protein lysB	NA	O80310	Escherichia_phage	66.9	1.1e-41
AVO18897.1|4674868_4675366_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
AVO18898.1|4675352_4675643_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
AVO18899.1|4675647_4675851_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AVO18900.1|4675850_4676357_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
AVO18901.1|4676453_4677197_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	78.9	9.6e-99
AVO18902.1|4677200_4678259_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
AVO18903.1|4678332_4679187_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
AVO18904.1|4679352_4681122_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
AVO18905.1|4681121_4682165_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
AVO18906.1|4682677_4682872_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
AVO18907.1|4682870_4683302_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
AVO18908.1|4683440_4684391_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
AVO18909.1|4684368_4684677_-	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
AVO18910.1|4685297_4685738_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
AVO18911.1|4685856_4688073_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.2	0.0e+00
AVO18912.1|4688074_4688296_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
AVO18913.1|4688295_4688523_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
AVO18914.1|4688590_4688929_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
AVO19776.1|4688892_4689093_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
AVO18915.1|4689100_4689610_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
AVO18916.1|4689640_4689904_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AVO18917.1|4690033_4690609_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
AVO18918.1|4690608_4691607_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
4692144:4692159	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
>prophage 1
CP024430	Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence	131243	2663	64222	131243	integrase,transposase	Escherichia_phage(40.0%)	57	17523:17582	64215:65037
AVO19800.1|2663_3368_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO19801.1|3442_3820_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	1.5e-68
AVO19802.1|3824_4382_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVO19803.1|4564_5425_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVO19804.1|5634_6174_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVO19805.1|6145_6982_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVO19806.1|6981_7785_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVO19807.1|7845_8661_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVO19808.1|8990_9167_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVO19809.1|9348_10353_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVO19810.1|13042_13879_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVO19811.1|13878_14682_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVO19812.1|14913_15264_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19813.1|15504_16146_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
17523:17582	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AVO19814.1|17574_18279_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO19927.1|18303_19860_+	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
AVO19815.1|20457_21534_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVO19816.1|22915_23332_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AVO19817.1|23328_23559_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVO19818.1|24132_24483_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19819.1|24533_25277_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19820.1|25273_26050_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AVO19821.1|26107_26365_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19822.1|27132_27999_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AVO19823.1|28175_28445_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19824.1|28859_30065_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AVO19825.1|30061_31039_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AVO19826.1|31120_32392_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AVO19827.1|32391_32823_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AVO19828.1|32980_33232_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19829.1|33231_34716_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
AVO19928.1|36155_36455_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19830.1|39438_40143_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVO19929.1|40113_40596_+	hypothetical protein	NA	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
AVO19831.1|40851_41727_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVO19832.1|41773_42106_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVO19833.1|42122_44915_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AVO19930.1|44939_45200_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19834.1|45423_45603_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
AVO19835.1|47516_47852_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19836.1|48024_48306_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVO19837.1|48359_48971_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVO19838.1|49155_50112_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19839.1|50492_51197_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO19840.1|51515_52949_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AVO19841.1|52982_54191_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AVO19842.1|54203_54416_-	resolvase	NA	NA	NA	NA	NA
AVO19843.1|54457_55222_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVO19844.1|55364_55631_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AVO19845.1|56499_57753_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
AVO19846.1|57828_58620_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVO19847.1|59027_59525_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AVO19848.1|60166_60871_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO19931.1|60950_61451_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19849.1|61600_62242_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AVO19850.1|62385_63090_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO19851.1|63517_64222_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
64215:65037	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAAAAATAGTCCTTCAGTGGGACGAAATGATCCGGACCGCTGGCTCCCTGAAGCTGGGCAAAGTACAGGCTTCAGTGCTGGTCCGTTCATTGCTGAAAAGTGAACGTCCTTCCGGACTGACTCAGGCAATCATTGAAGTGGGGCGCATCAACAAAACGCTGTATCTGCTTAATTATATTGATGATGAAGATTACCGCCGGCGCATTCTGACCCAGCTTAATCGGGGAGAAAGTCGCCATGCCGTTGCCAGAGCCATCTGTCACGGTCAAAAAGGTGAGATAAGAAAACGATATACCGACGGTCAGGAAGATCAACTGGGCGCACTGGGGCTGGTCACTAACGCCGTCGTGTTATGGAACACTATTTATATGCAGGCAGCCCTGGATCATCTCCGGGCGCAGGGTGAAACACTGAATGATGAAGATATCGCACGCCTCTCCCCGCTTTGCCACGGACATATCAATATGCTCGGCCATTATTCCTTCACGCTGGCAGAACTGGTGACCAAAGGACATCTGAGACCATTAAAAGAGGCGTCAGAGGCAGAAAACGTTGCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAAT	NA	NA	NA	NA
>prophage 1
CP024431	Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence	114815	3853	52495	114815	transposase,integrase	Stx2-converting_phage(22.22%)	57	8664:8680	30152:30168
AVO19940.1|3853_5443_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
AVO19941.1|5818_6226_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
AVO19942.1|6301_6559_+	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
AVO19943.1|6570_6822_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19944.1|6862_8791_-	MobA relaxase/mobilization protein	NA	NA	NA	NA	NA
8664:8680	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
AVO19945.1|8793_9105_-	mobilization protein	NA	NA	NA	NA	NA
AVO19946.1|9500_9833_+	MobC	NA	NA	NA	NA	NA
AVO19947.1|10103_10424_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19948.1|10477_10711_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19949.1|11402_11840_-	KlcA	NA	NA	NA	NA	NA
AVO19950.1|12009_12870_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
AVO20042.1|12943_13123_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AVO19951.1|13266_13626_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19952.1|14219_14657_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AVO19953.1|14784_15210_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO19954.1|15269_15518_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVO19955.1|15880_16309_-	recombinase	NA	NA	NA	NA	NA
AVO19956.1|16301_17282_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
AVO19957.1|17642_17825_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
AVO19958.1|17850_18294_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
AVO19959.1|18635_18863_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19960.1|19292_19550_+	XRE family transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
AVO19961.1|19753_20320_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19962.1|20361_20739_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19963.1|20850_21156_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVO19964.1|21155_21374_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19965.1|21559_22585_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVO19966.1|23528_23960_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
AVO19967.1|23959_25231_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
AVO19968.1|25642_26518_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AVO20043.1|27150_27777_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AVO19969.1|27896_28076_+	Par-like protein	NA	NA	NA	NA	NA
AVO19970.1|28523_29318_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AVO19971.1|29515_30520_-	hypothetical protein	NA	NA	NA	NA	NA
30152:30168	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
AVO20044.1|30584_30896_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19972.1|30944_31259_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19973.1|31781_32384_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19974.1|32524_33553_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19975.1|33697_36502_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19976.1|36700_37060_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19977.1|37086_38679_-|transposase	IS66 family transposase ISKox1	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
AVO19978.1|38709_39060_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AVO19979.1|39056_39497_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AVO19980.1|40177_40960_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
AVO19981.1|40956_41979_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
AVO19982.1|43008_44736_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19983.1|45181_45430_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19984.1|45426_45999_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19985.1|46029_46524_+	DNA-binding protein	NA	NA	NA	NA	NA
AVO19986.1|46567_46867_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19987.1|46756_47065_-	hypothetical protein	NA	NA	NA	NA	NA
AVO19988.1|47190_47427_+	hypothetical protein	NA	NA	NA	NA	NA
AVO19989.1|47558_48107_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AVO19990.1|48153_48588_+	protein TolA	NA	NA	NA	NA	NA
AVO19991.1|48858_50262_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AVO19992.1|50290_50923_-	hypothetical protein	NA	NA	NA	NA	NA
AVO20045.1|51148_52495_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP024433	Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence	55118	5471	47460	55118	tail,capsid,terminase,portal,head	Klebsiella_phage(82.69%)	55	NA	NA
AVO20111.1|5471_6932_+|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	52.9	2.7e-97
AVO20112.1|7011_7977_-	chromosome partitioning protein ParB	NA	Q6UAV8	Klebsiella_phage	86.6	1.5e-155
AVO20113.1|7979_9143_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AVO20114.1|9850_11764_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
AVO20115.1|11818_12619_-	hypothetical protein	NA	O64341	Escherichia_phage	78.1	3.2e-116
AVO20116.1|12615_12846_-	hypothetical protein	NA	NA	NA	NA	NA
AVO20117.1|12842_13007_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AVO20118.1|13585_14011_+	hypothetical protein	NA	NA	NA	NA	NA
AVO20119.1|14149_15142_-	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
AVO20120.1|15476_15827_-	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
AVO20121.1|15823_16120_-	hypothetical protein	NA	NA	NA	NA	NA
AVO20122.1|16112_20117_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AVO20123.1|20367_20976_-	helix-turn-helix domain-containing protein	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
AVO20163.1|21056_21266_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AVO20124.1|21255_21993_+	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AVO20125.1|21973_22195_+	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	75.3	1.1e-29
AVO20126.1|22404_23013_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	3.0e-98
AVO20127.1|23613_23859_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AVO20128.1|23851_24178_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
AVO20129.1|24198_24426_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AVO20130.1|24529_24733_+	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AVO20131.1|24777_25065_-	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AVO20132.1|25064_25373_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AVO20164.1|25543_25765_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AVO20133.1|25776_26004_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AVO20134.1|26321_27383_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	1.0e-170
AVO20135.1|27441_27753_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AVO20136.1|27749_28241_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	4.1e-82
AVO20137.1|28257_28734_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AVO20138.1|28987_29287_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AVO20139.1|29456_30518_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.3	8.8e-37
AVO20140.1|30501_30864_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
AVO20141.1|30860_31145_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
AVO20142.1|31141_31573_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
AVO20165.1|31658_31859_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	3.4e-11
AVO20143.1|31989_32424_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AVO20144.1|32458_34168_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AVO20145.1|34161_34341_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AVO20146.1|34340_35600_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	3.1e-222
AVO20147.1|35636_36557_+	serine peptidase	NA	Q6UAX7	Klebsiella_phage	87.6	3.6e-148
AVO20148.1|36634_37921_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.0	1.8e-206
AVO20149.1|37980_38268_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
AVO20150.1|38248_38566_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
AVO20151.1|38562_38901_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AVO20152.1|38881_39271_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AVO20153.1|39267_39669_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AVO20154.1|39700_40162_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AVO20155.1|40219_40585_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AVO20156.1|40605_40818_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AVO20157.1|40817_44174_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
AVO20158.1|44173_44512_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AVO20159.1|44508_45264_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
AVO20160.1|45265_45976_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AVO20161.1|46022_46850_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	1.3e-08
AVO20162.1|46866_47460_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
