The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	967975	975288	4698699	protease,integrase	Dickeya_phage(16.67%)	8	969226:969240	980480:980494
AVM14367.1|967975_969094_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVM14368.1|969090_971037_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
969226:969240	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AVM14369.1|971017_971212_+	hypothetical protein	NA	NA	NA	NA	NA
AVM14370.1|971166_971388_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVM14371.1|971711_972032_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVM14372.1|972062_974339_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVM14373.1|974551_974749_-	hypothetical protein	NA	NA	NA	NA	NA
AVM14374.1|974910_975288_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
980480:980494	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	1825109	1875244	4698699	tail,tRNA,transposase,protease,integrase	Moraxella_phage(14.29%)	56	1840480:1840495	1878098:1878113
AVM15189.1|1825109_1825805_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVM15190.1|1825862_1827773_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.3	3.5e-92
AVM15191.1|1827904_1828249_+	RidA family protein	NA	NA	NA	NA	NA
AVM15192.1|1828254_1828434_-	YoaH family protein	NA	NA	NA	NA	NA
AVM15193.1|1828514_1829879_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	2.5e-44
AVM15194.1|1829882_1830461_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AVM15195.1|1830724_1832089_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVM15196.1|1832226_1833828_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVM15197.1|1833849_1835409_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AVM15198.1|1835396_1835732_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15199.1|1835881_1836850_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVM15200.1|1836902_1837703_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AVM15201.1|1837715_1838567_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AVM15202.1|1838625_1839084_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AVM17909.1|1839439_1840060_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AVM15203.1|1840056_1840866_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
1840480:1840495	attL	ATAGCGCTTCGCTGCC	NA	NA	NA	NA
AVM15204.1|1840931_1842677_-	cell division protein FtsI	NA	NA	NA	NA	NA
AVM15205.1|1842896_1843106_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AVM15206.1|1843118_1843262_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AVM15207.1|1843910_1844198_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15208.1|1844268_1844412_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AVM15209.1|1844569_1844809_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15210.1|1845020_1845812_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AVM15211.1|1845987_1847361_+	MFS transporter	NA	NA	NA	NA	NA
AVM15212.1|1847408_1848290_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVM15213.1|1848483_1850532_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVM15214.1|1850551_1851238_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVM15215.1|1851335_1851920_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVM15216.1|1851961_1853245_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVM15217.1|1853207_1855847_+	MCE family protein	NA	NA	NA	NA	NA
AVM15218.1|1857477_1857717_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVM15219.1|1857827_1858019_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVM15220.1|1858037_1858688_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AVM15221.1|1858912_1859077_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15222.1|1859361_1860084_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVM15223.1|1860767_1861163_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.6	8.3e-17
AVM15224.1|1861492_1861969_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15225.1|1862355_1862775_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVM15226.1|1863147_1863417_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
AVM15227.1|1863582_1863723_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15228.1|1863868_1865077_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	5.3e-46
AVM15229.1|1865261_1865570_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	41.9	3.9e-14
AVM17910.1|1866041_1866242_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15230.1|1866859_1867774_+	protein PagO	NA	NA	NA	NA	NA
AVM15231.1|1867906_1868065_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15232.1|1868074_1868689_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVM15233.1|1869441_1869708_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15234.1|1869836_1869962_-	arsenic transporter	NA	NA	NA	NA	NA
AVM15235.1|1870224_1870341_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVM15236.1|1870531_1870732_+	phage virulence factor	NA	NA	NA	NA	NA
AVM15237.1|1872178_1872370_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15238.1|1872434_1872602_+	lytic enzyme	NA	NA	NA	NA	NA
AVM15239.1|1872858_1873392_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AVM15240.1|1873445_1873676_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVM17912.1|1873865_1874360_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	67.6	2.0e-20
AVM17911.1|1874419_1875244_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	1.1e-71
1878098:1878113	attR	GGCAGCGAAGCGCTAT	NA	NA	NA	NA
>prophage 3
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	1901782	1960654	4698699	tail,head,terminase,tRNA,protease	Salmonella_phage(60.27%)	85	NA	NA
AVM15271.1|1901782_1903555_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVM15272.1|1903879_1904446_+	hydrolase	NA	NA	NA	NA	NA
AVM15273.1|1904768_1905440_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	3.4e-79
AVM15274.1|1905465_1905897_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15275.1|1905981_1907250_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	94.1	1.2e-234
AVM15276.1|1907252_1907672_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
AVM15277.1|1907908_1909207_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	99.5	3.5e-245
AVM15278.1|1909217_1910177_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	1.6e-183
AVM15279.1|1910185_1913362_-	host specificity protein J	NA	I6R9B3	Salmonella_phage	93.7	0.0e+00
AVM15280.1|1913371_1913914_-|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	95.2	6.6e-65
AVM15281.1|1913841_1914561_-|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	93.3	3.9e-137
AVM17914.1|1914560_1915265_-|tail	phage minor tail protein L	tail	H6WRW1	Salmonella_phage	100.0	8.4e-137
AVM15282.1|1915430_1915646_+	hypothetical protein	NA	H6WRW0	Salmonella_phage	98.6	6.1e-30
AVM15283.1|1915614_1915821_-	hypothetical protein	NA	H6WRV9	Salmonella_phage	98.5	5.8e-30
AVM15284.1|1915831_1916179_-|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	91.3	4.5e-59
AVM15285.1|1916181_1919322_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	69.3	1.7e-311
AVM15286.1|1919384_1919678_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15287.1|1919779_1920133_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	2.7e-59
AVM15288.1|1920266_1920995_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	62.4	2.0e-72
AVM15289.1|1921067_1921934_-	hypothetical protein	NA	B6SD57	Bacteriophage	53.2	3.9e-67
AVM15290.1|1922454_1923183_-	DNA-binding protein	NA	H6WRU3	Salmonella_phage	100.0	3.1e-142
AVM15291.1|1923404_1924058_-	hypothetical protein	NA	H6WRU2	Salmonella_phage	99.5	1.3e-120
AVM15292.1|1924102_1924840_-	hypothetical protein	NA	Q5G8X3	Enterobacteria_phage	98.8	2.7e-130
AVM15293.1|1924855_1925242_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	97.7	3.8e-67
AVM15294.1|1925238_1925634_-	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	100.0	7.2e-69
AVM15295.1|1925641_1926004_-	hypothetical protein	NA	I6S1Q5	Salmonella_phage	95.8	1.3e-64
AVM15296.1|1925987_1926176_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	100.0	1.4e-30
AVM15297.1|1926175_1926577_-	hypothetical protein	NA	I6S619	Salmonella_phage	97.7	7.8e-71
AVM15298.1|1926628_1926808_-	glycoprotein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
AVM15299.1|1926817_1927894_-	hypothetical protein	NA	I6RSK5	Salmonella_phage	100.0	2.4e-207
AVM15300.1|1927911_1928361_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	100.0	1.6e-77
AVM15301.1|1928373_1929636_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.8	5.2e-238
AVM15302.1|1929651_1930611_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	98.1	2.8e-175
AVM15303.1|1930564_1931917_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	100.0	1.0e-260
AVM15304.1|1932049_1933369_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	99.1	1.3e-260
AVM15305.1|1933352_1933784_-|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
AVM17915.1|1934241_1934763_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	98.8	2.1e-100
AVM15306.1|1934979_1935171_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15307.1|1935130_1935418_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15308.1|1935414_1935645_-	hypothetical protein	NA	M4Q0Z5	Dunaliella_viridis_virus	40.6	1.3e-09
AVM15309.1|1935641_1936109_-	lysozyme	NA	H9C148	Vibrio_phage	45.8	2.5e-28
AVM17916.1|1936083_1936311_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15310.1|1936755_1937379_-	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AVM15311.1|1937375_1937555_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	2.1e-23
AVM15312.1|1937535_1937739_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
AVM15313.1|1937735_1938338_-	protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.3e-90
AVM15314.1|1938312_1938879_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AVM15315.1|1938871_1939048_-	protein ninF	NA	I6S668	Salmonella_phage	93.1	4.8e-25
AVM15316.1|1939040_1939442_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	1.6e-63
AVM15317.1|1939444_1939621_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AVM15318.1|1939587_1939761_-	protein ninD	NA	C6ZR56	Salmonella_phage	98.2	5.8e-31
AVM15319.1|1939757_1940204_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	9.2e-81
AVM15320.1|1940160_1940457_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
AVM17917.1|1940459_1940642_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	98.3	1.2e-26
AVM15321.1|1940719_1940920_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
AVM15322.1|1940916_1941243_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
AVM15323.1|1941315_1942692_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.6	7.4e-254
AVM15324.1|1943500_1943647_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AVM15325.1|1943681_1943963_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AVM15326.1|1944073_1944289_-	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AVM17918.1|1944407_1945070_+	LexA family transcriptional repressor	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
AVM15327.1|1945420_1945723_+	regulator	NA	I6S5Z3	Salmonella_phage	96.0	2.0e-47
AVM17919.1|1945990_1946497_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	1.7e-43
AVM15328.1|1946530_1946809_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
AVM15329.1|1947126_1947300_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AVM15330.1|1947280_1947469_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AVM15331.1|1947598_1948306_+	recombinase	NA	I6R0N0	Salmonella_phage	96.2	1.9e-133
AVM15332.1|1948305_1948590_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AVM15333.1|1948636_1948930_+	RecBCD nuclease inhibitor	NA	I6R984	Salmonella_phage	100.0	2.5e-50
AVM15334.1|1948940_1949111_+	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AVM15335.1|1949107_1949578_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	61.4	1.5e-33
AVM17920.1|1949634_1950141_+	hypothetical protein	NA	C6ZR30	Salmonella_phage	65.1	1.9e-45
AVM15336.1|1950140_1950896_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	2.4e-150
AVM15337.1|1950906_1951941_+	molecular chaperone DnaJ	NA	Q8HAA7	Salmonella_phage	56.6	3.1e-47
AVM15338.1|1951944_1952514_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	82.5	1.3e-90
AVM15339.1|1952552_1952789_+	excisionase	NA	Q8W657	Enterobacteria_phage	93.6	4.2e-40
AVM15340.1|1952847_1954161_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.4	2.3e-228
AVM15341.1|1954139_1954913_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	5.5e-57
AVM15342.1|1954965_1955361_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15343.1|1955401_1956145_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
AVM15344.1|1956141_1957113_+|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AVM15345.1|1957161_1957371_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15346.1|1957348_1958095_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVM15347.1|1958114_1958684_-	VOC family protein	NA	NA	NA	NA	NA
AVM15348.1|1958920_1960654_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
>prophage 4
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	2029826	2037077	4698699		Morganella_phage(33.33%)	8	NA	NA
AVM15424.1|2029826_2031257_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVM15425.1|2031330_2032026_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	3.6e-07
AVM15426.1|2032105_2032417_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15427.1|2033065_2034262_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	4.3e-109
AVM17922.1|2034520_2034709_-	cold-shock protein	NA	NA	NA	NA	NA
AVM15428.1|2034719_2034932_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVM15429.1|2035386_2036655_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	9.3e-227
AVM15430.1|2036657_2037077_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	2195482	2204653	4698699	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
AVM15572.1|2195482_2197516_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AVM15573.1|2197756_2198215_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVM15574.1|2198386_2198917_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.8e-15
AVM15575.1|2198973_2199441_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVM15576.1|2199487_2200207_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVM15577.1|2200203_2201889_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVM15578.1|2202111_2202843_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVM15579.1|2202902_2203010_+	hypothetical protein	NA	NA	NA	NA	NA
AVM15580.1|2202990_2203722_-	ABC transporter permease	NA	NA	NA	NA	NA
AVM15581.1|2203705_2204653_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 6
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	2416626	2485508	4698699	tail,head,terminase,tRNA,capsid,holin,lysis,portal,protease	Salmonella_phage(51.47%)	90	NA	NA
AVM15778.1|2416626_2417439_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVM15779.1|2417438_2418452_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVM15780.1|2418519_2419656_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
AVM15781.1|2419759_2420761_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AVM15782.1|2420757_2421936_-	MFS transporter	NA	NA	NA	NA	NA
AVM15783.1|2422115_2422490_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15784.1|2422662_2422911_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
AVM15785.1|2423079_2423448_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
AVM15786.1|2423447_2423966_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVM15787.1|2424032_2424689_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVM15788.1|2424786_2426001_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AVM15789.1|2426100_2428161_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVM15790.1|2428212_2428488_-	YfcL family protein	NA	NA	NA	NA	NA
AVM15791.1|2428520_2429069_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVM15792.1|2429068_2429878_-	hypothetical protein	NA	NA	NA	NA	NA
AVM15793.1|2429877_2430702_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVM15794.1|2430705_2431791_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AVM15795.1|2431826_2432759_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVM15796.1|2432924_2433476_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVM15797.1|2433575_2434061_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVM15798.1|2434278_2436417_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVM15799.1|2436416_2437727_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVM15800.1|2437904_2438189_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVM15801.1|2438553_2439867_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AVM15802.1|2439927_2440683_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVM15803.1|2440971_2441913_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.3e-145
AVM15804.1|2442226_2443396_+	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	98.5	2.9e-227
AVM15805.1|2443467_2444766_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.1	3.5e-245
AVM15806.1|2444776_2445736_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
AVM15807.1|2445744_2448465_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
AVM15808.1|2448464_2448863_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
AVM15809.1|2448869_2449454_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
AVM15810.1|2449453_2450047_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
AVM15811.1|2450398_2450662_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	5.1e-39
AVM15812.1|2450800_2454115_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	99.3	0.0e+00
AVM15813.1|2454161_2454497_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
AVM17939.1|2454553_2454832_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
AVM15814.1|2454855_2455227_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	92.6	9.7e-60
AVM15815.1|2455254_2455959_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AVM15816.1|2456015_2456363_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
AVM15817.1|2456359_2456809_-	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AVM15818.1|2456805_2457144_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AVM15819.1|2457153_2457480_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AVM15820.1|2457479_2457677_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	4.9e-10
AVM15821.1|2457720_2458938_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AVM15822.1|2458947_2459796_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AVM15823.1|2459809_2461117_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	4.2e-214
AVM15824.1|2461116_2462859_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.5	2.6e-139
AVM15825.1|2462812_2463277_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AVM15826.1|2463409_2463754_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AVM15827.1|2463872_2464325_-|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	96.0	2.0e-70
AVM15828.1|2464321_2464720_-	peptidase M15	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
AVM15829.1|2464706_2465024_-|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
AVM15830.1|2465414_2465927_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.1e-96
AVM15831.1|2466121_2466640_-	DUF1133 domain-containing protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
AVM15832.1|2466636_2466819_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	2.5e-24
AVM15833.1|2466806_2467277_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.2	1.3e-88
AVM15834.1|2467257_2467494_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	93.6	1.3e-36
AVM15835.1|2467486_2467663_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	91.2	6.9e-24
AVM15836.1|2468059_2468236_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	100.0	2.7e-28
AVM15837.1|2468634_2468964_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
AVM15838.1|2468975_2469185_-	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	97.1	2.6e-30
AVM15839.1|2469466_2469745_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.6	8.7e-45
AVM15840.1|2469741_2471118_-	replicative DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	99.6	3.7e-253
AVM17940.1|2471114_2471975_-	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
AVM15841.1|2472037_2472298_-	hypothetical protein	NA	G9L679	Escherichia_phage	74.1	3.4e-27
AVM15842.1|2472319_2472610_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
AVM15843.1|2472740_2472953_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	56.7	1.6e-14
AVM15844.1|2473054_2473750_+	phage repressor protein	NA	A0A2H4FNG6	Salmonella_phage	60.9	2.8e-76
AVM15845.1|2473988_2475008_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	2.7e-51
AVM15846.1|2475154_2475364_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	95.7	2.2e-29
AVM15847.1|2475732_2476095_+	antitermination protein	NA	C6ZR44	Salmonella_phage	89.2	3.9e-53
AVM15848.1|2476111_2476555_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
AVM17941.1|2476700_2477513_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	2.8e-43
AVM15849.1|2477546_2477825_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
AVM15850.1|2478142_2478316_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AVM15851.1|2478296_2478485_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AVM15852.1|2478614_2479322_+	recombinase	NA	I6R0N0	Salmonella_phage	95.7	7.4e-133
AVM15853.1|2479321_2479606_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AVM15854.1|2479652_2479946_+	RecBCD nuclease inhibitor	NA	I6R984	Salmonella_phage	100.0	2.5e-50
AVM15855.1|2479956_2480127_+	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	98.2	3.9e-24
AVM15856.1|2480123_2480597_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	89.3	7.3e-60
AVM15857.1|2480706_2481222_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	99.4	2.1e-97
AVM15858.1|2481218_2481734_+	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	73.2	4.4e-42
AVM15859.1|2481733_2482207_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	9.5e-68
AVM15860.1|2483211_2483397_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	100.0	2.6e-29
AVM15861.1|2483527_2483794_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
AVM15862.1|2484104_2484308_+	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	1.4e-31
AVM15863.1|2484317_2484548_+	hypothetical protein	NA	C6ZR23	Salmonella_phage	72.0	3.4e-10
AVM15864.1|2484569_2485508_-|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
>prophage 7
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	2776227	2785203	4698699		Enterobacteria_phage(83.33%)	10	NA	NA
AVM16096.1|2776227_2777424_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
AVM16097.1|2777460_2778870_-	hypothetical protein	NA	NA	NA	NA	NA
AVM16098.1|2779253_2779439_+	hypothetical protein	NA	NA	NA	NA	NA
AVM16099.1|2779402_2779969_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.2e-56
AVM16100.1|2779985_2780228_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
AVM16101.1|2780224_2780962_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
AVM16102.1|2781762_2782314_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
AVM16103.1|2782310_2782538_+	hypothetical protein	NA	NA	NA	NA	NA
AVM16104.1|2782534_2782855_+	hypothetical protein	NA	NA	NA	NA	NA
AVM16105.1|2782869_2785203_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
>prophage 8
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	3077086	3083535	4698699	tRNA	uncultured_Caudovirales_phage(33.33%)	8	NA	NA
AVM16382.1|3077086_3077260_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	5.8e-15
AVM16383.1|3077339_3077690_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	1.1e-23
AVM16384.1|3077844_3078948_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.5	1.2e-118
AVM16385.1|3079265_3080024_-	endopeptidase	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AVM16386.1|3080049_3080238_+	hypothetical protein	NA	NA	NA	NA	NA
AVM16387.1|3080288_3080834_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVM16388.1|3080909_3082427_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AVM16389.1|3082436_3083535_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
>prophage 9
CP026660	Salmonella enterica subsp. enterica strain 15-SA01028 chromosome, complete genome	4698699	4296824	4314728	4698699	tail,plate	Burkholderia_phage(42.11%)	22	NA	NA
AVM17474.1|4296824_4298579_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
AVM17475.1|4298581_4299214_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
AVM17476.1|4299206_4300322_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
AVM17477.1|4300312_4300672_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVM17478.1|4300835_4302383_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
AVM17479.1|4302382_4303312_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AVM17480.1|4303308_4303671_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AVM17481.1|4303998_4304721_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AVM17482.1|4304730_4305774_-	phage protein D	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
AVM17483.1|4305761_4305971_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	2.2e-16
AVM17484.1|4305970_4306924_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AVM17485.1|4306923_4309278_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.4	4.4e-65
AVM17486.1|4309374_4309503_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVM17487.1|4309462_4309780_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVM17488.1|4309831_4310356_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVM17489.1|4310355_4311783_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
AVM17490.1|4311772_4311970_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	50.0	1.3e-07
AVM17491.1|4311966_4312422_-	hypothetical protein	NA	NA	NA	NA	NA
AVM17492.1|4312581_4312896_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVM17493.1|4312908_4313514_-	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	59.4	5.5e-60
AVM17494.1|4313516_4313804_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AVM17495.1|4314380_4314728_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
CP026661	Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence	310921	81357	155536	310921	integrase,transposase	Salmonella_phage(22.73%)	73	90708:90722	98841:98855
AVM18098.1|81357_82620_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVM18335.1|82901_84074_+	cephalosporin-hydrolyzing class C beta-lactamase ACC-1	NA	NA	NA	NA	NA
AVM18336.1|85009_86158_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AVM18099.1|86248_86704_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18100.1|86944_87136_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18101.1|87227_87569_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18102.1|88555_88810_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18103.1|89469_90474_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVM18104.1|90552_93519_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
90708:90722	attL	GCAAGGCGTTCGCGG	NA	NA	NA	NA
AVM18105.1|93785_94043_-	DDE domain-containing protein	NA	A0A077SL39	Escherichia_phage	61.9	8.9e-12
AVM18106.1|94106_94871_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVM18107.1|94958_95072_+	NTP-binding protein	NA	NA	NA	NA	NA
AVM18108.1|95377_95878_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVM18109.1|95896_96076_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18110.1|96005_96857_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
AVM18111.1|96958_97996_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.4	7.7e-62
AVM18112.1|97967_98804_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVM18113.1|98803_99607_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
98841:98855	attR	GCAAGGCGTTCGCGG	NA	NA	NA	NA
AVM18114.1|99672_100287_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AVM18115.1|100412_103298_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.4e-190
AVM18116.1|103405_103585_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM18117.1|103753_104044_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVM18118.1|104040_104442_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVM18119.1|104431_104788_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVM18120.1|105042_105369_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18121.1|105365_105866_+|transposase	transposase	transposase	NA	NA	NA	NA
AVM18122.1|105862_106234_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18123.1|106227_106785_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AVM18124.1|106863_107868_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVM18125.1|109806_110793_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18126.1|111713_112106_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18127.1|112084_112396_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18128.1|112764_113421_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18129.1|113623_114121_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18130.1|114125_115514_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18337.1|115914_116208_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVM18131.1|116212_117538_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AVM18132.1|117598_117805_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18133.1|117905_118316_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18134.1|118328_119144_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
AVM18135.1|119396_119822_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18136.1|120370_120679_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18137.1|120694_121552_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AVM18138.1|121613_121817_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18139.1|122158_122563_-	DNA-binding protein	NA	NA	NA	NA	NA
AVM18140.1|122740_123034_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18141.1|123059_123296_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18142.1|123336_123792_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18143.1|123906_124029_+	ABC transporter	NA	NA	NA	NA	NA
AVM18144.1|124067_125048_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AVM18145.1|126410_127334_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AVM18146.1|127523_128447_+	cation transporter	NA	NA	NA	NA	NA
AVM18147.1|128791_130924_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AVM18148.1|131078_131501_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVM18149.1|131680_132088_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVM18150.1|132183_133080_+	cation transporter	NA	NA	NA	NA	NA
AVM18151.1|133083_133596_+	signal peptidase II	NA	NA	NA	NA	NA
AVM18152.1|133617_134907_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
AVM18153.1|136170_136521_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	2.3e-18
AVM18154.1|136667_137099_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVM18155.1|137349_138825_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	6.1e-28
AVM18156.1|138817_139498_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
AVM18157.1|139687_141073_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18158.1|141100_141454_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM18159.1|141567_142860_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVM18160.1|142870_146017_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.3e-61
AVM18161.1|146102_146543_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18162.1|146669_149117_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	3.1e-85
AVM18163.1|150045_150714_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.9	2.7e-23
AVM18164.1|150689_152039_+	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	2.9e-08
AVM18165.1|152251_152728_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVM18166.1|152804_154424_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AVM18167.1|154612_155536_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.7	3.2e-176
>prophage 2
CP026661	Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence	310921	169562	174831	310921		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
AVM18185.1|169562_171041_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AVM18186.1|171059_171887_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AVM18187.1|171946_172372_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AVM18188.1|172384_173674_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AVM18189.1|173719_174040_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AVM18190.1|174126_174831_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
>prophage 3
CP026661	Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence	310921	219860	263313	310921	integrase,transposase	Escherichia_phage(33.33%)	54	257980:258039	267948:269973
AVM18235.1|219860_221029_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.2e-184
AVM18236.1|221258_222443_-	DNA-binding protein	NA	NA	NA	NA	NA
AVM18237.1|222859_223090_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18238.1|223546_224491_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18239.1|224589_225189_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AVM18240.1|225248_225599_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18241.1|225645_225849_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18242.1|226130_226451_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18243.1|227059_227218_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVM18244.1|227572_228178_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18245.1|228394_228676_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18246.1|229051_229363_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18247.1|229585_229786_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18248.1|229825_230050_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18249.1|230104_230308_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18250.1|230487_230781_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
AVM18251.1|230860_231352_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AVM18252.1|231356_231668_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVM18253.1|232184_232505_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18254.1|232683_232914_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18255.1|233085_233979_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18256.1|233968_235081_-	toxic anion resistance protein	NA	NA	NA	NA	NA
AVM18340.1|235077_235863_-	protein KlaA	NA	NA	NA	NA	NA
AVM18257.1|236457_237066_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18258.1|237179_237713_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	6.8e-46
AVM18259.1|237767_237962_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18260.1|237958_238270_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18261.1|238332_238572_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18262.1|238821_241206_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AVM18263.1|241371_241821_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18264.1|241871_242663_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18265.1|242892_243150_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18266.1|243215_243542_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18267.1|243784_244105_-	hypothetical protein	NA	NA	NA	NA	NA
AVM18268.1|245531_246536_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVM18269.1|246614_247049_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVM18270.1|247120_247471_+	mercuric transporter	NA	NA	NA	NA	NA
AVM18271.1|247484_247760_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVM18341.1|247795_248218_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AVM18272.1|248269_249964_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AVM18273.1|249981_250344_+	transcriptional regulator	NA	NA	NA	NA	NA
AVM18274.1|250340_250577_+	mercury resistance protein	NA	NA	NA	NA	NA
AVM18275.1|250573_251281_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVM18276.1|251319_253035_+|transposase	transposase	transposase	NA	NA	NA	NA
AVM18277.1|253037_253898_+|transposase	transposase	transposase	NA	NA	NA	NA
AVM18278.1|255615_257139_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AVM18342.1|257128_257911_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
257980:258039	attL	ATATCGACAACCTCTCGCGCAACCAAGACATCGCGGTCGGACTGCAAGTGATCTTGAAGC	NA	NA	NA	NA
AVM18279.1|258086_258587_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVM18280.1|258605_258785_+	hypothetical protein	NA	NA	NA	NA	NA
AVM18281.1|258714_259554_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVM18282.1|259547_259895_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVM18283.1|260058_260850_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVM18284.1|260934_262155_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
AVM18285.1|262362_263313_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.6	7.5e-64
267948:269973	attR	ATATCGACAACCTCTCGCGCAACCAAGACATCGCGGTCGGACTGCAAGTGATCTTGAAGCCACGGGCCCGTCCCACCCCGACATGGACCTCGATGCCCGAACGGACGTTAGATTTCGAGTTCTAGGCGTTCTGCGATGAAGGTTGGATCCCAGCCGGGATTGAAAGTGTCGACGTGGGTGAATCCGAGCCGCTCGTATAGGCCACGCAGGTTCGGGTGGCAGTCGAGCCGCAGCTTGGCGCACCCCTGCGTTCGCGCGGCATGGCGGCAAGCCTCGATCAGCGCGGAGCTGACACCCCGGCCCGCATGTGTCCGTCGCACCGCGAGCTTGTGCAGATATGCGGCCTCCCCCTTGAGGGCGTCGGGCCAGAACTCGGGATCCTCGGCCGACAAGGTGCAACAGCCGACGATGCCGTCGCTGCAACTCGCGACTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCATTGCCGATCGCGTGAAGTTCCGCCGCAAGGCTCGCTGGACCCAGATCCTTTACAGGAAGGCCAACGGTGGCGCCCAAGAAGGATTTCCGCGACACCGAGACCAATAGCGGAAGCCCCAACGCCGACTTCAGCTTTTGAAGGTTCGACAGCACGTGCAGCGATGTTTCCGGTGCGGGGCTCAAGAAAAATCCCATCCCCGGATCGAGGATGAGCCGGTCGGCAGCGACCCCGCTCCGTCGCAAGGCGGAAACCCGCGCCTCGAAGAACCGCACAATCTCGTCGAGCGCGTCTTCGGGTCGAAGGTGACCGGTGCGGGTGGCGATGCCATCCCGCTGCGCTGAGTGCATAACCACCAGCCTGCAGTCCGCCTCAGCAATATCGGGATAGAGCGCAGGGTCAGGAAATCCTTGGATATCGTTCAGGTAGCCCACGCCGCGCTTGAGCGCATAGCGCTGGGTTTCCGGTTGGAAGCTGTCGATTGAAACACGGTGCATCTGATCGGACAGGGCGTCTAAGAGCGGCGCAATACGTCTGATCTCATCGGCCGGCGATACAGGCCTCGCGTCCGGATGGCTGGCGGCCGGTCCGACATCCACGACGTCTGATCCGACTCGCAGCATTTCGATCGCCGCGGTGACAGCGCCGGCGGGGTCTAGCCGCCGGCTCTCATCGAAGAAGGAGTCCTCGGTGAGATTCAGAATGCCGAACACCGTCACCATGGCGTCGGCCTCCGCAGCGACTTCCACGATGGGGATCGGGCGAGCAAAAAGGCAGCAATTATGAGCCCCATACCTACAAAGCCCCACGCATCAAGCTTTTGCCCATGAAGCAACCAGGCAATGGCTGTAATTATGACGACGCCGAGTCCCGACCAGACTGCATAAGCAACACCGACAGGGATGGATTTCAGAACCAGAGAAAGAAAATAAAATGCGATGCCATAACCGATTATGACAACGGCGGAAGGGGCAAGCTTAGTAAAGCCCTCGCTAGATTTTAATGCGGATGTTGCGATTACTTCGCCAACTATTGCGATAACAAGAAAAAGCCAGCCTTTCATGATATATCTCCCAATTTGTGTAGGGCTTATTATGCACGCTTAAAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACG	NA	NA	NA	NA
