The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027238	Dietzia sp. oral taxon 368 strain W5195 chromosome, complete genome	3400009	1359625	1431509	3400009	protease,transposase	Bacillus_phage(18.18%)	53	NA	NA
AVM64098.1|1359625_1361101_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
AVM64099.1|1361225_1362581_-	lipase	NA	NA	NA	NA	NA
AVM64100.1|1362592_1362958_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64101.1|1363740_1364334_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64102.1|1365960_1368489_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.9	5.4e-85
AVM64103.1|1368492_1369122_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64104.1|1369533_1370736_+	MFS transporter	NA	NA	NA	NA	NA
AVM65795.1|1370732_1371206_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64105.1|1371216_1371771_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64106.1|1371823_1373332_+	flavoprotein	NA	A0A2P0ZL82	Lactobacillus_phage	26.0	6.6e-22
AVM64107.1|1373605_1374268_+	hypothetical protein	NA	NA	NA	NA	NA
AVM65796.1|1374335_1374701_-	hypothetical protein	NA	NA	NA	NA	NA
AVM65797.1|1374798_1375941_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVM64108.1|1377264_1378083_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AVM64109.1|1378094_1378853_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AVM64110.1|1378857_1379502_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVM64111.1|1379561_1381088_-	alkane 1-monooxygenase	NA	NA	NA	NA	NA
AVM64112.1|1381337_1383197_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.4e-45
AVM64113.1|1383338_1384268_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AVM64114.1|1384341_1385664_-	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVM64115.1|1385701_1386184_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVM64116.1|1386180_1386930_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64117.1|1387001_1387532_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	40.1	2.6e-21
AVM64118.1|1387620_1388355_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AVM64119.1|1388451_1388919_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64120.1|1389264_1389531_-	cell division protein CrgA	NA	NA	NA	NA	NA
AVM64121.1|1389617_1390298_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.8	1.5e-42
AVM64122.1|1390379_1392431_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	29.6	6.7e-17
AVM64123.1|1392427_1394104_-	serine/threonine protein kinase	NA	A0A1E1EXG0	Acanthamoeba_castellanii_mimivirus	24.1	3.2e-09
AVM64124.1|1394100_1395573_-	penicillin-binding protein	NA	NA	NA	NA	NA
AVM65798.1|1395580_1396957_-	cell division protein FtsW	NA	NA	NA	NA	NA
AVM64125.1|1397046_1398489_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AVM64126.1|1398485_1398944_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64127.1|1399029_1399902_-	DUF2662 domain-containing protein	NA	NA	NA	NA	NA
AVM64128.1|1401643_1403284_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	33.9	1.0e-63
AVM64129.1|1403280_1404039_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.1	6.3e-29
AVM64130.1|1404782_1406183_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	44.9	9.6e-92
AVM64131.1|1406491_1406995_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64132.1|1407225_1411626_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64133.1|1412127_1414365_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64134.1|1414390_1416346_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64135.1|1416759_1418346_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AVM64136.1|1418350_1419772_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AVM64137.1|1419865_1421323_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVM64138.1|1421438_1422404_-	TIGR03557 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
AVM64139.1|1422407_1424258_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AVM64140.1|1424259_1425162_-	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.1	5.3e-59
AVM64141.1|1425249_1425726_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64142.1|1425777_1427052_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVM64143.1|1427184_1428129_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM64144.1|1428220_1428793_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64145.1|1428910_1430365_+	MFS transporter	NA	NA	NA	NA	NA
AVM64146.1|1430534_1431509_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP027238	Dietzia sp. oral taxon 368 strain W5195 chromosome, complete genome	3400009	1689611	1706710	3400009	integrase,tail	Gordonia_phage(64.29%)	23	1689613:1689648	1706829:1706864
AVM64319.1|1689611_1689911_-	XRE family transcriptional regulator	NA	A0A142F2H9	Mycobacterium_phage	52.0	7.9e-20
1689613:1689648	attL	CAAGAGGTTAGGGGTTCGAGTCCCTTCGGGCGCACA	NA	NA	NA	NA
AVM64320.1|1690004_1690193_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64321.1|1690189_1690369_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64322.1|1690365_1690554_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64323.1|1690550_1690751_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64324.1|1691407_1691818_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64325.1|1691810_1692086_+	HNH endonuclease	NA	A0A0K0MWF1	Gordonia_phage	58.6	2.0e-17
AVM64326.1|1692639_1694055_+	hypothetical protein	NA	G9FGU7	Rhodococcus_phage	55.3	2.1e-126
AVM64327.1|1694178_1695435_+	hypothetical protein	NA	A0A2P1CBY9	Gordonia_phage	52.5	7.8e-93
AVM64328.1|1695431_1696175_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0E3T679	Gordonia_phage	59.2	3.3e-51
AVM64329.1|1696410_1696614_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64330.1|1696556_1698353_+	hypothetical protein	NA	G9FGV2	Rhodococcus_phage	38.8	7.1e-71
AVM64331.1|1698355_1698718_+	hypothetical protein	NA	A0A2P1CBZ4	Gordonia_phage	58.9	1.2e-25
AVM64332.1|1698717_1699065_+	hypothetical protein	NA	A0A0K0MWM6	Gordonia_phage	39.6	8.7e-10
AVM64333.1|1699070_1699502_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64334.1|1699503_1699896_+	hypothetical protein	NA	A0A2P1CBZ9	Gordonia_phage	54.0	5.9e-31
AVM64335.1|1699915_1700224_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64336.1|1700374_1702468_+|tail	phage tail tape measure protein	tail	A0A2P1CC00	Gordonia_phage	41.1	2.1e-42
AVM64337.1|1702460_1703888_+	hypothetical protein	NA	G9FGV9	Rhodococcus_phage	39.6	3.2e-90
AVM64338.1|1703902_1704490_+	hypothetical protein	NA	A0A0K0N684	Gordonia_phage	31.8	1.2e-08
AVM64339.1|1704511_1705525_+	hypothetical protein	NA	A0A0K0NKS2	Gordonia_phage	43.1	8.6e-66
AVM64340.1|1705514_1705880_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64341.1|1705876_1706710_-|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	51.3	6.4e-67
1706829:1706864	attR	CAAGAGGTTAGGGGTTCGAGTCCCTTCGGGCGCACA	NA	NA	NA	NA
>prophage 3
CP027238	Dietzia sp. oral taxon 368 strain W5195 chromosome, complete genome	3400009	2364519	2427562	3400009	protease,transposase,tRNA	Bacillus_phage(14.29%)	55	NA	NA
AVM64820.1|2364519_2365269_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVM64821.1|2365338_2367447_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	27.7	2.9e-55
AVM65923.1|2367624_2369025_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AVM64822.1|2369192_2370551_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	33.6	1.0e-53
AVM64823.1|2370655_2370949_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
AVM64824.1|2370953_2371574_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
AVM64825.1|2371629_2372319_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AVM64826.1|2372315_2373131_+	glutamate racemase	NA	NA	NA	NA	NA
AVM64827.1|2373204_2373984_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64828.1|2374030_2374816_+	ribonuclease PH	NA	NA	NA	NA	NA
AVM64829.1|2374818_2375505_+	non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.3	8.0e-07
AVM64830.1|2375511_2375886_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
AVM64831.1|2375882_2376446_-	hypothetical protein	NA	NA	NA	NA	NA
AVM64832.1|2376625_2377189_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	29.3	2.7e-08
AVM64833.1|2377259_2377784_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AVM65924.1|2377812_2378382_-	gluconokinase	NA	NA	NA	NA	NA
AVM64834.1|2378396_2379236_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
AVM64835.1|2379358_2380753_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	31.1	2.1e-46
AVM64836.1|2380800_2380941_-	MetS family NSS transporter small subunit	NA	NA	NA	NA	NA
AVM64837.1|2380944_2382618_-	sodium-dependent transporter	NA	NA	NA	NA	NA
AVM64838.1|2382765_2383329_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64839.1|2383654_2393137_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AVM64840.1|2393133_2393712_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVM64841.1|2393767_2394514_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVM64842.1|2394521_2395028_-	peroxiredoxin	NA	NA	NA	NA	NA
AVM64843.1|2395176_2395452_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
AVM64844.1|2395981_2397211_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64845.1|2397222_2398506_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AVM64846.1|2399822_2400491_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	37.7	1.9e-21
AVM64847.1|2400536_2401358_-	short-chain dehydrogenase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	26.7	1.8e-05
AVM64848.1|2401480_2402203_-	hypothetical protein	NA	NA	NA	NA	NA
AVM65925.1|2402477_2403797_+	MFS transporter	NA	NA	NA	NA	NA
AVM64849.1|2403887_2404598_-	HAD family hydrolase	NA	NA	NA	NA	NA
AVM64850.1|2404695_2405685_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM64851.1|2406003_2408034_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AVM64852.1|2408200_2408716_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVM64853.1|2408840_2410514_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.0	1.3e-47
AVM64854.1|2410519_2410996_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64855.1|2410992_2411451_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVM64856.1|2411447_2411933_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVM64857.1|2411929_2412622_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64858.1|2412618_2413797_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	26.3	1.1e-24
AVM65926.1|2413824_2414967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVM65927.1|2415064_2415430_+	hypothetical protein	NA	NA	NA	NA	NA
AVM64859.1|2415426_2416170_-	oxidoreductase	NA	NA	NA	NA	NA
AVM64860.1|2416189_2417782_-	alpha-amylase	NA	NA	NA	NA	NA
AVM65928.1|2417778_2418174_-	globin	NA	NA	NA	NA	NA
AVM64861.1|2418688_2419300_+	HNH endonuclease	NA	H6WG01	Cyanophage	35.9	2.3e-21
AVM64862.1|2419355_2421965_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.0	4.6e-47
AVM64863.1|2422074_2422701_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AVM64864.1|2422765_2423239_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AVM64865.1|2423294_2424131_+	DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	22.9	5.2e-08
AVM64866.1|2424593_2425991_+	trigger factor	NA	NA	NA	NA	NA
AVM64867.1|2426228_2426870_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	51.1	1.1e-42
AVM64868.1|2426938_2427562_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	38.5	1.5e-28
