The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	1697688	1735794	5284831	head,capsid,tail,tRNA,integrase,plate,portal	Erwinia_phage(46.15%)	48	1697566:1697617	1729565:1729616
1697566:1697617	attL	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AVN49673.1|1697688_1698732_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.0	1.0e-178
AVN49674.1|1698731_1699310_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	55.3	9.9e-59
AVN49675.1|1699441_1699705_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	85.1	4.8e-37
AVN49676.1|1699736_1700246_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	5.5e-45
AVN52920.1|1700256_1700436_+	hypothetical protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
AVN49677.1|1700447_1700750_+	hypothetical protein	NA	NA	NA	NA	NA
AVN49678.1|1700814_1701108_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	54.4	6.4e-06
AVN49679.1|1701107_1701332_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
AVN49680.1|1701454_1701736_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
AVN49681.1|1701725_1702151_+	hypothetical protein	NA	NA	NA	NA	NA
AVN49682.1|1702147_1704361_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	58.9	4.7e-242
AVN52921.1|1704401_1704632_+	hypothetical protein	NA	NA	NA	NA	NA
AVN49683.1|1704646_1704877_+	hypothetical protein	NA	NA	NA	NA	NA
AVN52922.1|1704973_1705873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVN49684.1|1706001_1706574_+	flavin reductase	NA	NA	NA	NA	NA
AVN49685.1|1707098_1707353_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
AVN52923.1|1707352_1707694_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVN49686.1|1707738_1708773_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.5	3.2e-161
AVN49687.1|1708772_1710545_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	82.0	4.4e-291
AVN49688.1|1710687_1711503_+|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.1	2.7e-70
AVN49689.1|1711545_1712757_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.5	7.9e-159
AVN49690.1|1712759_1713419_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	69.4	5.2e-80
AVN49691.1|1713512_1714001_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
AVN49692.1|1714000_1714204_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
AVN49693.1|1714208_1714418_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
AVN49694.1|1714401_1714914_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.5	5.7e-58
AVN49695.1|1714910_1715339_+	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	36.6	5.5e-14
AVN49696.1|1715434_1715908_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.8	3.4e-49
AVN49697.1|1715894_1716341_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.4	4.6e-40
AVN49698.1|1716413_1717043_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	6.3e-75
AVN49699.1|1717190_1717541_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	2.2e-37
AVN49700.1|1717545_1718454_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.2	8.1e-108
AVN49701.1|1718446_1718980_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	5.7e-77
AVN49702.1|1718986_1721608_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.1	3.7e-60
AVN49703.1|1721609_1722155_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	46.4	2.0e-37
AVN49704.1|1722431_1723601_+|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	81.7	3.1e-184
AVN49705.1|1723616_1724126_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
AVN49706.1|1724180_1724462_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	5.3e-26
AVN49707.1|1724494_1724617_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
AVN49708.1|1724609_1727456_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	51.2	7.9e-109
AVN49709.1|1727460_1727946_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
AVN49710.1|1727942_1729091_+	hypothetical protein	NA	A0A218M4J7	Erwinia_phage	63.4	1.9e-125
AVN49711.1|1729181_1729412_+	transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
AVN49712.1|1729792_1730281_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
1729565:1729616	attR	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
AVN49713.1|1730355_1732197_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AVN49714.1|1732354_1734103_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
AVN49715.1|1734239_1734455_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVN49716.1|1734780_1735794_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
>prophage 2
CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	2344381	2391238	5284831	integrase,tail,terminase,holin	Escherichia_phage(23.26%)	56	2343468:2343483	2396303:2396318
2343468:2343483	attL	GACGAAGTCGGCGATG	NA	NA	NA	NA
AVN50222.1|2344381_2345845_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	8.8e-88
AVN50223.1|2345947_2347525_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AVN50224.1|2347749_2348952_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	69.3	4.8e-156
AVN50225.1|2348955_2349240_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50226.1|2349236_2349899_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	65.0	1.6e-81
AVN50227.1|2350016_2350268_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	48.8	9.3e-14
AVN50228.1|2350308_2351187_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	74.4	5.2e-120
AVN50229.1|2351183_2352005_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	79.4	1.1e-127
AVN50230.1|2352004_2352310_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50231.1|2352317_2353364_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.5	5.1e-37
AVN50232.1|2353360_2353513_-	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	50.0	1.6e-05
AVN50233.1|2353787_2354384_-	XRE family transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.8	9.5e-49
AVN50234.1|2354532_2354751_+	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
AVN50235.1|2354895_2355090_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	56.7	1.2e-13
AVN50236.1|2355089_2356040_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	59.7	4.1e-78
AVN50237.1|2355945_2356512_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.8	9.4e-22
AVN52960.1|2356775_2357075_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	7.1e-37
AVN50238.1|2357077_2357290_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	50.8	4.0e-10
AVN50239.1|2357300_2357783_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50240.1|2357779_2358442_+	hypothetical protein	NA	R9VWB9	Serratia_phage	61.1	2.6e-71
AVN50241.1|2358431_2358617_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	66.0	1.2e-15
AVN50242.1|2358613_2358889_+	hypothetical protein	NA	S4TW48	Salmonella_phage	61.4	7.3e-20
AVN50243.1|2358878_2359343_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50244.1|2359339_2359867_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	56.9	5.9e-10
AVN50245.1|2359859_2360246_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	33.0	3.0e-11
AVN50246.1|2360317_2360575_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	51.8	1.6e-16
AVN50247.1|2360681_2361230_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	66.9	1.4e-59
AVN50248.1|2361226_2362699_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	78.3	1.7e-235
AVN50249.1|2363591_2363795_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50250.1|2363797_2365483_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.5	1.4e-185
AVN52961.1|2365482_2365779_+	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	7.1e-29
AVN50251.1|2365744_2366008_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	64.2	2.0e-11
AVN50252.1|2366018_2366699_+	peptidase	NA	G9L6C4	Escherichia_phage	70.1	1.4e-51
AVN50253.1|2366704_2367691_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	71.6	1.1e-139
AVN50254.1|2367744_2368191_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	59.9	1.1e-33
AVN52962.1|2368201_2368486_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50255.1|2368525_2368849_+	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	2.7e-21
AVN50256.1|2368848_2369457_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
AVN50257.1|2369456_2371958_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.3	1.6e-307
AVN50258.1|2371957_2372431_+	hypothetical protein	NA	Q858G2	Salmonella_phage	66.0	1.1e-52
AVN50259.1|2372423_2372993_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	49.7	1.9e-30
AVN52963.1|2373002_2375759_+	hypothetical protein	NA	Q858G0	Salmonella_phage	34.6	1.9e-99
AVN50260.1|2375758_2379148_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.3	2.2e-182
AVN50261.1|2379148_2379577_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50262.1|2379601_2380036_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50263.1|2381981_2382521_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	41.0	7.3e-32
AVN50264.1|2382909_2383224_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50265.1|2383325_2383574_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50266.1|2383760_2386361_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	36.5	3.0e-54
AVN50267.1|2386392_2386626_+|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
AVN50268.1|2386609_2387125_+	glycoside hydrolase	NA	I6PBN2	Cronobacter_phage	66.0	9.7e-50
AVN50269.1|2387109_2387484_+	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	48.4	3.1e-13
AVN50270.1|2387480_2387741_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	58.6	1.5e-14
AVN50271.1|2388123_2388486_-	transcriptional regulator	NA	NA	NA	NA	NA
AVN50272.1|2388608_2389442_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AVN50273.1|2389456_2391238_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.7	3.5e-14
2396303:2396318	attR	GACGAAGTCGGCGATG	NA	NA	NA	NA
>prophage 3
CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	3034322	3070570	5284831	capsid,lysis,tail,integrase,plate,portal	Salmonella_phage(38.89%)	44	3034606:3034645	3070687:3070726
AVN50825.1|3034322_3034535_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	9.9e-25
3034606:3034645	attL	AAAAAAAGCCCGCAAGTCTGCGGGCAAAAGTTCCTTGTTA	NA	NA	NA	NA
AVN50826.1|3034726_3034948_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.7	4.3e-23
AVN50827.1|3035255_3036065_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	83.6	1.4e-138
AVN50828.1|3036212_3037304_-	late control protein D	NA	E5G6Q3	Salmonella_phage	58.6	4.1e-114
AVN50829.1|3037300_3037765_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.9	2.0e-49
AVN52995.1|3037776_3040695_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	53.3	1.1e-158
AVN52996.1|3040687_3040825_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	73.7	5.8e-10
AVN50830.1|3040821_3041148_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	5.1e-20
AVN50831.1|3041219_3041735_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.3	2.0e-58
AVN50832.1|3041745_3042918_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	80.4	4.2e-181
AVN50833.1|3043111_3044203_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	44.8	4.8e-30
AVN50834.1|3044212_3045124_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50835.1|3045120_3047457_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	25.8	6.6e-37
AVN50836.1|3047449_3048061_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.8	4.2e-60
AVN50837.1|3048053_3048962_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.5	4.8e-108
AVN50838.1|3048961_3049309_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	57.3	5.2e-31
AVN50839.1|3049305_3049944_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	58.3	8.3e-59
AVN50840.1|3050025_3050481_-	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	47.6	6.4e-29
AVN50841.1|3050468_3050936_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	51.0	2.9e-37
AVN50842.1|3050944_3051382_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	46.6	1.8e-20
AVN50843.1|3051378_3051858_-	lysozyme	NA	I6S1V9	Salmonella_phage	58.8	2.2e-51
AVN50844.1|3051857_3052124_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVN50845.1|3052145_3052349_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	55.2	3.3e-17
AVN50846.1|3052348_3052870_-	hypothetical protein	NA	A0A1S6KZW8	Salmonella_phage	49.0	5.8e-34
AVN50847.1|3052961_3053618_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.9	4.0e-40
AVN50848.1|3053621_3054716_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	62.3	1.2e-121
AVN50849.1|3054776_3055577_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	45.6	2.6e-49
AVN50850.1|3055764_3057534_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	65.8	3.5e-232
AVN50851.1|3057534_3058569_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.6	1.6e-136
AVN50852.1|3059242_3060421_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50853.1|3060529_3060874_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	42.2	2.5e-17
AVN50854.1|3060875_3063476_-	replication protein	NA	F1BUS0	Erwinia_phage	60.5	4.7e-225
AVN52997.1|3063472_3064483_-	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	42.0	3.0e-63
AVN50855.1|3064524_3065154_-	hypothetical protein	NA	A0A088FQU9	Escherichia_phage	59.2	3.5e-09
AVN50856.1|3065146_3065971_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	46.6	8.5e-64
AVN50857.1|3065967_3066819_-	hypothetical protein	NA	A0A1D9C9N8	Salinivibrio_phage	59.8	2.6e-55
AVN50858.1|3066822_3067041_-	hypothetical protein	NA	A0A0M3LQ09	Mannheimia_phage	38.9	1.5e-07
AVN50859.1|3067187_3067385_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50860.1|3067671_3067944_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50861.1|3067940_3068141_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50862.1|3068155_3068356_-	hypothetical protein	NA	NA	NA	NA	NA
AVN50863.1|3068604_3068904_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	45.2	1.8e-19
AVN50864.1|3068990_3069554_+	hypothetical protein	NA	NA	NA	NA	NA
AVN50865.1|3069556_3070570_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	48.3	2.6e-86
3070687:3070726	attR	AAAAAAAGCCCGCAAGTCTGCGGGCAAAAGTTCCTTGTTA	NA	NA	NA	NA
>prophage 4
CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	5273384	5282088	5284831		Enterobacteria_phage(66.67%)	9	NA	NA
AVN52831.1|5273384_5275718_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.0	3.6e-261
AVN52832.1|5275728_5276064_-	hypothetical protein	NA	NA	NA	NA	NA
AVN52833.1|5276060_5276324_-	hypothetical protein	NA	NA	NA	NA	NA
AVN52834.1|5276320_5276866_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.4	7.7e-21
AVN52835.1|5276871_5277117_-	hypothetical protein	NA	NA	NA	NA	NA
AVN52836.1|5277113_5277377_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
AVN52837.1|5278112_5279303_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.1	2.8e-140
AVN52838.1|5279721_5280981_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
AVN52839.1|5280984_5282088_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
