The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	0	12824	5022408		Tetraselmis_virus(20.0%)	11	NA	NA
AVN36717.1|1236_2496_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVN36718.1|2624_4118_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	8.0e-28
AVN36719.1|4138_4900_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36720.1|5456_5666_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
AVN36721.1|5769_6900_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AVN36722.1|6988_8905_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AVN36723.1|9275_9680_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36724.1|9705_10419_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36725.1|10567_11134_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36726.1|11168_11756_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVN36727.1|11870_12824_-	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 2
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	20972	84144	5022408	tail,head,integrase,tRNA,plate	Burkholderia_virus(36.96%)	77	46487:46503	81163:81179
AVN36734.1|20972_21659_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVN36735.1|22058_22199_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36736.1|22294_23011_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVN36737.1|23070_24423_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AVN36738.1|24480_25905_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
AVN36739.1|25904_26594_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AVN36740.1|26606_27080_-	protein CreA	NA	NA	NA	NA	NA
AVN36741.1|27290_28160_+	right origin-binding protein	NA	NA	NA	NA	NA
AVN36742.1|28156_28804_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
AVN41397.1|28855_29383_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AVN36743.1|29461_29788_-	trp operon repressor	NA	NA	NA	NA	NA
AVN36744.1|29877_31815_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AVN36745.1|32021_33689_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
AVN36746.1|33809_35042_-	trifunctional NAD biosynthesis/regulator protein NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AVN36747.1|35062_36445_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AVN36748.1|36493_37462_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AVN36749.1|37567_38212_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36750.1|38239_39256_+	lipoate-protein ligase LplA	NA	NA	NA	NA	NA
AVN36751.1|39256_40588_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AVN36752.1|40754_41474_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AVN36753.1|41530_42754_-	phosphopentomutase	NA	NA	NA	NA	NA
AVN36754.1|42805_44128_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
AVN36755.1|44205_44985_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
46487:46503	attL	TTATTCCGGCATCAGCG	NA	NA	NA	NA
AVN36756.1|46768_47341_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AVN36757.1|47400_47925_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
AVN36758.1|47924_48539_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AVN36759.1|48545_49019_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AVN36760.1|49029_50952_-	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.8	6.9e-40
AVN36761.1|50954_51533_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AVN36762.1|51525_52629_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
AVN36763.1|52619_52967_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
AVN36764.1|53021_53618_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AVN36765.1|53614_54787_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
AVN36766.1|54774_54990_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AVN36767.1|54986_55871_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AVN36768.1|55870_59083_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
AVN36769.1|59158_59317_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVN36770.1|59240_59576_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVN36771.1|59673_59955_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36772.1|59957_60479_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AVN36773.1|60478_61906_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AVN36774.1|61895_62150_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36775.1|62146_62611_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AVN36776.1|62610_63057_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AVN36777.1|63058_63397_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AVN36778.1|63406_64360_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AVN36779.1|64374_65490_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AVN36780.1|65704_66163_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AVN36781.1|66165_66987_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
AVN36782.1|66967_68464_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
AVN36783.1|68463_69987_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
AVN36784.1|69983_70526_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
AVN36785.1|70528_70840_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
AVN36786.1|70839_71166_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AVN41398.1|71162_71774_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
AVN36787.1|71802_72540_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
AVN36788.1|72542_72893_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
AVN36789.1|73023_73767_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36790.1|73742_74147_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36791.1|74145_74361_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36792.1|74552_75317_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
AVN36793.1|75433_75772_-	transcriptional regulator	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
AVN36794.1|75872_76061_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AVN36795.1|76113_76422_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
AVN36796.1|76432_77344_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
AVN36797.1|77347_79117_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.3	4.8e-229
AVN36798.1|79127_80294_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
AVN36799.1|80296_80566_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36800.1|80593_81124_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	6.9e-59
AVN36801.1|81411_81684_+	hypothetical protein	NA	NA	NA	NA	NA
81163:81179	attR	TTATTCCGGCATCAGCG	NA	NA	NA	NA
AVN36802.1|81693_81990_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36803.1|82004_82220_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36804.1|82216_82900_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.5	1.7e-33
AVN36805.1|82896_83127_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36806.1|83116_83332_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36807.1|83321_83774_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
AVN36808.1|83745_84144_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
>prophage 3
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	88685	91561	5022408		Salmonella_phage(50.0%)	3	NA	NA
AVN36813.1|88685_88865_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AVN36814.1|88973_89579_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVN36815.1|89971_91561_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 4
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	99391	100671	5022408		Salmonella_phage(50.0%)	2	NA	NA
AVN36825.1|99391_99931_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AVN36826.1|99933_100671_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 5
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	103898	109265	5022408		Tupanvirus(50.0%)	4	NA	NA
AVN36828.1|103898_104921_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.1	2.1e-11
AVN36829.1|105059_105974_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AVN36830.1|106190_107552_+	MFS transporter	NA	NA	NA	NA	NA
AVN36831.1|107600_109265_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 6
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	115048	124597	5022408		Bodo_saltans_virus(33.33%)	6	NA	NA
AVN36838.1|115048_116668_+	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
AVN36839.1|117785_121049_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
AVN36840.1|121263_121602_+	endoribonuclease SymE	NA	NA	NA	NA	NA
AVN36841.1|121644_121809_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
AVN36842.1|121985_123398_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVN36843.1|123640_124597_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.2	1.0e-60
>prophage 7
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	132098	132653	5022408		Clostridioides_phage(100.0%)	1	NA	NA
AVN36853.1|132098_132653_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 8
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	139176	140637	5022408		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVN36862.1|139176_140637_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 9
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	150832	206065	5022408	holin,transposase	Escherichia_phage(18.75%)	59	NA	NA
AVN36874.1|150832_151429_-	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AVN41402.1|151906_152314_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	57.8	1.3e-41
AVN36875.1|152413_152932_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AVN36876.1|152950_154171_+|transposase	ISL3 family transposase ISEc53	transposase	NA	NA	NA	NA
AVN36877.1|154659_155055_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36878.1|155336_155486_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36879.1|155852_156569_+	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AVN36880.1|156588_157695_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AVN36881.1|157758_158739_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
AVN36882.1|159321_160422_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36883.1|160437_161585_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AVN36884.1|161747_162002_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVN36885.1|162502_162685_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36886.1|163105_165181_+	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
AVN36887.1|165173_166460_+	restriction endonuclease	NA	NA	NA	NA	NA
AVN36888.1|166569_168309_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
AVN36889.1|168321_169512_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
AVN36890.1|169504_171145_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AVN36891.1|172715_172892_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVN36892.1|172908_173397_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36893.1|173393_173771_-	toxin	NA	NA	NA	NA	NA
AVN36894.1|173860_174229_-	antitoxin	NA	NA	NA	NA	NA
AVN36895.1|174391_174613_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AVN41403.1|174675_175122_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36896.1|175167_175641_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
AVN36897.1|175982_176801_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
AVN36898.1|176821_176956_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVN36899.1|176955_177150_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36900.1|177184_180031_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AVN36901.1|180403_181276_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AVN36902.1|181360_182278_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36903.1|182410_182626_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36904.1|183109_183307_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41404.1|183375_183573_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36905.1|183478_184096_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36906.1|184176_184437_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVN36907.1|184379_184586_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36908.1|185156_185306_+	hemolysin activation protein	NA	NA	NA	NA	NA
AVN36909.1|185325_185526_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36910.1|185638_185836_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36911.1|185999_186605_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVN36912.1|186858_187266_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36913.1|187166_187688_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36914.1|187687_187924_+	hypothetical protein	NA	NA	NA	NA	NA
AVN36915.1|188042_188423_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AVN36916.1|188419_188767_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AVN36917.1|188816_190202_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AVN36918.1|190440_191814_-	esterase-like activity of phytase	NA	NA	NA	NA	NA
AVN36919.1|193360_193882_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AVN36920.1|193878_194832_+	protein FecR	NA	NA	NA	NA	NA
AVN36921.1|194918_197243_+	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AVN36922.1|197287_198190_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AVN36923.1|198186_199185_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AVN36924.1|199181_200138_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AVN36925.1|200138_200906_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVN36926.1|201462_201876_-	hypothetical protein	NA	NA	NA	NA	NA
AVN36927.1|202653_203809_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AVN36928.1|203958_205962_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AVN36929.1|205906_206065_+|holin	choline transporter	holin	NA	NA	NA	NA
>prophage 10
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	214367	217358	5022408	transposase	Stx2-converting_phage(50.0%)	4	NA	NA
AVN36942.1|214367_215981_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVN36943.1|216011_216362_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVN36944.1|216358_216784_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AVN36945.1|217121_217358_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
>prophage 11
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	227319	238803	5022408	tRNA	Stenotrophomonas_phage(20.0%)	8	NA	NA
AVN36952.1|227319_227910_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.9	3.7e-29
AVN36953.1|228376_229396_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
AVN36954.1|229525_231028_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
AVN36955.1|231188_232271_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVN36956.1|232270_233371_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVN36957.1|233637_235149_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVN36958.1|235504_235948_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVN36959.1|235947_238803_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 12
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	247071	253168	5022408		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AVN36969.1|247071_248007_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AVN36970.1|248019_248481_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVN36971.1|248553_248940_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVN36972.1|249145_251842_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AVN41409.1|251982_252036_-	MgtA leader peptide	NA	NA	NA	NA	NA
AVN36973.1|252220_253168_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 13
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	256806	259568	5022408		Vibrio_phage(50.0%)	2	NA	NA
AVN36976.1|256806_258945_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
AVN36977.1|259103_259568_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 14
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	263878	270366	5022408		Klosneuvirus(33.33%)	6	NA	NA
AVN36982.1|263878_264877_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AVN36983.1|264909_265905_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVN36984.1|265891_266917_-	ABC transporter permease	NA	NA	NA	NA	NA
AVN36985.1|266927_268430_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
AVN36986.1|268569_269526_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN36987.1|269835_270366_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 15
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	313107	314271	5022408		Ralstonia_phage(100.0%)	1	NA	NA
AVN37036.1|313107_314271_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 16
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	318113	331138	5022408	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AVN37043.1|318113_320555_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
AVN37044.1|320593_321019_-	transcriptional regulator	NA	NA	NA	NA	NA
AVN37045.1|321223_322522_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.4	1.7e-66
AVN37046.1|322625_322823_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVN37047.1|322904_323909_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVN37048.1|323911_325171_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AVN37049.1|325256_326537_-	GTPase HflX	NA	NA	NA	NA	NA
AVN37050.1|326612_326921_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVN37051.1|327006_327957_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVN37052.1|327949_329797_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
AVN37053.1|329806_331138_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
>prophage 17
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	335053	335599	5022408		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVN37057.1|335053_335599_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 18
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	343319	344297	5022408		Tupanvirus(100.0%)	1	NA	NA
AVN37063.1|343319_344297_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 19
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	349217	349751	5022408		Morganella_phage(100.0%)	1	NA	NA
AVN37069.1|349217_349751_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 20
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	353955	355939	5022408		Vibrio_phage(50.0%)	2	NA	NA
AVN37077.1|353955_355602_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AVN37078.1|355645_355939_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 21
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	370216	385410	5022408	tRNA	Enterobacteria_phage(50.0%)	9	NA	NA
AVN37090.1|370216_371674_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
AVN37091.1|371910_373428_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AVN37092.1|373546_373720_-	DUF2566 domain-containing protein	NA	NA	NA	NA	NA
AVN37093.1|373747_374044_-	endoribonuclease GhoS	NA	NA	NA	NA	NA
AVN37094.1|374271_374544_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVN37095.1|374757_378687_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.3	4.9e-218
AVN37096.1|379542_379722_+	hypothetical protein	NA	NA	NA	NA	NA
AVN37097.1|379842_380673_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVN37098.1|381570_385410_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.2	0.0e+00
>prophage 22
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	409240	410743	5022408		Burkholderia_virus(100.0%)	1	NA	NA
AVN37116.1|409240_410743_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 23
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	415583	416372	5022408		Pithovirus(100.0%)	1	NA	NA
AVN37120.1|415583_416372_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 24
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	421975	423525	5022408		Bacillus_virus(50.0%)	2	NA	NA
AVN37128.1|421975_422734_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
AVN37129.1|422844_423525_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 25
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	429650	436019	5022408		Bacillus_virus(50.0%)	5	NA	NA
AVN37137.1|429650_431183_+	allose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
AVN37138.1|431161_432142_+	allose ABC transporter	NA	NA	NA	NA	NA
AVN37139.1|432152_432848_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVN37140.1|432831_433761_+	allose kinase	NA	NA	NA	NA	NA
AVN37141.1|434033_436019_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.9e-149
>prophage 26
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	441264	443412	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN37146.1|441264_443412_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 27
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	447329	448857	5022408		Planktothrix_phage(100.0%)	2	NA	NA
AVN37150.1|447329_448166_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
AVN37151.1|448152_448857_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 28
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	458568	460527	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN37163.1|458568_460527_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 29
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	466651	468001	5022408		Moraxella_phage(100.0%)	1	NA	NA
AVN37170.1|466651_468001_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 30
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	471818	475432	5022408		Enterobacteria_phage(50.0%)	2	NA	NA
AVN37178.1|471818_472355_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AVN37179.1|472609_475432_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 31
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	485375	486794	5022408		Erysipelothrix_phage(100.0%)	1	NA	NA
AVN37189.1|485375_486794_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.6e-38
>prophage 32
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	492193	496322	5022408		Cronobacter_phage(25.0%)	4	NA	NA
AVN37193.1|492193_493198_-	ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
AVN37194.1|493194_493752_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	28.8	2.2e-15
AVN37195.1|493774_494854_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
AVN37196.1|494906_496322_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 33
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	508442	509051	5022408		Lactococcus_phage(100.0%)	1	NA	NA
AVN37208.1|508442_509051_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 34
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	516403	517519	5022408		Mycoplasma_phage(100.0%)	1	NA	NA
AVN37214.1|516403_517519_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 35
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	541858	545542	5022408		Dickeya_phage(100.0%)	1	NA	NA
AVN37239.1|541858_545542_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 36
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	559323	560913	5022408		Prochlorococcus_phage(100.0%)	1	NA	NA
AVN37247.1|559323_560913_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 37
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	566275	568039	5022408		Bacillus_phage(50.0%)	3	NA	NA
AVN37253.1|566275_566548_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AVN37254.1|566734_567325_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVN37255.1|567367_568039_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	3.6e-20
>prophage 38
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	576335	584664	5022408		Vibrio_phage(50.0%)	2	NA	NA
AVN37265.1|576335_580559_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
AVN37266.1|580635_584664_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 39
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	588659	591712	5022408		Tupanvirus(50.0%)	4	NA	NA
AVN37273.1|588659_589844_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVN37274.1|590419_590575_+	hypothetical protein	NA	NA	NA	NA	NA
AVN37275.1|590584_590779_-	hypothetical protein	NA	NA	NA	NA	NA
AVN37276.1|590761_591712_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 40
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	604612	605929	5022408		Burkholderia_virus(100.0%)	1	NA	NA
AVN37282.1|604612_605929_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
>prophage 41
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	621681	628928	5022408		Serratia_phage(33.33%)	5	NA	NA
AVN37295.1|621681_623979_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AVN37296.1|624029_624350_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVN37297.1|624364_625444_-	PTS fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AVN37298.1|625752_628254_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AVN37299.1|628265_628928_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 42
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	635741	637295	5022408		Pandoravirus(100.0%)	1	NA	NA
AVN37305.1|635741_637295_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
>prophage 43
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	648917	653420	5022408		Erwinia_phage(50.0%)	5	NA	NA
AVN37316.1|648917_650249_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AVN37317.1|650315_651242_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVN37318.1|651334_651820_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVN37319.1|651904_652150_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVN37320.1|652574_653420_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 44
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	665030	669956	5022408		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVN37333.1|665030_665729_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVN37334.1|665725_667099_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AVN37335.1|667269_667944_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVN37336.1|668092_669076_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVN37337.1|669053_669161_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVN37338.1|669335_669956_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
>prophage 45
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	698859	703590	5022408		Prochlorococcus_phage(33.33%)	5	NA	NA
AVN37368.1|698859_699870_-	Zn-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
AVN37369.1|699902_700790_-	aldolase	NA	NA	NA	NA	NA
AVN37370.1|700814_701693_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
AVN37371.1|701865_702762_+	ribokinase	NA	NA	NA	NA	NA
AVN37372.1|702801_703590_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
>prophage 46
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	707476	709947	5022408		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVN37375.1|707476_708526_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
AVN41426.1|708537_709947_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 47
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	714068	716855	5022408		uncultured_virus(100.0%)	1	NA	NA
AVN37379.1|714068_716855_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 48
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	730452	731067	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN37389.1|730452_731067_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 49
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	739846	743133	5022408		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVN37397.1|739846_740623_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AVN37398.1|740625_741141_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVN37399.1|741144_741414_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVN37400.1|741492_743133_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 50
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	765127	766636	5022408		Vibrio_phage(100.0%)	1	NA	NA
AVN37422.1|765127_766636_-	PTS N-acetylglucosamine transporter subunit IICB	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 51
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	774488	777901	5022408	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVN37430.1|774488_775349_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
AVN37431.1|775386_776007_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AVN41428.1|776071_777901_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 52
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	784505	788364	5022408		Bacillus_phage(100.0%)	3	NA	NA
AVN37440.1|784505_786668_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AVN37441.1|786751_787468_-	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AVN37442.1|787467_788364_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 53
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	799259	800915	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
AVN37455.1|799259_800915_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 54
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	808922	815066	5022408		Enterobacteria_phage(40.0%)	6	NA	NA
AVN37462.1|808922_810053_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	7.4e-18
AVN37463.1|810057_810732_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVN37464.1|810709_811591_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AVN37465.1|811609_812677_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.3e-101
AVN37466.1|812676_813939_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
AVN37467.1|813935_815066_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 55
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	819108	824522	5022408		Indivirus(33.33%)	5	NA	NA
AVN37472.1|819108_819438_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVN37473.1|819568_820834_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AVN37474.1|820841_820964_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVN37475.1|820969_822454_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVN37476.1|822500_824522_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 56
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	832118	833765	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVN37483.1|832118_833765_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 57
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	847164	853017	5022408		Enterobacteria_phage(33.33%)	5	NA	NA
AVN37491.1|847164_848055_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AVN37492.1|848079_849045_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVN37493.1|849049_850555_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AVN41432.1|850562_850982_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVN37494.1|851148_853017_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 58
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	856185	857178	5022408		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVN37496.1|856185_857178_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 59
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	869133	876648	5022408		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AVN37511.1|869133_870504_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
AVN37512.1|870665_872495_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
AVN37513.1|872808_873849_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AVN37514.1|873934_874894_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVN37515.1|874893_875784_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AVN37516.1|875874_876648_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 60
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	887627	888965	5022408		Moraxella_phage(100.0%)	1	NA	NA
AVN37526.1|887627_888965_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 61
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	899162	906531	5022408		Staphylococcus_phage(33.33%)	8	NA	NA
AVN37535.1|899162_899420_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVN37536.1|899383_899743_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVN37537.1|899759_899900_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVN37538.1|900012_900213_+	hypothetical protein	NA	NA	NA	NA	NA
AVN37539.1|900506_901910_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVN37540.1|901914_903015_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVN37541.1|903014_904088_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVN37542.1|904116_906531_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 62
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	911139	912288	5022408		Oenococcus_phage(100.0%)	1	NA	NA
AVN37549.1|911139_912288_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 63
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	916717	928597	5022408		Cyanophage(20.0%)	12	NA	NA
AVN37553.1|916717_917131_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AVN37554.1|917242_917671_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AVN37555.1|917868_919530_+	putative transporter	NA	NA	NA	NA	NA
AVN37556.1|919619_920486_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVN37557.1|920652_922368_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
AVN37558.1|923918_924266_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AVN37559.1|924255_924618_+	hypothetical protein	NA	NA	NA	NA	NA
AVN37560.1|924614_925112_+	radical SAM protein	NA	NA	NA	NA	NA
AVN37561.1|925119_926304_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
AVN37562.1|926343_926535_-	hypothetical protein	NA	NA	NA	NA	NA
AVN37563.1|926704_926803_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVN37564.1|926908_928597_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
>prophage 64
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	937238	938573	5022408		Moraxella_phage(100.0%)	1	NA	NA
AVN41436.1|937238_938573_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	1.1e-65
>prophage 65
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	944823	945861	5022408		Wolbachia_phage(100.0%)	1	NA	NA
AVN37579.1|944823_945861_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 66
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	959122	960514	5022408		environmental_Halophage(100.0%)	1	NA	NA
AVN37591.1|959122_960514_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 67
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	964815	969836	5022408		Bordetella_phage(33.33%)	4	NA	NA
AVN37595.1|964815_966924_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVN37596.1|966942_967218_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVN37597.1|967272_967896_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AVN37598.1|968153_969836_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.0	5.7e-22
>prophage 68
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	973854	978417	5022408		Xanthomonas_phage(25.0%)	7	NA	NA
AVN41438.1|973854_974310_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AVN37604.1|974290_975511_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.2e-43
AVN37605.1|975682_976351_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVN37606.1|976567_976804_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVN37607.1|976824_976992_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVN37608.1|977089_977899_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AVN37609.1|977937_978417_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 69
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	993317	1002822	5022408		Synechococcus_phage(16.67%)	9	NA	NA
AVN37624.1|993317_994250_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
AVN37625.1|994463_995660_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
AVN37626.1|995669_996695_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVN37627.1|996933_997968_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AVN37628.1|997954_998914_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVN37629.1|998917_1000201_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AVN37630.1|1000210_1001755_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVN37631.1|1001998_1002430_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVN37632.1|1002570_1002822_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 70
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1024530	1029142	5022408	tRNA	Tupanvirus(50.0%)	3	NA	NA
AVN37651.1|1024530_1026375_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	4.3e-15
AVN37652.1|1026565_1027717_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AVN37653.1|1027846_1029142_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 71
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1053190	1054732	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN37675.1|1053190_1054732_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 72
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1060049	1061045	5022408		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVN37681.1|1060049_1061045_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 73
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1064901	1066924	5022408	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AVN37685.1|1064901_1066270_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AVN37686.1|1066371_1066524_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AVN37687.1|1066711_1066924_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 74
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1070578	1072912	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN37692.1|1070578_1072912_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 75
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1082956	1084941	5022408		Planktothrix_phage(50.0%)	2	NA	NA
AVN37701.1|1082956_1083940_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
AVN37702.1|1083936_1084941_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 76
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1131844	1133314	5022408		Bacillus_virus(50.0%)	2	NA	NA
AVN41442.1|1131844_1132492_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
AVN37742.1|1132543_1133314_-	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 77
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1143987	1149396	5022408		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AVN37753.1|1143987_1144413_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
AVN37754.1|1144504_1144726_-	hypothetical protein	NA	NA	NA	NA	NA
AVN37755.1|1144747_1144831_+	Damage inducible protein	NA	NA	NA	NA	NA
AVN37756.1|1144884_1146237_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AVN37757.1|1146308_1147151_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AVN37758.1|1147353_1149396_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 78
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1159083	1161819	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN37767.1|1159083_1161819_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 79
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1169257	1170064	5022408		Bacillus_virus(100.0%)	1	NA	NA
AVN37777.1|1169257_1170064_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	7.6e-17
>prophage 80
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1177957	1182078	5022408		Dickeya_phage(50.0%)	4	NA	NA
AVN37786.1|1177957_1178623_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
AVN37787.1|1178832_1179078_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AVN37788.1|1179179_1181378_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
AVN37789.1|1181451_1182078_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 81
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1185084	1187903	5022408		Staphylococcus_phage(50.0%)	3	NA	NA
AVN37794.1|1185084_1185753_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AVN37795.1|1185745_1186804_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVN37796.1|1187048_1187903_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 82
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1194382	1195865	5022408		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVN37805.1|1194382_1195150_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AVN37806.1|1195151_1195865_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 83
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1199406	1201217	5022408		Planktothrix_phage(50.0%)	2	NA	NA
AVN37810.1|1199406_1200477_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AVN37811.1|1200473_1201217_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	1.1e-09
>prophage 84
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1209473	1211570	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVN37820.1|1209473_1211570_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 85
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1221899	1224347	5022408		Dickeya_phage(100.0%)	1	NA	NA
AVN37828.1|1221899_1224347_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 86
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1235321	1237715	5022408		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVN37838.1|1235321_1237715_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 87
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1243752	1244163	5022408	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVN37844.1|1243752_1244163_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	42.5	9.3e-11
>prophage 88
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1250753	1258134	5022408	transposase	Bacillus_phage(50.0%)	6	NA	NA
AVN37851.1|1250753_1251473_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	5.9e-29
AVN37852.1|1251469_1252822_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AVN37853.1|1252898_1254521_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
AVN37854.1|1254692_1254824_+	hypothetical protein	NA	NA	NA	NA	NA
AVN37855.1|1254898_1256623_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
AVN37856.1|1256925_1258134_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
>prophage 89
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1272995	1273832	5022408		Vibrio_phage(100.0%)	1	NA	NA
AVN37870.1|1272995_1273832_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 90
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1292746	1302287	5022408		Acinetobacter_phage(25.0%)	10	NA	NA
AVN37892.1|1292746_1293310_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
AVN37893.1|1293395_1294616_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVN37894.1|1294682_1296785_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
AVN37895.1|1296823_1297456_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVN37896.1|1297462_1297678_-	hypothetical protein	NA	NA	NA	NA	NA
AVN37897.1|1297757_1298162_+	OsmC family protein	NA	NA	NA	NA	NA
AVN37898.1|1298216_1299086_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVN37899.1|1299139_1299358_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AVN37900.1|1299351_1300374_-	hydrolase	NA	NA	NA	NA	NA
AVN37901.1|1300373_1302287_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 91
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1307857	1316424	5022408		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
AVN37910.1|1307857_1308244_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
AVN37911.1|1308243_1308603_+	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AVN37912.1|1308609_1308897_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVN37913.1|1309022_1309397_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVN37914.1|1309493_1309964_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVN37915.1|1310060_1312175_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AVN37916.1|1312245_1313430_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVN37917.1|1313721_1316424_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
>prophage 92
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1325249	1327202	5022408		Vibrio_phage(100.0%)	1	NA	NA
AVN41448.1|1325249_1327202_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 93
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1348426	1349898	5022408	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVN37966.1|1348426_1349374_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AVN37967.1|1349388_1349898_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 94
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1360238	1364392	5022408		Bacillus_virus(50.0%)	4	NA	NA
AVN37975.1|1360238_1360997_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
AVN37976.1|1361004_1362108_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVN37977.1|1362117_1363299_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVN37978.1|1363366_1364392_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 95
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1370896	1371781	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVN37986.1|1370896_1371781_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 96
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1377117	1381629	5022408		Escherichia_phage(50.0%)	4	NA	NA
AVN37993.1|1377117_1377948_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
AVN37994.1|1378288_1379143_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AVN37995.1|1379178_1380069_+	sugar ABC transporter	NA	NA	NA	NA	NA
AVN37996.1|1380129_1381629_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 97
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1390915	1391959	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVN38006.1|1390915_1391959_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 98
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1409604	1410972	5022408	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVN38021.1|1409604_1410972_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 99
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1414939	1418950	5022408		Pseudomonas_phage(50.0%)	4	NA	NA
AVN38027.1|1414939_1415437_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
AVN38028.1|1415544_1416336_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVN38029.1|1416457_1417351_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVN38030.1|1417459_1418950_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 100
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1427653	1442447	5022408		Staphylococcus_phage(25.0%)	17	NA	NA
AVN41452.1|1427653_1428583_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AVN38037.1|1428678_1431015_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AVN38038.1|1431244_1431898_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AVN38039.1|1431894_1432623_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVN38040.1|1432619_1433252_-	protein YrbL	NA	NA	NA	NA	NA
AVN38041.1|1433464_1433737_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AVN38042.1|1433733_1434588_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AVN38043.1|1434633_1435125_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVN38044.1|1435242_1435530_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AVN38045.1|1435552_1436986_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVN38046.1|1437033_1437759_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVN38047.1|1437765_1438323_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVN38048.1|1438291_1438867_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVN38049.1|1438863_1439430_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AVN38050.1|1439450_1440437_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AVN38051.1|1440450_1441428_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVN38052.1|1441637_1442447_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 101
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1446515	1447998	5022408		Vibrio_phage(50.0%)	2	NA	NA
AVN38057.1|1446515_1446794_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AVN38058.1|1447026_1447998_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 102
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1454627	1457500	5022408	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVN38067.1|1454627_1456562_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AVN38068.1|1456651_1457500_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
>prophage 103
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1461580	1468219	5022408		Dickeya_phage(50.0%)	4	NA	NA
AVN38072.1|1461580_1462924_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AVN41456.1|1463554_1464007_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVN38073.1|1464034_1465522_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVN38074.1|1465546_1468219_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 104
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1473700	1475590	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVN38081.1|1473700_1475590_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 105
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1481292	1489088	5022408		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AVN38088.1|1481292_1481595_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AVN38089.1|1481645_1482089_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38090.1|1482068_1482587_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	4.4e-10
AVN38091.1|1482714_1483350_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38092.1|1483422_1484463_+	permease	NA	NA	NA	NA	NA
AVN38093.1|1484575_1485151_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVN38094.1|1485160_1485751_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AVN38095.1|1485770_1486166_-	YraN family protein	NA	NA	NA	NA	NA
AVN38096.1|1486123_1488160_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVN38097.1|1488224_1489088_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 106
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1506708	1507854	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN38117.1|1506708_1507854_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 107
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1514009	1516304	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
AVN38122.1|1514009_1516304_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.0e-158
>prophage 108
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1537366	1538332	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN38143.1|1537366_1538332_-	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 109
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1550987	1567135	5022408	tRNA	Herpes_simplex_virus(16.67%)	16	NA	NA
AVN38155.1|1550987_1554080_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	2.6e-158
AVN38156.1|1554263_1555247_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVN38157.1|1555176_1555359_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38158.1|1555465_1555798_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVN41460.1|1555839_1557219_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
AVN41461.1|1557154_1557361_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38159.1|1557636_1559157_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
AVN38160.1|1559263_1559887_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVN38161.1|1560174_1560939_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AVN38162.1|1561192_1561699_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVN38163.1|1561776_1563618_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVN38164.1|1563676_1563799_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVN38165.1|1563812_1565558_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
AVN38166.1|1565668_1565884_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVN38167.1|1565882_1566113_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38168.1|1566121_1567135_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 110
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1573435	1574674	5022408		Sinorhizobium_phage(100.0%)	1	NA	NA
AVN38176.1|1573435_1574674_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.0	3.8e-92
>prophage 111
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1579811	1581245	5022408		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVN38180.1|1579811_1581245_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 112
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1585158	1585812	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN38186.1|1585158_1585812_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 113
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1597051	1609497	5022408		Ralstonia_phage(16.67%)	12	NA	NA
AVN38197.1|1597051_1598212_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
AVN38198.1|1598217_1598889_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AVN41463.1|1598776_1599040_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38199.1|1599036_1600518_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AVN38200.1|1600722_1601352_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AVN38201.1|1601352_1601775_+	dehydrogenase	NA	NA	NA	NA	NA
AVN38202.1|1601799_1602627_+	phosphodiesterase	NA	NA	NA	NA	NA
AVN38203.1|1602626_1603208_+	esterase YqiA	NA	NA	NA	NA	NA
AVN38204.1|1603236_1605129_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	4.5e-92
AVN38205.1|1605192_1607334_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVN38206.1|1607707_1608517_+	cobalamin/Fe(3+)-siderophore ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
AVN38207.1|1608513_1609497_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
>prophage 114
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1617340	1622380	5022408		Stx_converting_phage(50.0%)	4	NA	NA
AVN38216.1|1617340_1617733_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
AVN38217.1|1617785_1618268_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVN38218.1|1618376_1619984_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN38219.1|1620121_1622380_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	3.1e-84
>prophage 115
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1629838	1637157	5022408		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
AVN38227.1|1629838_1631311_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	4.5e-47
AVN38228.1|1631633_1632383_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AVN38229.1|1632634_1634854_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AVN38230.1|1634895_1635153_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38231.1|1635203_1636130_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVN38232.1|1636329_1637157_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
>prophage 116
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1643000	1643885	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVN41464.1|1643000_1643885_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 117
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1666060	1667233	5022408		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVN38264.1|1666060_1667233_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 118
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1694662	1695682	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
AVN38282.1|1694662_1695682_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 119
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1700946	1703744	5022408		Pseudomonas_phage(50.0%)	5	NA	NA
AVN38290.1|1700946_1701591_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
AVN38291.1|1701609_1701831_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AVN41467.1|1701893_1702340_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38292.1|1702385_1702871_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
AVN38293.1|1702925_1703744_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 120
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1717210	1773189	5022408	transposase	Stx2-converting_phage(38.89%)	51	NA	NA
AVN38309.1|1717210_1718749_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
AVN38310.1|1719876_1720227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
AVN38311.1|1720223_1720649_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
AVN38312.1|1720676_1720880_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41469.1|1721020_1721158_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38313.1|1721309_1722227_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVN38314.1|1722260_1723136_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AVN38315.1|1723148_1724657_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.3e-06
AVN38316.1|1724660_1725491_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVN38317.1|1725536_1726247_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
AVN38318.1|1726250_1727369_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AVN38319.1|1727418_1728354_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVN38320.1|1728389_1729124_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVN38321.1|1729220_1730210_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
AVN38322.1|1730316_1731589_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.5e-168
AVN38323.1|1731747_1731933_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38324.1|1732089_1734180_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
AVN38325.1|1734963_1735284_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38326.1|1735371_1735563_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38327.1|1735559_1735934_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38328.1|1735937_1736153_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38329.1|1736149_1736422_+	neurotensin receptor R8	NA	NA	NA	NA	NA
AVN38330.1|1739471_1739897_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AVN38331.1|1739893_1740244_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVN38332.1|1740274_1741888_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVN38333.1|1742103_1742559_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38334.1|1743473_1744625_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	3.4e-42
AVN38335.1|1744581_1744950_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38336.1|1745221_1749109_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
AVN38337.1|1749869_1750115_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38338.1|1750052_1752254_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVN38339.1|1752335_1753613_-	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AVN38340.1|1753609_1755352_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AVN38341.1|1755351_1756299_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVN38342.1|1756299_1758087_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
AVN38343.1|1758159_1759353_+	MFS transporter	NA	NA	NA	NA	NA
AVN38344.1|1760070_1760529_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AVN38345.1|1760538_1761099_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVN38346.1|1761140_1761401_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVN38347.1|1761397_1761712_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38348.1|1762989_1763166_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38349.1|1763438_1764564_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
AVN41470.1|1764533_1764749_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
AVN38350.1|1764862_1765150_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38351.1|1765215_1765449_-	pilus assembly protein	NA	NA	NA	NA	NA
AVN38352.1|1767138_1768752_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVN38353.1|1768782_1769133_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVN38354.1|1769129_1769555_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AVN38355.1|1770251_1770482_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38356.1|1770624_1771698_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38357.1|1771923_1773189_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.1	2.1e-77
>prophage 121
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1798955	1800110	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN38387.1|1798955_1800110_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 122
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1808477	1809386	5022408		Yersinia_phage(100.0%)	1	NA	NA
AVN38396.1|1808477_1809386_-	Band 7 protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 123
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1815089	1815767	5022408		Bacillus_virus(100.0%)	1	NA	NA
AVN38404.1|1815089_1815767_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 124
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1829274	1830507	5022408		Catovirus(100.0%)	1	NA	NA
AVN38419.1|1829274_1830507_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 125
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1838643	1843122	5022408		Prochlorococcus_phage(50.0%)	2	NA	NA
AVN38429.1|1838643_1841517_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
AVN38430.1|1841682_1843122_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.2e-31
>prophage 126
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1846921	1862313	5022408	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
AVN38437.1|1846921_1847818_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AVN38438.1|1847842_1848553_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVN38439.1|1848558_1850292_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
AVN38440.1|1850382_1851480_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVN38441.1|1851490_1853008_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AVN38442.1|1853050_1853599_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVN38443.1|1853721_1853847_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38444.1|1853848_1855297_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
AVN38445.1|1855241_1855430_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38446.1|1855732_1857652_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AVN38447.1|1857651_1858140_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVN38448.1|1858175_1859543_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
AVN38449.1|1859578_1860898_-	guanine deaminase	NA	NA	NA	NA	NA
AVN38450.1|1860912_1862313_-	xanthine permease XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 127
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1886591	1887347	5022408		Clostridium_phage(100.0%)	1	NA	NA
AVN38468.1|1886591_1887347_+	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 128
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1891633	1894128	5022408		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVN38472.1|1891633_1892395_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AVN41474.1|1892709_1894128_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 129
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1903759	1910532	5022408		Moraxella_phage(33.33%)	6	NA	NA
AVN38481.1|1903759_1904473_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AVN38482.1|1904541_1905231_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVN38483.1|1905915_1906446_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVN38484.1|1906458_1908705_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AVN38485.1|1908855_1909731_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVN38486.1|1909737_1910532_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 130
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1916009	1927157	5022408		Klosneuvirus(25.0%)	5	NA	NA
AVN38492.1|1916009_1918898_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
AVN38493.1|1918890_1922433_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
AVN38494.1|1922432_1924259_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	3.0e-24
AVN38495.1|1924340_1925672_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVN38496.1|1925903_1927157_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 131
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1931028	1932644	5022408		Tetraselmis_virus(50.0%)	2	NA	NA
AVN38499.1|1931028_1931625_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
AVN38500.1|1931696_1932644_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
>prophage 132
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1943926	1946229	5022408	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
AVN38508.1|1943926_1944673_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVN38509.1|1944687_1946229_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 133
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1950516	1953030	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVN38513.1|1950516_1953030_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
>prophage 134
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1956395	1961416	5022408		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVN38517.1|1956395_1958768_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
AVN38518.1|1958779_1961416_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
>prophage 135
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1970249	1972755	5022408	tRNA	Pandoravirus(50.0%)	3	NA	NA
AVN38526.1|1970249_1971056_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
AVN38527.1|1971106_1971550_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVN38528.1|1971549_1972755_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
>prophage 136
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1984331	1985087	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN38540.1|1984331_1985087_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 137
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1989945	1990794	5022408		Vibrio_phage(100.0%)	1	NA	NA
AVN38544.1|1989945_1990794_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 138
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1998326	2002441	5022408		Hokovirus(50.0%)	2	NA	NA
AVN38552.1|1998326_2001083_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.4e-54
AVN38553.1|2001139_2002441_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 139
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2005837	2013285	5022408		Only_Syngen_Nebraska_virus(25.0%)	6	NA	NA
AVN38556.1|2005837_2007475_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AVN38557.1|2007562_2008861_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AVN38558.1|2008920_2009793_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38559.1|2010086_2010758_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
AVN38560.1|2010842_2011850_-	transcriptional regulator	NA	NA	NA	NA	NA
AVN38561.1|2011875_2013285_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
>prophage 140
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2020586	2021372	5022408		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVN38567.1|2020586_2021372_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 141
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2036023	2038056	5022408		Hokovirus(50.0%)	2	NA	NA
AVN38582.1|2036023_2037451_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
AVN38583.1|2037450_2038056_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 142
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2041166	2044882	5022408		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVN38589.1|2041166_2041928_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AVN38590.1|2041921_2042548_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVN38591.1|2042687_2043827_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVN38592.1|2043889_2044882_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 143
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2049248	2056388	5022408		Escherichia_phage(83.33%)	6	NA	NA
AVN38597.1|2049248_2049887_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
AVN38598.1|2049883_2051146_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AVN38599.1|2051142_2052051_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AVN38600.1|2052246_2053014_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AVN38601.1|2053064_2053721_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AVN38602.1|2053826_2056388_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 144
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2080402	2081368	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
AVN38625.1|2080402_2081368_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.7e-37
>prophage 145
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2087151	2092538	5022408	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AVN38634.1|2087151_2087649_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	49.7	9.8e-31
AVN38635.1|2087728_2088790_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AVN38636.1|2088858_2089359_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVN38637.1|2089487_2092118_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
AVN38638.1|2092352_2092538_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 146
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2107279	2112576	5022408		Bacillus_virus(20.0%)	6	NA	NA
AVN38653.1|2107279_2108482_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AVN38654.1|2108471_2108720_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38655.1|2108837_2109797_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
AVN38656.1|2109806_2111951_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
AVN38657.1|2111923_2112334_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AVN38658.1|2112330_2112576_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 147
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2116510	2120561	5022408		Clostridium_phage(50.0%)	4	NA	NA
AVN38666.1|2116510_2116960_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AVN38667.1|2116960_2117623_-	transcriptional regulator	NA	NA	NA	NA	NA
AVN38668.1|2117643_2119044_-	GABA permease	NA	NA	NA	NA	NA
AVN38669.1|2119280_2120561_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
>prophage 148
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2125104	2213879	5022408	tail,lysis,portal,terminase,tRNA	Enterobacteria_phage(38.1%)	99	NA	NA
AVN38674.1|2125104_2125923_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
AVN38675.1|2125926_2126175_-	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
AVN38676.1|2126470_2127646_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
AVN38677.1|2127606_2127813_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AVN38678.1|2127872_2128088_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AVN38679.1|2128084_2128447_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
AVN38680.1|2128437_2128974_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
AVN38681.1|2129101_2129926_-	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
AVN38682.1|2129991_2130354_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AVN38683.1|2130426_2130621_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AVN38684.1|2130722_2130953_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.2e-12
AVN38685.1|2131022_2131697_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
AVN38686.1|2131787_2131988_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AVN38687.1|2132031_2132583_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AVN38688.1|2132579_2133416_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	1.5e-148
AVN41479.1|2133420_2133645_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
AVN38689.1|2133641_2134460_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
AVN38690.1|2134456_2134951_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	4.3e-87
AVN38691.1|2134950_2135604_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AVN38692.1|2135600_2135927_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AVN38693.1|2135923_2136313_+	hypothetical protein	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AVN38694.1|2136332_2137142_+	DNA-binding protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
AVN38695.1|2137149_2138139_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
AVN38696.1|2138152_2138905_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
AVN38697.1|2139185_2139611_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AVN38698.1|2139834_2140038_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	2.3e-31
AVN38699.1|2140188_2141241_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AVN38700.1|2141307_2141523_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVN38701.1|2141522_2142020_+	lysozyme	NA	A5LH83	Enterobacteria_phage	99.4	4.9e-91
AVN38702.1|2142016_2142484_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	100.0	1.6e-75
AVN38703.1|2142505_2142868_+	DNA-binding protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
AVN38704.1|2143321_2143816_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AVN38705.1|2143815_2145918_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
AVN38706.1|2145914_2146127_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVN38707.1|2146126_2147635_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
AVN38708.1|2147579_2149607_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.8	0.0e+00
AVN38709.1|2149648_2150017_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AVN38710.1|2150009_2150285_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVN38711.1|2150296_2150875_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AVN41481.1|2150871_2151273_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AVN38712.1|2151283_2152027_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
AVN41480.1|2152087_2152474_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AVN38713.1|2152482_2152812_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AVN38714.1|2152783_2155849_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
AVN38715.1|2155848_2156178_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVN38716.1|2156187_2156886_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	8.6e-134
AVN38717.1|2156891_2157635_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
AVN38718.1|2157532_2158180_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
AVN38719.1|2158240_2161738_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
AVN38720.1|2161808_2162408_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
AVN41482.1|2162472_2165565_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	92.4	1.6e-54
AVN38721.1|2165564_2166149_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	96.3	3.0e-103
AVN38722.1|2166218_2166992_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
AVN38723.1|2167398_2168832_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AVN38724.1|2168866_2170075_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AVN38725.1|2170886_2171369_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AVN38726.1|2171500_2171977_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVN38727.1|2171966_2172257_+	RnfH family protein	NA	NA	NA	NA	NA
AVN38728.1|2172318_2172660_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVN38729.1|2172808_2174470_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVN38730.1|2174555_2175434_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVN41483.1|2175365_2175560_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AVN38731.1|2175556_2176150_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVN41484.1|2176203_2177445_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVN41485.1|2177510_2178302_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVN38732.1|2178468_2179830_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVN38733.1|2179966_2180215_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVN38734.1|2180233_2180782_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVN38735.1|2180812_2181580_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVN38736.1|2181621_2181969_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVN38737.1|2182045_2182528_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38738.1|2182543_2183770_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVN38739.1|2183759_2184278_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVN38740.1|2184424_2184790_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38741.1|2184999_2186070_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AVN38742.1|2186080_2187202_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVN38743.1|2187244_2188405_-	prephenate dehydratase	NA	NA	NA	NA	NA
AVN41486.1|2188503_2188551_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38744.1|2188654_2188996_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AVN38745.1|2189030_2189237_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38746.1|2189265_2190003_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVN38747.1|2190137_2191118_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVN38748.1|2191114_2191846_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVN38749.1|2191975_2194549_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AVN38750.1|2200240_2200354_+	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AVN38751.1|2200335_2201634_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
AVN38752.1|2201630_2201954_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38753.1|2201999_2203355_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
AVN38754.1|2203468_2206129_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVN41487.1|2206160_2206859_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVN38755.1|2206927_2207347_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AVN38756.1|2207360_2207564_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38757.1|2207553_2208591_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVN38758.1|2208638_2209328_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AVN38759.1|2209632_2210016_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AVN38760.1|2210071_2210659_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVN41488.1|2210761_2211643_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVN38761.1|2211675_2213010_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AVN38762.1|2213141_2213879_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
>prophage 149
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2218781	2222523	5022408		Tupanvirus(50.0%)	4	NA	NA
AVN38768.1|2218781_2220581_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AVN38769.1|2220596_2221571_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVN38770.1|2221620_2221899_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38771.1|2221842_2222523_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 150
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2225982	2226243	5022408		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVN38778.1|2225982_2226243_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 151
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2230362	2241671	5022408		Bacillus_phage(50.0%)	7	NA	NA
AVN38784.1|2230362_2234250_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
AVN38785.1|2234825_2236253_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
AVN38786.1|2236417_2237131_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVN38787.1|2237120_2238455_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVN38788.1|2238515_2238854_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVN38789.1|2238898_2240089_-	flavohemoprotein	NA	NA	NA	NA	NA
AVN38790.1|2240417_2241671_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 152
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2247429	2248959	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN38794.1|2247429_2248959_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	7.0e-11
>prophage 153
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2259721	2266059	5022408		Faustovirus(20.0%)	8	NA	NA
AVN38804.1|2259721_2260936_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AVN38805.1|2260963_2261350_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AVN38806.1|2261366_2261690_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AVN38807.1|2261785_2262301_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVN38808.1|2262317_2264168_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AVN38809.1|2264169_2264505_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVN38810.1|2264516_2264717_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVN38811.1|2264775_2266059_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 154
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2275944	2276376	5022408		Powai_lake_megavirus(100.0%)	1	NA	NA
AVN38816.1|2275944_2276376_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 155
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2296869	2303340	5022408		Escherichia_phage(66.67%)	8	NA	NA
AVN38828.1|2296869_2298237_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
AVN38829.1|2298398_2299865_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AVN38830.1|2299933_2301511_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVN38831.1|2301603_2302143_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AVN38832.1|2302158_2302677_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AVN38833.1|2302779_2302917_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AVN38834.1|2302978_2303170_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVN38835.1|2303187_2303340_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
>prophage 156
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2309587	2313589	5022408		Prochlorococcus_phage(33.33%)	5	NA	NA
AVN38839.1|2309587_2310226_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AVN38840.1|2310225_2311263_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
AVN38841.1|2311281_2311467_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38842.1|2311587_2312214_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVN38843.1|2312299_2313589_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 157
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2321067	2321781	5022408		Synechococcus_phage(100.0%)	1	NA	NA
AVN38852.1|2321067_2321781_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 158
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2339022	2339973	5022408		Cyanophage(100.0%)	1	NA	NA
AVN38865.1|2339022_2339973_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 159
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2358627	2380355	5022408		Streptococcus_phage(25.0%)	22	NA	NA
AVN38883.1|2358627_2359497_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
AVN38884.1|2359710_2360136_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVN38885.1|2360122_2360572_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVN38886.1|2360632_2361208_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVN38887.1|2361303_2362203_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AVN38888.1|2362380_2363805_-	PTS N-acetylmuramic acid transporter subunits IIBC	NA	NA	NA	NA	NA
AVN38889.1|2363808_2364705_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVN38890.1|2364984_2365776_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
AVN38891.1|2365933_2366950_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN38892.1|2366949_2367783_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AVN38893.1|2367782_2368658_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AVN38894.1|2368647_2369745_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AVN38895.1|2369879_2370791_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
AVN38896.1|2370793_2371162_-	hypothetical protein	NA	NA	NA	NA	NA
AVN38897.1|2371266_2372118_+	pyridoxine kinase	NA	NA	NA	NA	NA
AVN38898.1|2372160_2372670_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVN38899.1|2372710_2374438_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AVN38900.1|2374482_2374740_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVN38901.1|2375123_2376095_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AVN38902.1|2376279_2377041_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVN38903.1|2377270_2378269_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVN38904.1|2378339_2380355_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
>prophage 160
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2405893	2406628	5022408		Clostridioides_phage(100.0%)	1	NA	NA
AVN38928.1|2405893_2406628_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 161
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2410447	2411368	5022408		Morganella_phage(100.0%)	1	NA	NA
AVN38931.1|2410447_2411368_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 162
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2415057	2422634	5022408		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AVN38936.1|2415057_2416752_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
AVN38937.1|2416821_2417766_+	transporter YfdV	NA	NA	NA	NA	NA
AVN38938.1|2417839_2418985_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AVN38939.1|2419040_2422634_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 163
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2430883	2444054	5022408	capsid	Enterobacteria_phage(42.86%)	12	NA	NA
AVN38946.1|2430883_2431111_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	56.1	2.3e-11
AVN38947.1|2431128_2431974_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38948.1|2432788_2433793_+|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	48.3	1.1e-81
AVN38949.1|2433880_2434471_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
AVN38950.1|2434467_2434704_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38951.1|2435572_2435884_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38952.1|2435880_2438568_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
AVN38953.1|2438850_2439123_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
AVN38954.1|2439802_2440684_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38955.1|2440705_2441656_+	hypothetical protein	NA	NA	NA	NA	NA
AVN38956.1|2441635_2442811_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.0	2.8e-145
AVN38957.1|2443121_2444054_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
>prophage 164
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2460187	2461273	5022408		Pandoravirus(100.0%)	1	NA	NA
AVN38975.1|2460187_2461273_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 165
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2469809	2470946	5022408		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVN38984.1|2469809_2470946_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
>prophage 166
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2477604	2479122	5022408		Mollivirus(100.0%)	1	NA	NA
AVN38992.1|2477604_2479122_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 167
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2483333	2484107	5022408		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVN38998.1|2483333_2484107_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 168
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2494777	2498005	5022408		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVN39010.1|2494777_2495428_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
AVN39011.1|2495514_2497347_+	SLC13 family permease	NA	NA	NA	NA	NA
AVN39012.1|2497405_2498005_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 169
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2532971	2537975	5022408		Tupanvirus(50.0%)	4	NA	NA
AVN39044.1|2532971_2534954_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
AVN39045.1|2534953_2535922_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
AVN39046.1|2535925_2537065_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	4.2e-29
AVN39047.1|2537372_2537975_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 170
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2541578	2546221	5022408		Oenococcus_phage(50.0%)	5	NA	NA
AVN41497.1|2541578_2542784_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
AVN39051.1|2542840_2544130_+	MFS transporter	NA	NA	NA	NA	NA
AVN39052.1|2544147_2544951_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AVN39053.1|2544991_2545213_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39054.1|2545225_2546221_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	56.1	1.8e-68
>prophage 171
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2552113	2565931	5022408		Pseudomonas_phage(33.33%)	8	NA	NA
AVN39059.1|2552113_2553190_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AVN39060.1|2553392_2554043_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39061.1|2554096_2554351_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AVN39062.1|2554350_2555481_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	3.3e-175
AVN39063.1|2555569_2557855_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AVN41498.1|2558536_2562295_+	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-21
AVN39064.1|2562434_2563157_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AVN39065.1|2563303_2565931_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 172
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2580854	2585697	5022408		Bacillus_phage(50.0%)	2	NA	NA
AVN39076.1|2580854_2582681_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
AVN39077.1|2582847_2585697_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 173
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2589974	2595770	5022408		Enterobacteria_phage(25.0%)	5	NA	NA
AVN39082.1|2589974_2591096_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
AVN39083.1|2591207_2592263_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVN39084.1|2592336_2593401_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
AVN39085.1|2593400_2594051_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
AVN39086.1|2594126_2595770_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
>prophage 174
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2604532	2605156	5022408		Bacillus_virus(100.0%)	1	NA	NA
AVN39097.1|2604532_2605156_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.6e-12
>prophage 175
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2615214	2622864	5022408		Vibrio_phage(50.0%)	7	NA	NA
AVN39109.1|2615214_2616222_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
AVN39110.1|2616360_2616645_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVN39111.1|2616769_2618530_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
AVN39112.1|2618679_2619375_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVN39113.1|2619402_2620593_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
AVN39114.1|2620926_2621271_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39115.1|2621274_2622864_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
>prophage 176
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2628618	2632919	5022408		Clostridioides_phage(50.0%)	4	NA	NA
AVN39120.1|2628618_2629185_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AVN39121.1|2629596_2630310_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39122.1|2630348_2631335_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39123.1|2631452_2632919_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 177
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2646307	2647165	5022408		Catovirus(100.0%)	1	NA	NA
AVN39136.1|2646307_2647165_-	endonuclease	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 178
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2651233	2655019	5022408	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AVN39141.1|2651233_2653225_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	9.7e-13
AVN39142.1|2653256_2654093_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AVN39143.1|2654020_2654197_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39144.1|2654253_2654367_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AVN39145.1|2654350_2655019_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 179
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2658713	2660234	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVN39150.1|2658713_2660234_+	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 180
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2680594	2690039	5022408		Enterobacteria_phage(85.71%)	10	NA	NA
AVN39169.1|2680594_2681521_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
AVN39170.1|2681525_2682257_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVN39171.1|2682237_2682345_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39172.1|2682404_2683136_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AVN39173.1|2683357_2685043_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVN39174.1|2685039_2685759_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVN39175.1|2685805_2686276_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVN39176.1|2686316_2686778_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVN39177.1|2686902_2688906_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AVN39178.1|2688902_2690039_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 181
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2705845	2707879	5022408	tRNA	Indivirus(100.0%)	1	NA	NA
AVN39184.1|2705845_2707879_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 182
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2718528	2722085	5022408		Paenibacillus_phage(50.0%)	4	NA	NA
AVN39196.1|2718528_2719347_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
AVN39197.1|2719398_2720145_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVN39198.1|2720118_2721084_-	sugar kinase	NA	NA	NA	NA	NA
AVN39199.1|2721080_2722085_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 183
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2731223	2737497	5022408		Bacillus_phage(50.0%)	6	NA	NA
AVN39209.1|2731223_2732123_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
AVN39210.1|2732537_2732855_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39211.1|2733354_2734716_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
AVN39212.1|2734862_2735195_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVN39213.1|2735374_2736097_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVN39214.1|2736093_2737497_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 184
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2750604	2751957	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVN39222.1|2750604_2751957_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 185
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2756680	2768815	5022408		Enterobacteria_phage(50.0%)	9	NA	NA
AVN39225.1|2756680_2757322_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AVN39226.1|2757413_2757995_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AVN39227.1|2758016_2759870_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVN39228.1|2760321_2761905_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AVN39229.1|2764081_2764975_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AVN41502.1|2765347_2766433_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AVN39230.1|2766432_2767332_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AVN39231.1|2767389_2768268_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AVN39232.1|2768272_2768815_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 186
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2776096	2778916	5022408		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVN39240.1|2776096_2777503_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
AVN39241.1|2777749_2778916_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
>prophage 187
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2786358	2787258	5022408		Cellulophaga_phage(100.0%)	1	NA	NA
AVN39249.1|2786358_2787258_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 188
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2791911	2825720	5022408	transposase	Escherichia_phage(18.18%)	39	NA	NA
AVN39255.1|2791911_2792421_+|transposase	IS200/IS605-like element IS200C family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.8e-11
AVN39256.1|2792531_2793959_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AVN39257.1|2794167_2795334_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
AVN39258.1|2795452_2795926_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AVN39259.1|2796123_2797182_+	FUSC family protein	NA	NA	NA	NA	NA
AVN39260.1|2797353_2797683_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41506.1|2797783_2797966_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
AVN41508.1|2798580_2798772_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39261.1|2798771_2799146_-	toxin	NA	NA	NA	NA	NA
AVN39262.1|2799234_2799603_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AVN39263.1|2799618_2800263_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
AVN39264.1|2800281_2800503_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AVN41507.1|2800565_2801012_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39265.1|2801057_2801531_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AVN39266.1|2801624_2801870_-	antirestriction protein	NA	NA	NA	NA	NA
AVN39267.1|2801869_2802688_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AVN39268.1|2802908_2803319_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39269.1|2803767_2804514_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVN39270.1|2804528_2806070_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVN39271.1|2806184_2806598_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39272.1|2806733_2807804_-	phospholipase	NA	NA	NA	NA	NA
AVN39273.1|2807800_2808706_-	chemotaxis protein	NA	NA	NA	NA	NA
AVN39274.1|2808702_2811087_-	dGTPase	NA	NA	NA	NA	NA
AVN39275.1|2811304_2811739_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39276.1|2812167_2814333_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVN39277.1|2814343_2815333_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN39278.1|2815351_2816410_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVN39279.1|2816406_2817174_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AVN39280.1|2817227_2817485_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41509.1|2818015_2819161_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39281.1|2819570_2819831_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41510.1|2819757_2820135_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39282.1|2820360_2820540_-|transposase	transposase	transposase	NA	NA	NA	NA
AVN39283.1|2820685_2821708_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AVN39284.1|2821704_2822400_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AVN39285.1|2822736_2822952_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39286.1|2823425_2824043_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39287.1|2824121_2824475_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVN39288.1|2824523_2825720_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 189
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2840437	2842290	5022408		Mycobacterium_phage(50.0%)	2	NA	NA
AVN41512.1|2840437_2841661_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
AVN39303.1|2841645_2842290_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
>prophage 190
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2869216	2912921	5022408	transposase	Bacillus_phage(41.67%)	29	NA	NA
AVN39327.1|2869216_2878708_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AVN39328.1|2878795_2884903_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AVN39329.1|2885093_2886053_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVN39330.1|2886219_2888022_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
AVN39331.1|2888008_2889811_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AVN39332.1|2889803_2891084_+	MFS transporter	NA	NA	NA	NA	NA
AVN39333.1|2891111_2892416_+	salicylate synthase	NA	NA	NA	NA	NA
AVN39334.1|2892609_2893872_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AVN41514.1|2894209_2895007_-	protein MtfA	NA	NA	NA	NA	NA
AVN39335.1|2895494_2895824_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39336.1|2895859_2896510_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AVN39337.1|2896770_2898118_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
AVN39338.1|2898202_2898838_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVN39339.1|2898838_2899843_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AVN39340.1|2899951_2900365_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVN41515.1|2900497_2901169_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AVN39341.1|2901168_2902527_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AVN39342.1|2902634_2903486_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AVN39343.1|2904078_2905194_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
AVN39344.1|2905463_2905667_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39345.1|2905759_2906125_+	permease	NA	NA	NA	NA	NA
AVN39346.1|2906164_2906860_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
AVN39347.1|2906926_2908345_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
AVN39348.1|2908325_2908796_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AVN39349.1|2908784_2909705_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVN39350.1|2909877_2910795_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVN39351.1|2910873_2911056_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVN41516.1|2911117_2911306_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39352.1|2911226_2912921_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 191
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2928902	3044416	5022408	tail,head,transposase,capsid,portal,terminase,integrase,holin,tRNA,plate	Pectobacterium_phage(19.23%)	135	2950026:2950085	2994530:2994654
AVN41517.1|2928902_2929427_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
AVN39375.1|2929660_2930146_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	70.2	5.6e-47
AVN39376.1|2930207_2930633_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AVN39377.1|2930629_2930980_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVN39378.1|2931010_2932624_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVN39379.1|2932806_2933040_-	SirA-like protein	NA	NA	NA	NA	NA
AVN39380.1|2933036_2934242_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVN39381.1|2934428_2934842_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39382.1|2934875_2936363_-	alpha-amylase	NA	NA	NA	NA	NA
AVN39383.1|2936440_2936806_-	flagellar protein FliT	NA	NA	NA	NA	NA
AVN39384.1|2936805_2937216_-	flagella export chaperone FliS	NA	NA	NA	NA	NA
AVN39385.1|2937231_2938647_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AVN39386.1|2938894_2939944_+	flagellin FliC	NA	NA	NA	NA	NA
AVN39387.1|2940107_2940827_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AVN39388.1|2940872_2941424_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AVN39389.1|2941511_2942312_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AVN39390.1|2942416_2943403_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AVN39391.1|2943417_2944086_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVN39392.1|2944082_2944835_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
AVN39393.1|2945064_2945787_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AVN39394.1|2945854_2946079_-	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AVN39395.1|2946537_2947194_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVN39396.1|2947190_2949023_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AVN39397.1|2949079_2949628_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2950026:2950085	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
AVN39398.1|2950211_2951228_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
AVN39399.1|2951196_2951460_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AVN39400.1|2951395_2951620_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AVN39401.1|2951669_2951852_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39402.1|2951851_2952421_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AVN39403.1|2952417_2954634_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AVN39404.1|2954664_2954985_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39405.1|2955995_2956409_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AVN39406.1|2956507_2956738_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AVN39407.1|2956796_2957273_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AVN39408.1|2957312_2957537_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AVN39409.1|2957533_2958289_+	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AVN39410.1|2958278_2959694_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AVN39411.1|2959732_2960143_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39412.1|2960144_2960381_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39413.1|2960377_2960689_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AVN39414.1|2960685_2960910_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39415.1|2961097_2961319_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41518.1|2961590_2962379_+	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AVN39416.1|2962553_2963477_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39417.1|2964665_2965364_+	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AVN39418.1|2965826_2966432_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39419.1|2966441_2966930_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AVN39420.1|2967328_2967562_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39421.1|2967805_2968447_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39422.1|2968600_2969821_-|transposase	ISL3 family transposase ISEc53	transposase	NA	NA	NA	NA
AVN39423.1|2969839_2970358_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AVN39424.1|2970491_2970671_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39425.1|2970748_2971345_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AVN39426.1|2971341_2971635_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AVN39427.1|2971634_2972306_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AVN39428.1|2972418_2972802_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39429.1|2972801_2973074_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AVN39430.1|2973073_2973553_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AVN39431.1|2973560_2973755_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41519.1|2973814_2974060_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39432.1|2974428_2974995_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AVN39433.1|2974981_2976844_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AVN39434.1|2976843_2977077_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39435.1|2977073_2978648_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AVN39436.1|2978647_2979955_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AVN39437.1|2979954_2980284_+|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AVN39438.1|2980342_2981377_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AVN39439.1|2981411_2981831_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVN39440.1|2981827_2982208_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39441.1|2982239_2982920_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39442.1|2982916_2983453_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39443.1|2983433_2984336_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AVN39444.1|2984338_2984680_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AVN39445.1|2984676_2985597_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AVN39446.1|2985599_2986226_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AVN39447.1|2986218_2987403_+	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AVN39448.1|2987402_2987792_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AVN39449.1|2987788_2989291_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AVN39450.1|2989308_2989821_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVN39451.1|2989833_2990115_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVN39452.1|2990223_2991864_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AVN41520.1|2991899_2992289_+	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AVN39453.1|2992450_2992675_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVN39454.1|2993889_2994309_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AVN39455.1|2994780_2995446_+	YecA family protein	NA	NA	NA	NA	NA
2994530:2994654	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
AVN39456.1|2995496_2996708_-	tyrosine transporter	NA	NA	NA	NA	NA
AVN39457.1|2996898_2997138_+	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AVN39458.1|2997175_2997673_-	non-heme ferritin	NA	NA	NA	NA	NA
AVN39459.1|2997844_2998168_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39460.1|2998374_2998521_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39461.1|2998632_2998884_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AVN39462.1|2998961_2999465_-	non-heme ferritin	NA	NA	NA	NA	NA
AVN39463.1|2999934_3000174_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39464.1|3000259_3001249_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN39465.1|3001318_3002833_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AVN39466.1|3002847_3003834_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AVN39467.1|3004000_3004801_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AVN39468.1|3004775_3006200_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AVN39469.1|3006206_3006635_-	universal stress protein UspC	NA	NA	NA	NA	NA
AVN39470.1|3007414_3007765_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AVN39471.1|3007767_3008346_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AVN39472.1|3008472_3009360_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AVN39473.1|3009356_3010283_+	motility protein MotB	NA	NA	NA	NA	NA
AVN39474.1|3010287_3012252_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AVN39475.1|3012272_3012776_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVN39476.1|3012920_3014582_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AVN39477.1|3014872_3015733_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVN39478.1|3015735_3016785_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVN39479.1|3016799_3017189_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AVN39480.1|3017199_3017844_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AVN39481.1|3018032_3019181_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AVN39482.1|3019173_3021252_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AVN39483.1|3021251_3021644_+	flagellar protein FlhE	NA	NA	NA	NA	NA
AVN39484.1|3021696_3023430_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AVN41521.1|3023645_3024212_+	VOC family protein	NA	NA	NA	NA	NA
AVN39485.1|3024225_3024972_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVN39486.1|3025359_3026460_+	cytochrome C	NA	NA	NA	NA	NA
AVN39487.1|3026484_3028914_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AVN39488.1|3028949_3029921_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVN39489.1|3029917_3030661_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AVN39490.1|3030701_3031097_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39491.1|3031149_3031968_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AVN39492.1|3031964_3032531_-	hydrolase	NA	NA	NA	NA	NA
AVN39493.1|3032840_3034613_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVN39494.1|3034605_3035058_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVN39495.1|3035086_3035827_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVN39496.1|3035861_3036383_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AVN39497.1|3036384_3036987_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41522.1|3037057_3037123_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39498.1|3037261_3037873_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVN39499.1|3037881_3038892_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVN39500.1|3040529_3041315_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVN39501.1|3041311_3042067_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVN41523.1|3042145_3043078_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN39502.1|3043093_3044416_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 192
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3048414	3049890	5022408		Cyanophage(100.0%)	1	NA	NA
AVN39506.1|3048414_3049890_+	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 193
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3057946	3062415	5022408		Klebsiella_phage(33.33%)	7	NA	NA
AVN39514.1|3057946_3058609_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AVN39515.1|3058632_3059289_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVN39516.1|3059390_3059621_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVN39517.1|3059759_3060134_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVN39518.1|3060137_3061010_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39519.1|3061022_3061364_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVN39520.1|3061758_3062415_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
>prophage 194
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3069910	3071959	5022408	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AVN39526.1|3069910_3071959_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 195
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3077291	3077501	5022408		Morganella_phage(100.0%)	1	NA	NA
AVN39534.1|3077291_3077501_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 196
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3083142	3084699	5022408		Moraxella_phage(100.0%)	1	NA	NA
AVN39542.1|3083142_3084699_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 197
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3088561	3089923	5022408		Pandoravirus(100.0%)	1	NA	NA
AVN39546.1|3088561_3089923_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.7e-40
>prophage 198
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3094971	3096657	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN39552.1|3094971_3096657_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 199
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3105624	3110201	5022408		Bacillus_phage(100.0%)	3	NA	NA
AVN39567.1|3105624_3107115_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
AVN39568.1|3107295_3108771_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVN39569.1|3108917_3110201_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 200
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3113519	3114374	5022408		Indivirus(100.0%)	1	NA	NA
AVN39572.1|3113519_3114374_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 201
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3123187	3127273	5022408		Staphylococcus_phage(50.0%)	4	NA	NA
AVN39582.1|3123187_3124168_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
AVN39583.1|3124304_3125063_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVN39584.1|3125180_3126539_+	MFS transporter	NA	NA	NA	NA	NA
AVN39585.1|3126631_3127273_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 202
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3132990	3134946	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN39593.1|3132990_3134946_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 203
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3139336	3139990	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN39599.1|3139336_3139990_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 204
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3146753	3147974	5022408		Klosneuvirus(100.0%)	1	NA	NA
AVN39607.1|3146753_3147974_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 205
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3155450	3156278	5022408		Bacillus_virus(100.0%)	1	NA	NA
AVN39615.1|3155450_3156278_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.5e-73
>prophage 206
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3162403	3164665	5022408		Tupanvirus(100.0%)	1	NA	NA
AVN39623.1|3162403_3164665_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	5.1e-143
>prophage 207
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3174813	3194354	5022408	tRNA	Tupanvirus(22.22%)	20	NA	NA
AVN39633.1|3174813_3176742_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
AVN39634.1|3176745_3177288_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVN39635.1|3177384_3177582_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVN39636.1|3177634_3177991_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVN41529.1|3178113_3178158_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVN39637.1|3178441_3179425_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVN39638.1|3179439_3181827_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVN39639.1|3181831_3182131_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVN39640.1|3182231_3183212_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVN39641.1|3183274_3183826_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVN39642.1|3183825_3184575_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AVN39643.1|3184652_3185117_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AVN39644.1|3185364_3186078_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVN39645.1|3186140_3187577_+	YdiU family protein	NA	NA	NA	NA	NA
AVN39646.1|3187580_3187772_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVN39647.1|3187903_3188950_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AVN39648.1|3189106_3189940_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVN39649.1|3190051_3190219_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39650.1|3190272_3192651_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
AVN41530.1|3192707_3194354_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
>prophage 208
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3212827	3217911	5022408		Lake_Baikal_phage(33.33%)	5	NA	NA
AVN39668.1|3212827_3213196_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
AVN39669.1|3213204_3214692_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVN39670.1|3214701_3215448_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
AVN39671.1|3215422_3216694_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVN39672.1|3216690_3217911_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	4.4e-93
>prophage 209
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3226199	3228466	5022408		Escherichia_phage(50.0%)	3	NA	NA
AVN41531.1|3226199_3226868_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
AVN39681.1|3226864_3227650_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVN39682.1|3227653_3228466_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 210
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3234748	3243552	5022408		Orpheovirus(20.0%)	10	NA	NA
AVN39687.1|3234748_3235390_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AVN39688.1|3235429_3236578_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AVN39689.1|3236868_3238080_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVN39690.1|3238192_3239125_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVN39691.1|3239121_3240147_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
AVN39692.1|3240134_3240359_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39693.1|3240445_3240535_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVN39694.1|3240700_3241870_+	MFS transporter	NA	NA	NA	NA	NA
AVN39695.1|3242015_3242597_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	3.1e-44
AVN39696.1|3242724_3243552_-	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 211
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3247967	3249466	5022408		Indivirus(50.0%)	2	NA	NA
AVN39704.1|3247967_3248864_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
AVN41532.1|3248944_3249466_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 212
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3256377	3257652	5022408	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVN39712.1|3256377_3257652_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 213
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3277734	3279546	5022408		Vaccinia_virus(100.0%)	1	NA	NA
AVN39733.1|3277734_3279546_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 214
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3289441	3290743	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN39738.1|3289441_3290743_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 215
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3308506	3323090	5022408		Escherichia_phage(37.5%)	15	NA	NA
AVN39759.1|3308506_3309121_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AVN39760.1|3309163_3310018_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVN39761.1|3310019_3310637_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVN39762.1|3312277_3314704_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AVN39763.1|3314902_3315208_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVN39764.1|3315315_3316026_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVN39765.1|3316028_3316589_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AVN39766.1|3316623_3316965_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39767.1|3317099_3317426_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVN39768.1|3317462_3317651_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39769.1|3317631_3318846_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
AVN39770.1|3318857_3319877_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.3	3.7e-16
AVN39771.1|3319934_3321302_+	MFS transporter	NA	NA	NA	NA	NA
AVN39772.1|3321390_3322851_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.3e-43
AVN39773.1|3322886_3323090_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 216
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3327476	3328367	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN39778.1|3327476_3328367_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 217
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3331369	3331753	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN39783.1|3331369_3331753_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 218
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3338967	3339915	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN41537.1|3338967_3339915_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 219
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3366956	3369380	5022408		Klosneuvirus(100.0%)	1	NA	NA
AVN39813.1|3366956_3369380_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.6e-09
>prophage 220
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3372784	3374542	5022408		Tupanvirus(50.0%)	2	NA	NA
AVN39817.1|3372784_3373795_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
AVN39818.1|3374257_3374542_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 221
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3385787	3387332	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN39825.1|3385787_3387332_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 222
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3396295	3398398	5022408		Salmonella_phage(100.0%)	1	NA	NA
AVN39836.1|3396295_3398398_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 223
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3403895	3404909	5022408		Mycoplasma_phage(100.0%)	1	NA	NA
AVN39845.1|3403895_3404909_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
>prophage 224
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3408538	3410500	5022408	protease	Phage_TP(100.0%)	1	NA	NA
AVN39849.1|3408538_3410500_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	3.5e-23
>prophage 225
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3422350	3423299	5022408		Moraxella_phage(50.0%)	2	NA	NA
AVN39863.1|3422350_3422524_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AVN41542.1|3422768_3423299_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 226
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3427252	3431155	5022408		Klosneuvirus(100.0%)	1	NA	NA
AVN39867.1|3427252_3431155_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 227
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3446043	3447033	5022408		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVN39875.1|3446043_3447033_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 228
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3451992	3461411	5022408	integrase,tRNA	Escherichia_phage(33.33%)	11	3449705:3449719	3460572:3460586
3449705:3449719	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AVN39879.1|3451992_3453126_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
AVN39880.1|3453266_3453701_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AVN41543.1|3453852_3454158_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39881.1|3454123_3454390_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39882.1|3454778_3454958_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41544.1|3455723_3455975_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	100.0	1.9e-38
AVN39883.1|3456026_3456962_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
AVN39884.1|3457089_3458463_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
AVN39885.1|3458492_3458666_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39886.1|3458940_3459924_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVN39887.1|3460178_3461411_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3460572:3460586	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 229
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3466183	3466699	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN39893.1|3466183_3466699_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 230
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3483923	3485006	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN39910.1|3483923_3485006_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-22
>prophage 231
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3504347	3506365	5022408		Bacillus_virus(50.0%)	2	NA	NA
AVN39931.1|3504347_3505154_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AVN39932.1|3505201_3506365_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	27.2	5.6e-29
>prophage 232
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3515299	3517234	5022408		Lactococcus_phage(100.0%)	1	NA	NA
AVN39938.1|3515299_3517234_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 233
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3525046	3525637	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN39948.1|3525046_3525637_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 234
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3530547	3603526	5022408	integrase,tail,lysis,protease,head,transposase,capsid,portal,terminase,holin	Enterobacteria_phage(25.42%)	88	3562697:3562711	3604490:3604504
AVN39953.1|3530547_3533145_-	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
AVN39954.1|3533267_3533480_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39955.1|3533524_3533776_+	hypothetical protein	NA	NA	NA	NA	NA
AVN39956.1|3533811_3534861_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AVN39957.1|3535080_3535839_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AVN39958.1|3535835_3536426_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AVN39959.1|3536482_3536791_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41546.1|3536800_3537787_-	hypothetical protein	NA	NA	NA	NA	NA
AVN39960.1|3537992_3538868_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AVN39961.1|3539080_3540976_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AVN39962.1|3541003_3541624_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AVN39963.1|3541620_3542502_-	phosphatase	NA	NA	NA	NA	NA
AVN41547.1|3542639_3542684_+	trp operon leader peptide	NA	NA	NA	NA	NA
AVN39964.1|3542775_3544338_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AVN39965.1|3544337_3545933_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AVN39966.1|3545936_3547295_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AVN39967.1|3547306_3548500_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AVN39968.1|3548499_3549306_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AVN39969.1|3549681_3549957_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AVN39970.1|3549953_3550511_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AVN39971.1|3550922_3551192_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AVN41549.1|3551290_3551917_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVN39972.1|3551861_3551999_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVN41548.1|3552115_3552298_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AVN39973.1|3552525_3553311_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.8	1.3e-109
AVN39974.1|3553312_3553846_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AVN39975.1|3553876_3554404_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AVN39976.1|3554419_3557326_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
AVN39977.1|3557787_3558534_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVN39978.1|3558548_3560090_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVN39979.1|3560730_3564204_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
3562697:3562711	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
AVN39980.1|3564546_3565227_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AVN39981.1|3565124_3565868_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AVN39982.1|3565878_3566577_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AVN39983.1|3566576_3566918_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AVN39984.1|3566910_3570153_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AVN39985.1|3570200_3570482_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AVN39986.1|3570505_3570880_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AVN39987.1|3570894_3571611_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AVN39988.1|3571677_3572022_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AVN39989.1|3572018_3572465_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AVN39990.1|3572461_3572812_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AVN39991.1|3572821_3573148_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AVN39992.1|3573144_3575730_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AVN39993.1|3575675_3575897_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AVN39994.1|3575941_3577879_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AVN39995.1|3577942_3579604_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AVN39996.1|3579600_3580164_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AVN39997.1|3580454_3580820_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AVN39998.1|3580861_3581062_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AVN41550.1|3581099_3581264_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AVN39999.1|3581260_3581476_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40000.1|3581472_3581967_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AVN41551.1|3581968_3582055_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40001.1|3582319_3582532_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AVN40002.1|3582609_3583143_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AVN40003.1|3583248_3583521_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40004.1|3583486_3583831_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AVN40005.1|3583835_3584051_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AVN40006.1|3584201_3586055_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AVN40007.1|3586315_3586651_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AVN40008.1|3586931_3587063_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AVN41552.1|3587098_3587425_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40009.1|3587864_3588914_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AVN40010.1|3589065_3589263_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AVN40011.1|3589489_3590311_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AVN40012.1|3590307_3590688_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AVN40013.1|3590688_3591744_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AVN40014.1|3591745_3592018_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AVN41553.1|3591964_3592144_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40015.1|3592185_3592398_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AVN40016.1|3592578_3593244_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40017.1|3593418_3593844_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AVN40018.1|3593859_3594630_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AVN40019.1|3594651_3595398_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AVN40020.1|3595404_3596367_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AVN40021.1|3596389_3596815_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVN40022.1|3596811_3597027_-	transcriptional regulator	NA	NA	NA	NA	NA
AVN40023.1|3597076_3597793_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AVN41554.1|3598065_3598221_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AVN40024.1|3598180_3598351_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40025.1|3598380_3598599_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40026.1|3598647_3598842_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40027.1|3599164_3599353_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVN40028.1|3599349_3599541_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVN40029.1|3599633_3602105_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
AVN40030.1|3602169_3602418_+	excisionase	NA	NA	NA	NA	NA
AVN40031.1|3602395_3603526_+|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3604490:3604504	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 235
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3611457	3613472	5022408		Bacillus_virus(50.0%)	2	NA	NA
AVN40041.1|3611457_3612462_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AVN40042.1|3612458_3613472_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 236
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3623038	3629401	5022408		Citrobacter_phage(33.33%)	7	NA	NA
AVN40047.1|3623038_3623656_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.7e-53
AVN40048.1|3624259_3624673_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVN40049.1|3624817_3625726_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AVN40050.1|3625927_3626941_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVN40051.1|3627032_3627938_-	patatin family protein	NA	NA	NA	NA	NA
AVN40052.1|3628050_3628509_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40053.1|3628558_3629401_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
>prophage 237
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3638054	3639593	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN40063.1|3638054_3639593_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 238
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3650715	3656993	5022408		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
AVN40072.1|3650715_3650955_-	cation transport regulator	NA	A5IZT6	Spodoptera_litura_granulovirus	39.0	2.6e-05
AVN40073.1|3651224_3652325_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVN41557.1|3652729_3652837_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AVN40074.1|3652985_3653840_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AVN40075.1|3653875_3654685_-	protein sirB1	NA	NA	NA	NA	NA
AVN40076.1|3654688_3655081_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40077.1|3655077_3655911_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AVN40078.1|3655910_3656993_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 239
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3660129	3667920	5022408	tRNA,transposase	Tupanvirus(25.0%)	8	NA	NA
AVN40081.1|3660129_3661077_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AVN40082.1|3661201_3662881_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
AVN40083.1|3662935_3663214_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40084.1|3663491_3664076_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVN40085.1|3664192_3665284_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVN40086.1|3665498_3666674_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.4	1.7e-73
AVN40087.1|3666784_3667069_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVN40088.1|3667065_3667920_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	56.2	1.6e-81
>prophage 240
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3678106	3685305	5022408	integrase,transposase	Stx2-converting_phage(33.33%)	11	3664284:3664297	3684347:3684360
3664284:3664297	attL	ACTTTCCATTCTGC	NA	NA	NA	NA
AVN40094.1|3678106_3678304_-	AlpA family phage regulatory protein	NA	A0A1V0E888	Vibrio_phage	43.9	7.3e-06
AVN40095.1|3678526_3679141_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40096.1|3679127_3680057_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
AVN40097.1|3680103_3680556_-	DNA repair protein	NA	NA	NA	NA	NA
AVN40098.1|3680554_3680782_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40099.1|3680796_3681222_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AVN40100.1|3681218_3681569_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVN40101.1|3681599_3683213_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVN41559.1|3683678_3684071_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AVN41560.1|3684425_3684782_-	hypothetical protein	NA	NA	NA	NA	NA
3684347:3684360	attR	ACTTTCCATTCTGC	NA	NA	NA	NA
AVN40102.1|3685035_3685305_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
>prophage 241
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3703921	3704680	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVN40120.1|3703921_3704680_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 242
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3720597	3722285	5022408		Salmonella_phage(50.0%)	2	NA	NA
AVN40135.1|3720597_3721866_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
AVN40136.1|3721865_3722285_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 243
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3730099	3730687	5022408		Escherichia_phage(100.0%)	1	NA	NA
AVN40151.1|3730099_3730687_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	29.6	2.4e-36
>prophage 244
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3736481	3738252	5022408		Enterobacteria_phage(50.0%)	3	NA	NA
AVN40160.1|3736481_3737213_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
AVN40161.1|3737433_3737838_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVN40162.1|3738099_3738252_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
>prophage 245
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3741871	3792564	5022408	integrase,tail,head,capsid,portal,terminase,holin,tRNA	Enterobacteria_phage(53.85%)	66	3736218:3736233	3797863:3797878
3736218:3736233	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
AVN40167.1|3741871_3742699_+	manganese/iron transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
AVN40168.1|3742695_3743553_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVN40169.1|3743549_3744407_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVN40170.1|3744498_3744792_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40171.1|3744804_3745083_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
AVN40172.1|3745079_3747101_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AVN40173.1|3747159_3750642_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AVN40174.1|3750702_3751344_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AVN40175.1|3751241_3751985_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AVN40176.1|3751989_3752688_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AVN40177.1|3752687_3753017_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AVN40178.1|3753013_3755575_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AVN40179.1|3755567_3756002_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVN40180.1|3755983_3756406_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AVN41562.1|3756421_3757162_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AVN40181.1|3757169_3757565_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AVN40182.1|3757561_3758140_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AVN40183.1|3758151_3758505_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AVN40184.1|3758516_3758915_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AVN40185.1|3758956_3759982_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AVN40186.1|3760037_3760370_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AVN40187.1|3760379_3761699_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AVN40188.1|3761679_3763281_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AVN40189.1|3763277_3763484_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVN40190.1|3763480_3765406_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AVN40191.1|3765380_3765926_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AVN40192.1|3766065_3766260_-	DNA-packaging protein	NA	NA	NA	NA	NA
AVN40193.1|3766194_3766515_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40194.1|3766402_3766756_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40195.1|3766878_3767259_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AVN40196.1|3767685_3767979_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AVN40197.1|3768069_3768252_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AVN40198.1|3768468_3768945_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AVN40199.1|3768931_3769249_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AVN40200.1|3769558_3770248_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AVN40201.1|3770244_3770385_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AVN40202.1|3770381_3770744_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AVN40203.1|3770740_3771031_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AVN40204.1|3771023_3771194_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVN40205.1|3771193_3771649_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AVN40206.1|3771645_3771747_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40207.1|3772096_3773140_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVN40208.1|3773176_3777442_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AVN40209.1|3777691_3778393_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AVN40210.1|3778389_3779409_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AVN40211.1|3779405_3779945_-	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AVN40212.1|3780014_3780245_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVN40213.1|3780283_3781039_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVN40214.1|3781634_3781841_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVN40215.1|3781916_3782213_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AVN40216.1|3782218_3783004_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVN40217.1|3783000_3783681_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AVN41563.1|3783677_3783860_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AVN40218.1|3783832_3784024_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AVN40219.1|3784034_3784316_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AVN40220.1|3784414_3784636_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AVN40221.1|3784635_3784962_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AVN40222.1|3784945_3785185_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AVN40223.1|3785324_3785561_+	excisionase	NA	NA	NA	NA	NA
AVN40224.1|3785550_3786693_+|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AVN40225.1|3786806_3788057_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AVN40226.1|3788228_3788882_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AVN40227.1|3788891_3789353_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVN40228.1|3789406_3790513_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVN41564.1|3790548_3791190_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AVN40229.1|3791193_3792564_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
3797863:3797878	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 246
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3797585	3799563	5022408		Mycoplasma_phage(100.0%)	2	NA	NA
AVN40234.1|3797585_3798722_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVN40235.1|3798705_3799563_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	4.3e-10
>prophage 247
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3802838	3806561	5022408		Vibrio_phage(50.0%)	4	NA	NA
AVN40240.1|3802838_3803660_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AVN40241.1|3803675_3804587_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVN40242.1|3804615_3805860_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVN40243.1|3805859_3806561_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 248
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3813847	3814105	5022408		Erwinia_phage(100.0%)	1	NA	NA
AVN40247.1|3813847_3814105_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 249
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3826427	3828070	5022408		Streptococcus_virus(50.0%)	2	NA	NA
AVN40260.1|3826427_3827432_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
AVN40261.1|3827428_3828070_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 250
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3831342	3832524	5022408		Ralstonia_phage(50.0%)	2	NA	NA
AVN40265.1|3831342_3831579_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVN40266.1|3831789_3832524_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 251
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3844880	3845822	5022408		Brevibacillus_phage(100.0%)	1	NA	NA
AVN40278.1|3844880_3845822_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 252
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3861702	3861948	5022408		Salmonella_phage(100.0%)	1	NA	NA
AVN40298.1|3861702_3861948_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 253
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3866609	3867530	5022408		Morganella_phage(100.0%)	1	NA	NA
AVN40305.1|3866609_3867530_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 254
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3876837	3877371	5022408		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AVN40313.1|3876837_3877371_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 255
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3881508	3882342	5022408		Pelagibacter_phage(100.0%)	1	NA	NA
AVN40322.1|3881508_3882342_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 256
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3885733	3887101	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN40326.1|3885733_3887101_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 257
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3893919	3894984	5022408		Cronobacter_phage(100.0%)	1	NA	NA
AVN40331.1|3893919_3894984_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 258
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3909305	3911405	5022408		Enterobacteria_phage(100.0%)	3	NA	NA
AVN40343.1|3909305_3909800_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
AVN40344.1|3909820_3911149_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
AVN40345.1|3911231_3911405_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 259
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3914435	3926852	5022408		Klosneuvirus(20.0%)	13	NA	NA
AVN40350.1|3914435_3915356_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AVN40351.1|3915355_3915661_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVN40352.1|3915915_3916515_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AVN40353.1|3916511_3919058_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	1.5e-71
AVN40354.1|3919057_3920230_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVN40355.1|3920359_3921052_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVN40356.1|3921024_3922053_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVN40357.1|3922135_3924868_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.8e-38
AVN40358.1|3924950_3926024_+	electron transporter YccM	NA	NA	NA	NA	NA
AVN40359.1|3926072_3926246_-	protein GnsA	NA	NA	NA	NA	NA
AVN40360.1|3926235_3926466_-	cold-shock protein	NA	NA	NA	NA	NA
AVN41573.1|3926440_3926629_-	cold-shock protein	NA	NA	NA	NA	NA
AVN40361.1|3926639_3926852_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 260
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3937849	3938509	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVN40372.1|3937849_3938509_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 261
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3942743	3944798	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN40380.1|3942743_3944798_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 262
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3957408	3959316	5022408		Tupanvirus(100.0%)	1	NA	NA
AVN40392.1|3957408_3959316_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 263
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3967283	3978869	5022408	tRNA	Bacillus_virus(33.33%)	10	NA	NA
AVN40400.1|3967283_3968075_+	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
AVN40401.1|3968071_3968839_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
AVN40402.1|3968881_3971494_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
AVN40403.1|3971759_3972962_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVN40404.1|3973130_3974531_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
AVN40405.1|3975133_3976222_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
AVN40406.1|3976237_3976420_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40407.1|3976406_3977597_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVN40408.1|3977646_3978294_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVN41578.1|3978320_3978869_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 264
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3987621	4148765	5022408	tail,lysis,protease,head,transposase,capsid,holin,terminase,integrase,portal,tRNA,plate	Enterobacteria_phage(37.76%)	194	4061941:4061960	4115783:4115802
AVN40413.1|3987621_3988407_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVN40414.1|3988542_3989322_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVN40415.1|3989298_3990192_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40416.1|3990345_3991092_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVN40417.1|3991088_3991271_-	protein YcaR	NA	NA	NA	NA	NA
AVN40418.1|3991322_3992555_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVN40419.1|3992591_3993578_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVN40420.1|3993574_3995323_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AVN40421.1|3995359_3997624_-	ComEC family protein	NA	NA	NA	NA	NA
AVN40422.1|3997829_3998114_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AVN40423.1|3998273_3999947_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVN40424.1|4000057_4000741_-	cytidylate kinase	NA	NA	NA	NA	NA
AVN40425.1|4000913_4001696_-|protease	metalloprotease	protease	NA	NA	NA	NA
AVN40426.1|4001839_4002229_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AVN40427.1|4002200_4002650_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AVN40428.1|4002651_4002858_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40429.1|4002847_4003078_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40430.1|4003074_4003758_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AVN40431.1|4003754_4003970_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40432.1|4003984_4004281_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40433.1|4004290_4004563_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40434.1|4004619_4004841_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40435.1|4004851_4005382_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AVN40436.1|4005409_4005679_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40437.1|4005681_4006848_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AVN40438.1|4006858_4008628_-|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AVN40439.1|4008643_4008961_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40440.1|4008960_4009881_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AVN40441.1|4009891_4010200_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AVN40442.1|4010252_4010441_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AVN40443.1|4010534_4010891_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVN40444.1|4011007_4011772_-	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AVN40445.1|4011962_4012178_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40446.1|4012176_4012581_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40447.1|4012556_4013285_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40448.1|4013415_4013766_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AVN40449.1|4013768_4014509_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AVN40450.1|4014492_4015143_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AVN40451.1|4015139_4015466_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AVN40452.1|4015465_4015777_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AVN40453.1|4015776_4016322_+|terminase	terminase	terminase	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AVN40454.1|4016318_4017914_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AVN40455.1|4017913_4019410_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AVN40456.1|4019390_4020212_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AVN40457.1|4020214_4020673_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AVN40458.1|4020887_4022003_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AVN40459.1|4022017_4022971_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AVN40460.1|4022980_4023319_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AVN40461.1|4023320_4023767_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AVN40462.1|4023766_4024231_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AVN40463.1|4024227_4024482_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40464.1|4024471_4025899_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AVN40465.1|4025898_4026420_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AVN40466.1|4026422_4026704_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40467.1|4026801_4027137_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVN40468.1|4027060_4027219_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVN40469.1|4027294_4030246_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AVN40470.1|4030245_4031130_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AVN40471.1|4031126_4031342_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AVN40472.1|4031329_4032484_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AVN40473.1|4032480_4033077_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AVN40474.1|4033131_4033479_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AVN40475.1|4033469_4034573_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AVN40476.1|4034565_4035144_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AVN40477.1|4035146_4036394_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AVN40478.1|4036404_4036866_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AVN40479.1|4036872_4037487_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AVN40480.1|4037486_4038011_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
AVN40481.1|4038070_4038643_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AVN40482.1|4038898_4040182_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVN40483.1|4040252_4041341_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AVN40484.1|4041539_4042232_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AVN40485.1|4042361_4044122_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AVN40486.1|4044527_4045385_+	formate transporter FocA	NA	NA	NA	NA	NA
AVN40487.1|4045439_4047722_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AVN40488.1|4048041_4048296_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AVN40489.1|4048341_4049505_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.1e-205
AVN40490.1|4049504_4049984_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
AVN41579.1|4049998_4050886_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	88.8	2.1e-124
AVN40491.1|4051129_4052671_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVN40492.1|4052685_4053432_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVN40493.1|4053502_4055032_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	93.5	9.7e-247
AVN40494.1|4055024_4055180_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	98.0	2.0e-22
AVN40495.1|4055176_4055452_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	94.5	1.2e-38
AVN40496.1|4055508_4056027_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVN40497.1|4056039_4057230_-|tail	phage tail protein	tail	Q858V1	Yersinia_virus	99.7	2.8e-225
AVN40498.1|4057418_4057601_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40499.1|4057601_4058093_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40500.1|4058766_4059345_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	65.4	5.2e-68
AVN40501.1|4059344_4061969_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.9	0.0e+00
4061941:4061960	attL	GTGATAACGGTTTTAAATTT	NA	NA	NA	NA
AVN40502.1|4061979_4062510_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.1e-101
AVN40503.1|4062502_4063411_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	4.4e-162
AVN40504.1|4063415_4063763_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	1.5e-57
AVN40505.1|4063759_4064401_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	90.7	1.1e-98
AVN40506.1|4064467_4064920_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
AVN40507.1|4064912_4065380_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AVN40508.1|4065342_4065516_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AVN40509.1|4065487_4065913_-	protein lysB	NA	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
AVN40510.1|4065900_4066326_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	1.0e-57
AVN40511.1|4066340_4066838_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
AVN40512.1|4066837_4067119_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AVN40513.1|4067122_4067326_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AVN40514.1|4067325_4067835_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
AVN40515.1|4067934_4068678_-|terminase	terminase	terminase	Q94MK1	Enterobacteria_phage	98.4	2.6e-120
AVN40516.1|4068681_4069755_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.2	7.4e-201
AVN40517.1|4069813_4070668_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AVN40518.1|4070841_4072614_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AVN40519.1|4072613_4073648_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.2e-200
AVN40520.1|4073978_4074677_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40521.1|4074881_4075613_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	79.8	4.1e-110
AVN40522.1|4075842_4076049_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	2.6e-30
AVN41580.1|4076048_4076501_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	97.3	1.2e-80
AVN40523.1|4076500_4078786_-	replication protein A	NA	Q7Y4B8	Escherichia_virus	97.9	0.0e+00
AVN40524.1|4078775_4079051_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	98.9	3.3e-44
AVN40525.1|4079047_4079272_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AVN40526.1|4079271_4079574_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	94.0	7.2e-45
AVN40527.1|4079573_4079798_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
AVN40528.1|4079861_4080362_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
AVN40529.1|4080358_4080556_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	8.0e-29
AVN40530.1|4080539_4080911_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.0e-64
AVN40531.1|4081004_4081304_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AVN40532.1|4081397_4082393_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AVN40533.1|4082424_4083222_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AVN40534.1|4083318_4084467_-	MFS transporter	NA	NA	NA	NA	NA
AVN40535.1|4084780_4085407_+	hydrolase	NA	NA	NA	NA	NA
AVN40536.1|4085442_4086306_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVN40537.1|4086307_4086925_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AVN40538.1|4086935_4089380_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVN40539.1|4089679_4090672_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AVN41581.1|4090741_4091083_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AVN40540.1|4091187_4091709_+	transcriptional regulator	NA	NA	NA	NA	NA
AVN40541.1|4091713_4092136_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40542.1|4092142_4092334_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40543.1|4092471_4092822_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AVN40544.1|4092832_4093111_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AVN40545.1|4093122_4093365_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AVN40546.1|4093568_4093979_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40547.1|4094002_4094206_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AVN40548.1|4094202_4094469_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AVN40549.1|4094465_4094765_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AVN40550.1|4094815_4095031_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40551.1|4095087_4095318_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AVN40552.1|4095390_4095756_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AVN41582.1|4095900_4098585_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AVN40553.1|4098661_4099621_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AVN40554.1|4099625_4099940_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AVN40555.1|4100023_4100866_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40556.1|4100905_4101403_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AVN40557.1|4102126_4102651_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40558.1|4102665_4103712_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AVN40559.1|4103711_4105463_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AVN40560.1|4105617_4106454_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AVN40561.1|4106477_4107530_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AVN40562.1|4107575_4108376_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
AVN40563.1|4108477_4108972_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AVN40564.1|4108971_4109172_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AVN40565.1|4109174_4109498_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AVN40566.1|4109494_4109887_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AVN40567.1|4109883_4110279_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AVN40568.1|4110417_4112295_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.0	1.0e-298
AVN40569.1|4112318_4112786_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AVN40570.1|4112778_4113414_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AVN40571.1|4113410_4113992_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AVN40572.1|4113988_4114339_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AVN40573.1|4114342_4115239_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AVN40574.1|4115231_4115762_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AVN40575.1|4115764_4117750_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
4115783:4115802	attR	AAATTTAAAACCGTTATCAC	NA	NA	NA	NA
AVN40576.1|4117752_4118286_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AVN40577.1|4118314_4118842_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AVN40578.1|4118843_4119629_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	76.6	1.1e-108
AVN40579.1|4119856_4120456_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AVN40580.1|4120484_4120979_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AVN40581.1|4120985_4123793_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AVN40582.1|4123779_4124016_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AVN40583.1|4123943_4124318_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AVN40584.1|4124373_4124886_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AVN40585.1|4124885_4126070_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AVN40586.1|4126227_4127337_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AVN40587.1|4127377_4127638_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40588.1|4127829_4127970_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AVN40589.1|4128275_4129568_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVN40590.1|4129658_4131002_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVN40591.1|4131012_4131624_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVN40592.1|4131782_4135889_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVN40593.1|4136023_4136518_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVN40594.1|4137061_4138027_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AVN40595.1|4138149_4139916_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AVN40596.1|4139916_4141638_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
AVN40597.1|4141679_4142384_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVN40598.1|4142668_4142887_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVN40599.1|4143571_4145848_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVN40600.1|4145878_4146199_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVN40601.1|4146521_4146746_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVN40602.1|4146818_4148765_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
>prophage 265
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4157981	4159700	5022408		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVN40611.1|4157981_4159700_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 266
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4163287	4166025	5022408		Roseobacter_phage(50.0%)	4	NA	NA
AVN40614.1|4163287_4164118_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AVN40615.1|4164114_4164438_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40616.1|4164563_4165079_+	lipoprotein	NA	NA	NA	NA	NA
AVN40617.1|4165296_4166025_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 267
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4169150	4178290	5022408		Streptococcus_phage(25.0%)	11	NA	NA
AVN40622.1|4169150_4170278_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AVN40623.1|4170318_4170807_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVN40624.1|4170866_4171712_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVN40625.1|4171708_4172653_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVN40626.1|4172662_4173796_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AVN40627.1|4173890_4175003_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVN40628.1|4175352_4175829_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVN40629.1|4175916_4176819_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AVN40630.1|4176879_4177602_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVN40631.1|4177585_4177873_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40632.1|4178032_4178290_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 268
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4186856	4188059	5022408		Stx2-converting_phage(100.0%)	1	NA	NA
AVN41585.1|4186856_4188059_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 269
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4200170	4202042	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN40651.1|4200170_4202042_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 270
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4205257	4212141	5022408		Synechococcus_phage(33.33%)	5	NA	NA
AVN40655.1|4205257_4205920_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	9.7e-26
AVN40656.1|4206050_4206950_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVN40657.1|4206955_4209388_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AVN40658.1|4209533_4210349_+	HAD family hydrolase	NA	NA	NA	NA	NA
AVN40659.1|4210548_4212141_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 271
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4217137	4222363	5022408		Escherichia_phage(33.33%)	7	NA	NA
AVN40666.1|4217137_4217653_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AVN40667.1|4218005_4218893_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVN40668.1|4219192_4219696_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AVN40669.1|4219760_4220054_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40670.1|4220099_4220846_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN40671.1|4220984_4221644_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AVN40672.1|4221640_4222363_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 272
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4228752	4240323	5022408		Synechococcus_phage(16.67%)	11	NA	NA
AVN40677.1|4228752_4229430_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
AVN40678.1|4229503_4229770_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
AVN40679.1|4230034_4230295_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVN40680.1|4230432_4231518_-	dehydrogenase	NA	NA	NA	NA	NA
AVN40681.1|4231657_4232620_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVN40682.1|4232647_4234798_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.8e-41
AVN40683.1|4234796_4235102_+	DUF1768 domain-containing protein	NA	A0A0H3TLU0	Faustovirus	54.4	9.6e-13
AVN40684.1|4235334_4236696_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.6	1.5e-52
AVN41586.1|4236924_4237596_+	transcriptional regulator	NA	NA	NA	NA	NA
AVN40685.1|4237595_4238594_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVN40686.1|4238586_4240323_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 273
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4250921	4251830	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN40700.1|4250921_4251830_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 274
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4258157	4259447	5022408		Klosneuvirus(100.0%)	1	NA	NA
AVN40706.1|4258157_4259447_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 275
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4269709	4276285	5022408		Planktothrix_phage(33.33%)	9	NA	NA
AVN40715.1|4269709_4270768_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
AVN40716.1|4270770_4271460_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVN40717.1|4271459_4272233_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN40718.1|4272254_4272464_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40719.1|4272399_4272549_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AVN40720.1|4272677_4273466_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVN40721.1|4273459_4273606_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40722.1|4273533_4275006_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.9e-13
AVN40723.1|4275268_4276285_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 276
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4280648	4284168	5022408		Klebsiella_phage(33.33%)	4	NA	NA
AVN40728.1|4280648_4281701_-	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
AVN40729.1|4282016_4282397_+	hypothetical protein	NA	NA	NA	NA	NA
AVN40730.1|4282510_4283452_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
AVN40731.1|4283448_4284168_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.9	2.4e-22
>prophage 277
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4320005	4320761	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVN40762.1|4320005_4320761_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.9e-10
>prophage 278
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4324684	4325476	5022408		Kaumoebavirus(100.0%)	1	NA	NA
AVN40767.1|4324684_4325476_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	5.8e-09
>prophage 279
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4328854	4340687	5022408		Hokovirus(40.0%)	10	NA	NA
AVN40772.1|4328854_4330336_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
AVN40773.1|4330377_4331796_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	2.8e-62
AVN40774.1|4331792_4332302_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40775.1|4332402_4332609_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVN40776.1|4332921_4333011_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVN40777.1|4333010_4334684_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVN40778.1|4334706_4336755_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
AVN40779.1|4336763_4337336_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
AVN40780.1|4337328_4340013_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
AVN40781.1|4340009_4340687_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
>prophage 280
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4347342	4348107	5022408		Mycobacterium_phage(100.0%)	1	NA	NA
AVN40787.1|4347342_4348107_+	alpha/beta hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 281
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4352252	4354898	5022408	tRNA	Escherichia_phage(100.0%)	2	NA	NA
AVN40793.1|4352252_4353917_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
AVN40794.1|4354136_4354898_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 282
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4359391	4360150	5022408		Moraxella_phage(100.0%)	1	NA	NA
AVN40799.1|4359391_4360150_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 283
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4363981	4365928	5022408		Vibrio_phage(100.0%)	1	NA	NA
AVN40803.1|4363981_4365928_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 284
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4376748	4377828	5022408		Pseudomonas_phage(100.0%)	1	NA	NA
AVN40811.1|4376748_4377828_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 285
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4385772	4389305	5022408		Planktothrix_phage(50.0%)	3	NA	NA
AVN40819.1|4385772_4386498_+	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
AVN40820.1|4386615_4387551_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVN40821.1|4387634_4389305_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	7.2e-78
>prophage 286
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4393437	4396020	5022408	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVN40827.1|4393437_4396020_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 287
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4403030	4405470	5022408		Synechococcus_phage(50.0%)	2	NA	NA
AVN40836.1|4403030_4404119_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AVN40837.1|4404258_4405470_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 288
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4409887	4410534	5022408		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVN40844.1|4409887_4410271_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AVN40845.1|4410324_4410534_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 289
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4424623	4426738	5022408		Morganella_phage(50.0%)	2	NA	NA
AVN40860.1|4424623_4425052_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
AVN40861.1|4425172_4426738_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 290
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4429843	4431666	5022408		Streptococcus_phage(50.0%)	2	NA	NA
AVN40865.1|4429843_4431064_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
AVN40866.1|4431036_4431666_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 291
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4446734	4452808	5022408		Klosneuvirus(50.0%)	4	NA	NA
AVN40879.1|4446734_4447550_+	iron-enterobactin transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
AVN40880.1|4447546_4448680_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVN40881.1|4448667_4448871_-	hypothetical protein	NA	NA	NA	NA	NA
AVN40882.1|4448926_4452808_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	29.4	1.7e-61
>prophage 292
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4464196	4465741	5022408		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVN40892.1|4464196_4465741_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 293
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4475310	4478454	5022408		Leptospira_phage(100.0%)	1	NA	NA
AVN40903.1|4475310_4478454_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 294
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4481599	4483715	5022408		Bacillus_phage(50.0%)	2	NA	NA
AVN40908.1|4481599_4482283_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AVN40909.1|4482272_4483715_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
>prophage 295
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4492507	4496983	5022408	tail,tRNA	Enterobacteria_phage(33.33%)	5	NA	NA
AVN40915.1|4492507_4492864_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	67.5	1.3e-53
AVN40916.1|4493852_4494719_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVN40917.1|4494720_4494933_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVN40918.1|4495040_4495562_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVN40919.1|4495597_4496983_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 296
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4509218	4510364	5022408		Streptococcus_phage(100.0%)	1	NA	NA
AVN40932.1|4509218_4510364_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 297
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4514071	4515679	5022408		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AVN40935.1|4514071_4515679_-	glyoxylate carboligase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	26.9	4.3e-35
>prophage 298
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4526108	4526795	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN40945.1|4526108_4526795_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 299
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4530051	4530729	5022408		Bacillus_virus(100.0%)	1	NA	NA
AVN40949.1|4530051_4530729_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 300
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4536097	4539339	5022408		Escherichia_phage(66.67%)	3	NA	NA
AVN40955.1|4536097_4538602_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
AVN40956.1|4538659_4539001_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AVN40957.1|4539036_4539339_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 301
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4548901	4557359	5022408		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AVN40968.1|4548901_4549861_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
AVN40969.1|4549857_4550820_-	ferrochelatase	NA	NA	NA	NA	NA
AVN40970.1|4550951_4551596_-	adenylate kinase	NA	NA	NA	NA	NA
AVN40971.1|4551776_4553651_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
AVN40972.1|4553760_4554366_-	recombination protein RecR	NA	NA	NA	NA	NA
AVN40973.1|4554365_4554695_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVN40974.1|4554747_4556679_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
AVN40975.1|4556807_4557359_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 302
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4564197	4567347	5022408		Leptospira_phage(100.0%)	1	NA	NA
AVN40984.1|4564197_4567347_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 303
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4576185	4579732	5022408		Bacillus_phage(100.0%)	2	NA	NA
AVN40995.1|4576185_4577967_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-41
AVN40996.1|4577959_4579732_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 304
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4583055	4583751	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVN41000.1|4583055_4583751_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 305
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4586903	4591950	5022408	protease	Bacillus_phage(25.0%)	4	NA	NA
AVN41004.1|4586903_4587176_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AVN41005.1|4587384_4589739_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AVN41006.1|4589926_4591201_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
AVN41007.1|4591326_4591950_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 306
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4613384	4622227	5022408	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AVN41030.1|4613384_4613855_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVN41031.1|4613943_4615047_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
AVN41032.1|4615050_4615500_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVN41033.1|4615650_4616190_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41034.1|4616488_4617373_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVN41035.1|4617410_4617758_-	HNH endonuclease	NA	NA	NA	NA	NA
AVN41036.1|4617887_4618859_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVN41037.1|4618869_4620717_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVN41038.1|4620744_4621077_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVN41039.1|4621099_4622227_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 307
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4629178	4639276	5022408		Bacillus_phage(60.0%)	7	NA	NA
AVN41045.1|4629178_4630474_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
AVN41046.1|4630531_4631221_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVN41047.1|4631410_4632613_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVN41048.1|4632609_4635753_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
AVN41597.1|4635878_4637063_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVN41049.1|4637331_4638240_-	fructokinase	NA	NA	NA	NA	NA
AVN41598.1|4638364_4639276_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
>prophage 308
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4643565	4644681	5022408		Bacillus_phage(100.0%)	1	NA	NA
AVN41059.1|4643565_4644681_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 309
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4652096	4653254	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVN41071.1|4652096_4653254_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 310
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4660162	4663630	5022408		Planktothrix_phage(50.0%)	4	NA	NA
AVN41077.1|4660162_4660930_-	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
AVN41078.1|4660942_4661905_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVN41079.1|4662210_4662486_+	transcriptional regulator	NA	NA	NA	NA	NA
AVN41080.1|4662520_4663630_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 311
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4666708	4668669	5022408		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
AVN41084.1|4666708_4667722_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	1.4e-44
AVN41085.1|4667718_4668669_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
>prophage 312
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4674079	4678359	5022408		Enterobacteria_phage(50.0%)	2	NA	NA
AVN41090.1|4674079_4675162_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
AVN41091.1|4675284_4678359_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
>prophage 313
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4683318	4685205	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN41095.1|4683318_4685205_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 314
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4692851	4693901	5022408		Tupanvirus(100.0%)	1	NA	NA
AVN41102.1|4692851_4693901_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 315
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4705799	4713367	5022408	holin	Vibrio_phage(33.33%)	7	NA	NA
AVN41114.1|4705799_4707833_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AVN41601.1|4707829_4708045_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41115.1|4707961_4708549_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVN41116.1|4708562_4710035_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVN41117.1|4710048_4711719_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
AVN41118.1|4711760_4711988_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41119.1|4712803_4713367_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
>prophage 316
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4723285	4726605	5022408		Erysipelothrix_phage(50.0%)	4	NA	NA
AVN41129.1|4723285_4724611_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AVN41130.1|4724719_4724956_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVN41131.1|4724967_4725561_+	protein RclC	NA	NA	NA	NA	NA
AVN41132.1|4725720_4726605_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	2.5e-53
>prophage 317
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4732632	4733484	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
AVN41135.1|4732632_4733484_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 318
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4750492	4751812	5022408	integrase	Pseudomonas_phage(50.0%)	2	4745281:4745294	4761738:4761751
4745281:4745294	attL	TAAAAACATCGCTG	NA	NA	NA	NA
AVN41153.1|4750492_4750828_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	44.6	1.5e-06
AVN41154.1|4751035_4751812_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	26.4	1.2e-11
4761738:4761751	attR	CAGCGATGTTTTTA	NA	NA	NA	NA
>prophage 319
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4757041	4764995	5022408		Streptococcus_phage(50.0%)	7	NA	NA
AVN41158.1|4757041_4758679_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
AVN41159.1|4758668_4759916_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41160.1|4760095_4760281_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41161.1|4760258_4760729_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41162.1|4761282_4762536_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
AVN41163.1|4762547_4763651_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVN41164.1|4763939_4764995_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
>prophage 320
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4769671	4770823	5022408		Mycobacterium_phage(100.0%)	1	NA	NA
AVN41170.1|4769671_4770823_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 321
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4781394	4784717	5022408		Clostridioides_phage(50.0%)	4	NA	NA
AVN41181.1|4781394_4782153_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AVN41182.1|4782455_4783196_+	transpeptidase	NA	NA	NA	NA	NA
AVN41183.1|4783166_4783934_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVN41184.1|4784138_4784717_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 322
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4789148	4793350	5022408		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVN41189.1|4789148_4789880_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AVN41190.1|4789944_4790412_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVN41191.1|4790408_4791131_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVN41192.1|4791164_4791920_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVN41193.1|4791991_4793350_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
>prophage 323
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4803528	4804560	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN41199.1|4803528_4804560_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 324
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4817518	4821634	5022408		Saccharomonospora_phage(50.0%)	2	NA	NA
AVN41214.1|4817518_4821001_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
AVN41215.1|4821037_4821634_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 325
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4830462	4831221	5022408		Flavobacterium_phage(100.0%)	1	NA	NA
AVN41224.1|4830462_4831221_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 326
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4842800	4844225	5022408	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVN41235.1|4842800_4844225_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 327
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4848154	4848499	5022408		Lake_Baikal_phage(100.0%)	1	NA	NA
AVN41240.1|4848154_4848499_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 328
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4854410	4855208	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN41245.1|4854410_4855208_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 329
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4865592	4910798	5022408	tRNA,bacteriocin,transposase	Acanthamoeba_polyphaga_mimivirus(14.29%)	47	NA	NA
AVN41252.1|4865592_4868022_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
AVN41253.1|4868095_4868626_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVN41254.1|4868640_4869345_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVN41255.1|4869522_4869978_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVN41256.1|4870014_4870941_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVN41257.1|4870979_4872398_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AVN41258.1|4872394_4872874_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVN41259.1|4873221_4873806_+	fimbrial protein	NA	NA	NA	NA	NA
AVN41260.1|4873902_4874643_+	fimbrial chaperone	NA	NA	NA	NA	NA
AVN41261.1|4874677_4877278_+	outer membrane usher protein	NA	NA	NA	NA	NA
AVN41262.1|4877294_4877867_+	fimbrial protein	NA	NA	NA	NA	NA
AVN41263.1|4877881_4878484_+	fimbrial protein StaE	NA	NA	NA	NA	NA
AVN41264.1|4878510_4879107_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AVN41265.1|4879158_4880412_+	fimbrial protein	NA	NA	NA	NA	NA
AVN41266.1|4880524_4881319_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AVN41267.1|4881330_4882182_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AVN41268.1|4882263_4882461_-|transposase	transposase	transposase	NA	NA	NA	NA
AVN41269.1|4882529_4883450_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AVN41270.1|4883570_4883774_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41271.1|4883723_4884104_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AVN41272.1|4884107_4885337_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVN41273.1|4885400_4885841_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AVN41274.1|4885945_4886716_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AVN41275.1|4886712_4887639_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AVN41276.1|4887747_4888410_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVN41277.1|4888450_4888987_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AVN41278.1|4889192_4891583_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVN41279.1|4891629_4893180_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AVN41280.1|4893345_4893693_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41281.1|4893798_4894665_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AVN41282.1|4894680_4895475_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVN41283.1|4895512_4895875_-	UPF0231 family protein	NA	NA	NA	NA	NA
AVN41284.1|4896049_4898647_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AVN41285.1|4898627_4898744_-	aconitate hydratase	NA	NA	NA	NA	NA
AVN41286.1|4899001_4900765_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AVN41606.1|4900835_4902260_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AVN41287.1|4902467_4904360_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AVN41288.1|4904374_4907038_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AVN41607.1|4907019_4907202_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41289.1|4907198_4907963_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AVN41290.1|4908418_4908709_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVN41291.1|4908709_4908949_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41292.1|4909116_4909407_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVN41293.1|4909460_4909649_-	HNH endonuclease	NA	NA	NA	NA	NA
AVN41294.1|4909815_4910106_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVN41295.1|4910106_4910346_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41296.1|4910513_4910798_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 330
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4915373	4915925	5022408		Sphingobium_phage(100.0%)	1	NA	NA
AVN41300.1|4915373_4915925_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 331
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4920171	4921215	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVN41304.1|4920171_4921215_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 332
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4947184	4948909	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVN41331.1|4947184_4948909_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 333
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4960386	4961085	5022408		Planktothrix_phage(100.0%)	1	NA	NA
AVN41342.1|4960386_4961085_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	5.2e-22
>prophage 334
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4972824	4978247	5022408		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AVN41352.1|4972824_4975176_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	2.3e-37
AVN41353.1|4975340_4978247_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 335
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4986024	4987985	5022408		Microcystis_phage(50.0%)	4	NA	NA
AVN41361.1|4986024_4986873_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
AVN41362.1|4986899_4987184_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVN41363.1|4987186_4987420_-	antitoxin	NA	NA	NA	NA	NA
AVN41364.1|4987505_4987985_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 336
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4995879	5001539	5022408		Vibrio_phage(50.0%)	4	NA	NA
AVN41372.1|4995879_4997394_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
AVN41373.1|4997424_4998567_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVN41374.1|4998695_4999913_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVN41375.1|4999985_5001539_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.0	2.0e-34
>prophage 337
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	5007042	5008191	5022408		Halovirus(100.0%)	1	NA	NA
AVN41381.1|5007042_5008191_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 338
CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	5012999	5015816	5022408	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVN41388.1|5012999_5015816_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 1
CP027537	Escherichia coli strain AR_0081 plasmid unnamed2, complete sequence	100279	8785	51111	100279	integrase,transposase	Escherichia_phage(34.78%)	44	15879:15895	32407:32423
AVN41841.1|8785_10155_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AVN41842.1|10400_11120_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AVN41843.1|11116_11551_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AVN41844.1|11605_13564_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
AVN41845.1|13629_13863_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVN41846.1|13925_14465_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
AVN41847.1|14490_14697_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVN41848.1|14698_14887_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41849.1|15399_15963_-	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
15879:15895	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
AVN41850.1|16010_17372_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AVN41851.1|17423_17654_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41852.1|17914_18337_+	hypothetical protein	NA	NA	NA	NA	NA
AVN41853.1|18489_18756_-	transporter	NA	NA	NA	NA	NA
AVN41854.1|18688_18880_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41855.1|18876_19299_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVN41928.1|19345_19648_-	antirestriction protein	NA	NA	NA	NA	NA
AVN41856.1|21014_21449_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVN41857.1|21462_21684_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41858.1|21684_22368_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AVN41929.1|22752_23655_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVN41859.1|23692_23965_-	hypothetical protein	NA	NA	NA	NA	NA
AVN41860.1|24521_25493_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AVN41861.1|25492_26659_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AVN41862.1|27246_28002_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AVN41863.1|28775_29582_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AVN41864.1|29582_29888_-	toxin CcdB	NA	NA	NA	NA	NA
AVN41865.1|29889_30108_-	antitoxin CcdA	NA	NA	NA	NA	NA
AVN41866.1|30815_31811_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVN41867.1|31814_32747_+	hypothetical protein	NA	NA	NA	NA	NA
32407:32423	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
AVN41868.1|33794_36911_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
AVN41869.1|37032_38304_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
AVN41930.1|38300_39857_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
AVN41870.1|40039_40261_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AVN41871.1|40260_40641_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AVN41872.1|40645_40825_+	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AVN41873.1|40852_41212_+	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AVN41874.1|41498_41816_-	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AVN41875.1|42043_43060_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AVN41876.1|44531_45236_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVN41877.1|45456_46980_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AVN41878.1|47481_47886_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AVN41879.1|47882_48230_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVN41880.1|49309_50332_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AVN41881.1|50328_51111_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
