The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	607044	614184	4933784		Escherichia_phage(83.33%)	6	NA	NA
AVL07635.1|607044_609606_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
AVL07636.1|609711_610368_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
AVL07637.1|610418_611186_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AVL07638.1|611381_612290_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVL07639.1|612286_613549_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVL07640.1|613545_614184_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 2
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	923539	962003	4933784	head,integrase,plate,tail	Burkholderia_virus(41.46%)	55	927096:927110	963037:963051
AVL07925.1|923539_923938_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
AVL07926.1|923909_924362_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
AVL07927.1|924351_924567_-	hypothetical protein	NA	NA	NA	NA	NA
AVL07928.1|924556_924787_-	hypothetical protein	NA	NA	NA	NA	NA
AVL07929.1|924783_925467_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
AVL07930.1|925463_925769_-	hypothetical protein	NA	NA	NA	NA	NA
AVL07931.1|925778_926051_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11714.1|926107_926329_+	hypothetical protein	NA	NA	NA	NA	NA
AVL07932.1|926339_926870_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AVL07933.1|926897_927167_-	hypothetical protein	NA	NA	NA	NA	NA
927096:927110	attL	CGTCGCCTTAAGCGC	NA	NA	NA	NA
AVL07934.1|927169_928336_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
AVL07935.1|928346_930116_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.3	6.2e-229
AVL07936.1|930119_931031_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
AVL07937.1|931041_931350_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
AVL07938.1|931402_931591_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AVL07939.1|931691_932030_+	transcriptional regulator	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
AVL07940.1|932146_932911_-	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
AVL07941.1|933102_933318_-	hypothetical protein	NA	NA	NA	NA	NA
AVL07942.1|933316_933721_+	hypothetical protein	NA	NA	NA	NA	NA
AVL07943.1|933696_934440_-	hypothetical protein	NA	NA	NA	NA	NA
AVL07944.1|934570_934921_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
AVL07945.1|934923_935661_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
AVL11715.1|935689_936301_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
AVL07946.1|936297_936624_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AVL07947.1|936623_936935_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
AVL07948.1|936937_937480_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
AVL07949.1|937476_939000_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
AVL07950.1|938999_940496_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
AVL07951.1|940476_941298_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
AVL07952.1|941300_941759_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AVL07953.1|941973_943089_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	7.2e-98
AVL07954.1|943103_944057_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AVL07955.1|944066_944405_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AVL07956.1|944406_944853_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AVL07957.1|944852_945317_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AVL07958.1|945313_945568_+	hypothetical protein	NA	NA	NA	NA	NA
AVL07959.1|945557_946985_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AVL07960.1|946984_947506_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AVL07961.1|947508_947790_+	hypothetical protein	NA	NA	NA	NA	NA
AVL07962.1|947887_948223_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVL07963.1|948146_948305_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVL07964.1|948380_951593_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
AVL07965.1|951592_952477_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AVL07966.1|952473_952689_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AVL07967.1|952676_953849_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
AVL07968.1|953845_954442_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AVL07969.1|954496_954844_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
AVL07970.1|954834_955938_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
AVL07971.1|955930_956509_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AVL07972.1|956511_958104_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	42.9	1.4e-38
AVL07973.1|958110_958725_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AVL07974.1|958724_959207_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	44.0	1.1e-26
AVL11716.1|959247_959721_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	45.4	2.1e-30
AVL07975.1|959822_960395_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AVL07976.1|961118_962003_+	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
963037:963051	attR	GCGCTTAAGGCGACG	NA	NA	NA	NA
>prophage 3
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	2703029	2765231	4933784	plate,tRNA,transposase,protease	Emiliania_huxleyi_virus(12.5%)	54	NA	NA
AVL09568.1|2703029_2704382_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AVL09569.1|2704411_2706844_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AVL09570.1|2706965_2707451_+	chaperone protein Skp	NA	NA	NA	NA	NA
AVL09571.1|2707454_2708480_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AVL09572.1|2708584_2709040_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AVL09573.1|2709043_2709832_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AVL09574.1|2709831_2710980_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AVL09575.1|2710976_2711573_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AVL09576.1|2711609_2715092_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AVL09577.1|2715104_2716064_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVL09578.1|2716162_2718304_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AVL09579.1|2718360_2718750_+	VOC family protein	NA	NA	NA	NA	NA
AVL09580.1|2718814_2720113_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AVL11782.1|2720161_2720416_-	protein rof	NA	NA	NA	NA	NA
AVL09581.1|2720408_2720609_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09582.1|2720774_2721320_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09583.1|2721316_2721739_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVL09584.1|2721752_2722463_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AVL09585.1|2722469_2722721_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09586.1|2722712_2723693_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
AVL09587.1|2723895_2724720_-	endopeptidase	NA	NA	NA	NA	NA
AVL09588.1|2724773_2726492_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AVL09589.1|2726602_2727310_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AVL09590.1|2727306_2727711_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AVL09591.1|2727828_2728644_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AVL09592.1|2728683_2729337_-	methionine ABC transporter	NA	NA	NA	NA	NA
AVL09593.1|2729329_2730361_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AVL09594.1|2730548_2731124_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AVL09595.1|2736885_2737689_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
AVL09596.1|2737685_2738600_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL09597.1|2738840_2739641_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVL09598.1|2739718_2740489_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL09599.1|2740536_2741895_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVL09600.1|2741966_2742722_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVL09601.1|2742755_2743478_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL09602.1|2743474_2743942_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVL11783.1|2744006_2744738_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AVL09603.1|2744677_2744857_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09604.1|2745273_2746059_+	aminopeptidase	NA	NA	NA	NA	NA
AVL09605.1|2746195_2746675_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09606.1|2746684_2747599_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09607.1|2747642_2748125_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVL09608.1|2748148_2749501_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09609.1|2749511_2752976_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVL09610.1|2753054_2754533_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVL09611.1|2754471_2755215_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AVL09612.1|2755211_2757983_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.8e-81
AVL09613.1|2757991_2758753_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09614.1|2758757_2760089_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVL09615.1|2760091_2760616_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVL09616.1|2760612_2761893_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVL09617.1|2761917_2763000_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVL09618.1|2762963_2764814_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVL09619.1|2764817_2765231_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	2789371	2834708	4933784	plate,portal,protease,head,capsid,tail,holin,integrase,terminase	Shigella_phage(43.86%)	64	2793228:2793275	2833282:2833329
AVL09643.1|2789371_2790427_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
AVL09644.1|2790714_2791818_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVL09645.1|2791829_2793083_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
2793228:2793275	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
AVL11785.1|2793287_2794226_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AVL09646.1|2794327_2794678_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AVL09647.1|2794677_2794983_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
AVL09648.1|2794982_2795345_-	hypothetical protein	NA	U5P092	Shigella_phage	99.2	2.1e-67
AVL09649.1|2795335_2795872_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.3	1.8e-99
AVL09650.1|2796020_2796245_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	1.1e-13
AVL09651.1|2796385_2796631_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09652.1|2796548_2796824_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
AVL09653.1|2796832_2797036_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	66.7	2.6e-14
AVL09654.1|2797377_2798454_-	hypothetical protein	NA	E7C9Q8	Salmonella_phage	59.9	7.6e-121
AVL11786.1|2798624_2799329_-	XRE family transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.9	3.4e-69
AVL09655.1|2799435_2799699_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
AVL09656.1|2799727_2800279_+	hypothetical protein	NA	S5FXP0	Shigella_phage	97.3	6.4e-100
AVL09657.1|2800454_2800634_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AVL09658.1|2800623_2801565_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
AVL09659.1|2801561_2802056_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AVL09660.1|2802055_2802709_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AVL09661.1|2802705_2803032_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
AVL09662.1|2803028_2803418_+	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	7.8e-68
AVL09663.1|2803437_2804235_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.1	3.2e-148
AVL09664.1|2804242_2805232_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.2e-194
AVL09665.1|2805249_2805597_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	8.0e-56
AVL09666.1|2805610_2806702_-	hypothetical protein	NA	Q332C0	Clostridium_botulinum_C_phage	35.4	5.3e-05
AVL09667.1|2806725_2807298_-	hypothetical protein	NA	A0A1L2CVC4	Pectobacterium_phage	40.4	2.3e-07
AVL09668.1|2807294_2808050_-	hypothetical protein	NA	NA	NA	NA	NA
AVL09669.1|2808386_2808713_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
AVL09670.1|2808716_2809193_+	lysozyme	NA	S5FV07	Shigella_phage	98.7	8.3e-88
AVL09671.1|2809176_2809569_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	89.2	6.5e-54
AVL09672.1|2810021_2810372_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
AVL09673.1|2810489_2810993_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AVL09674.1|2810989_2812723_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AVL09675.1|2812734_2812917_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
AVL09676.1|2812916_2814158_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	1.3e-241
AVL09677.1|2814099_2814786_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	9.4e-125
AVL09678.1|2814800_2816006_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
AVL09679.1|2816055_2816256_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
AVL09680.1|2816258_2816582_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
AVL09681.1|2816578_2816989_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
AVL09682.1|2816963_2817470_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	1.1e-90
AVL09683.1|2817466_2818027_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.4	1.2e-104
AVL09684.1|2818035_2818206_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AVL09685.1|2818189_2819686_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.4	7.0e-274
AVL09686.1|2819685_2820042_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
AVL09687.1|2820041_2820311_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AVL09688.1|2820277_2820460_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09689.1|2820452_2822285_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	2.5e-305
AVL09690.1|2822366_2822879_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09691.1|2822969_2824298_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	1.9e-246
AVL09692.1|2824294_2825374_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	2.6e-206
AVL09693.1|2825373_2825922_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	96.2	1.8e-94
AVL09694.1|2826322_2827381_+|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
AVL09695.1|2827371_2827956_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	5.4e-113
AVL09696.1|2827959_2828622_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	87.2	9.5e-66
AVL09697.1|2828642_2829086_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	1.1e-81
AVL09698.1|2829057_2829660_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
AVL09699.1|2829659_2830151_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	58.8	6.9e-45
AVL09700.1|2830180_2830735_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	86.2	3.1e-86
AVL09701.1|2831105_2831810_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AVL09702.1|2832171_2832951_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09703.1|2833057_2833216_+	hypothetical protein	NA	NA	NA	NA	NA
AVL09704.1|2833493_2834708_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.7	8.8e-134
2833282:2833329	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
>prophage 5
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	3729755	3796377	4933784	tRNA,portal,capsid,head,tail,holin,integrase,terminase,transposase	Enterobacteria_phage(47.06%)	67	3726846:3726861	3737116:3737131
3726846:3726861	attL	CTAAAAAACGGGCGGT	NA	NA	NA	NA
AVL10527.1|3729755_3730874_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	4.5e-84
AVL10528.1|3730842_3731112_-	excisionase	NA	NA	NA	NA	NA
AVL10529.1|3733691_3733895_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVL10530.1|3733897_3734080_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVL10531.1|3734974_3735145_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11816.1|3735104_3735260_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVL10532.1|3735318_3735522_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10533.1|3735558_3735978_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AVL10534.1|3736057_3736312_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AVL10535.1|3736308_3736731_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AVL10536.1|3736808_3737597_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
3737116:3737131	attR	CTAAAAAACGGGCGGT	NA	NA	NA	NA
AVL10537.1|3737603_3738350_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	4.9e-111
AVL10538.1|3738321_3739134_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-115
AVL10539.1|3739149_3739572_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	5.9e-61
AVL10540.1|3739778_3740333_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10541.1|3740329_3741262_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10542.1|3741225_3741627_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	82.3	1.1e-19
AVL10543.1|3741687_3741843_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVL10544.1|3741986_3742379_+	hypothetical protein	NA	NA	NA	NA	NA
AVL10545.1|3742674_3742953_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.8e-11
AVL10546.1|3742954_3744004_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
AVL10547.1|3744016_3744388_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	2.1e-38
AVL11817.1|3744380_3744764_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.8	5.9e-60
AVL10548.1|3745494_3745725_+	hypothetical protein	NA	NA	NA	NA	NA
AVL10549.1|3745748_3746492_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVL10550.1|3746671_3747064_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	1.5e-50
AVL11818.1|3747053_3747332_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	1.8e-42
AVL10551.1|3747333_3747879_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	87.3	2.0e-93
AVL10552.1|3748196_3748490_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	87.6	7.2e-42
AVL10553.1|3748714_3749125_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	84.6	5.7e-61
AVL10554.1|3749287_3750449_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.4e-50
AVL10555.1|3751133_3751682_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	7.2e-59
AVL10556.1|3751653_3753570_+|terminase	terminase	terminase	O64317	Escherichia_phage	64.8	8.7e-253
AVL10557.1|3753573_3753783_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	49.2	1.0e-10
AVL11819.1|3753827_3755351_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	1.7e-182
AVL10558.1|3755340_3756957_+	peptidase S49 family protein	NA	A0A0K2FI53	Enterobacteria_phage	53.4	3.4e-101
AVL10559.1|3756997_3757333_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	5.2e-20
AVL10560.1|3757402_3758431_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
AVL10561.1|3758481_3758862_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	61.1	3.6e-09
AVL10562.1|3758875_3759250_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	59.8	3.1e-29
AVL10563.1|3759236_3759827_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	69.4	7.0e-68
AVL10564.1|3759823_3760225_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	83.5	6.6e-62
AVL10565.1|3760235_3760976_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	84.8	2.7e-109
AVL10566.1|3761032_3761422_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	66.7	1.2e-39
AVL10567.1|3761430_3761745_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	74.0	4.0e-38
AVL10568.1|3761728_3764752_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	75.6	0.0e+00
AVL10569.1|3764751_3765081_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	82.4	4.9e-47
AVL10570.1|3765090_3765789_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	85.3	2.5e-117
AVL10571.1|3765793_3766537_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.5	1.2e-141
AVL10572.1|3766434_3767082_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	1.2e-97
AVL10573.1|3767142_3770541_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	98.4	0.0e+00
AVL10574.1|3770602_3771223_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	99.5	5.3e-111
AVL10575.1|3771287_3773801_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	63.4	1.2e-76
AVL10576.1|3773800_3774385_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	97.9	1.4e-105
AVL10577.1|3774500_3774686_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	92.3	3.7e-20
AVL10578.1|3775099_3776785_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVL10579.1|3776781_3777501_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL10580.1|3777547_3778018_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
AVL10581.1|3778058_3778520_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVL10582.1|3778644_3780645_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AVL10583.1|3780641_3781778_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
AVL10584.1|3781770_3784050_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10585.1|3784060_3785149_-	MoxR family ATPase	NA	NA	NA	NA	NA
AVL10586.1|3786388_3786706_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10587.1|3786766_3790399_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AVL10588.1|3790408_3794203_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AVL10589.1|3794343_3796377_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	3819797	3859445	4933784	plate,capsid,portal,head,protease,tail,lysis,integrase,terminase	Escherichia_phage(24.39%)	52	3821539:3821555	3854297:3854313
AVL10613.1|3819797_3820697_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AVL10614.1|3821111_3821429_+	hypothetical protein	NA	NA	NA	NA	NA
AVL10615.1|3821416_3821566_+	hypothetical protein	NA	NA	NA	NA	NA
3821539:3821555	attL	TATCGATGTGGTCAATG	NA	NA	NA	NA
AVL10616.1|3821693_3822701_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	85.2	1.2e-168
AVL10617.1|3822815_3823115_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	82.8	2.8e-41
AVL10618.1|3823234_3823504_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	83.0	9.0e-39
AVL10619.1|3823568_3823988_+	hypothetical protein	NA	NA	NA	NA	NA
AVL10620.1|3823984_3824176_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10621.1|3824442_3824943_+	replication protein B	NA	M1SV55	Escherichia_phage	84.9	5.7e-79
AVL10622.1|3825006_3825231_+	DUF2732 domain-containing protein	NA	Q7Y4C2	Escherichia_virus	66.2	5.2e-16
AVL10623.1|3825230_3825530_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	58.9	6.7e-19
AVL10624.1|3825529_3825805_+	hypothetical protein	NA	M1TAP2	Escherichia_phage	62.6	4.0e-26
AVL10625.1|3825794_3828086_+	replication endonuclease	NA	Q858T4	Yersinia_virus	74.8	0.0e+00
AVL10626.1|3828085_3828550_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	54.9	6.1e-43
AVL11820.1|3828561_3828786_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	4.9e-14
AVL10627.1|3829086_3830715_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
AVL10628.1|3830717_3831830_+	hypothetical protein	NA	NA	NA	NA	NA
AVL10629.1|3831925_3832933_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	3.6e-157
AVL10630.1|3832934_3834704_-	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	84.4	5.1e-300
AVL10631.1|3834870_3835725_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	70.8	1.0e-112
AVL10632.1|3835786_3836854_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.9	8.8e-170
AVL10633.1|3836857_3837613_+|terminase	terminase	terminase	O80305	Escherichia_phage	71.4	2.5e-78
AVL10634.1|3837712_3838219_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	4.9e-62
AVL10635.1|3838218_3838422_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	83.6	3.8e-26
AVL10636.1|3838412_3838634_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.9e-27
AVL10637.1|3838617_3839127_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	87.5	2.8e-81
AVL10638.1|3839123_3839549_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	65.9	1.3e-39
AVL10639.1|3839523_3839682_+|lysis	phage lysis protein	lysis	A0A218M4L1	Erwinia_phage	73.1	5.3e-15
AVL10640.1|3839644_3840112_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.9	2.9e-61
AVL10641.1|3840104_3840551_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.2	5.5e-49
AVL10642.1|3840622_3841552_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10643.1|3841887_3842529_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.2	3.6e-94
AVL10644.1|3842525_3842876_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	8.1e-40
AVL10645.1|3842881_3843790_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	86.4	1.9e-141
AVL10646.1|3843782_3844313_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	90.9	1.1e-93
AVL10647.1|3844323_3846159_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	58.1	5.8e-121
AVL10648.1|3846158_3846737_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.0	4.1e-57
AVL10649.1|3846873_3848067_+|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	82.4	1.3e-185
AVL10650.1|3848079_3848598_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.6	1.0e-78
AVL10651.1|3848651_3848966_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	66.0	1.7e-28
AVL10652.1|3848998_3849121_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	1.3e-13
AVL10653.1|3849110_3851552_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.9	7.1e-308
AVL10654.1|3851565_3852030_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.7	2.1e-59
AVL10655.1|3852026_3853196_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	75.4	1.3e-161
AVL10656.1|3853271_3853493_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	7.6e-28
AVL10657.1|3853720_3853981_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10658.1|3854532_3855894_-|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
3854297:3854313	attR	TATCGATGTGGTCAATG	NA	NA	NA	NA
AVL10659.1|3855996_3856293_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVL10660.1|3856294_3856591_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AVL10661.1|3856799_3857132_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVL10662.1|3857322_3858045_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
AVL10663.1|3858041_3859445_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 7
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	3906127	3913283	4933784		Enterobacteria_phage(42.86%)	8	NA	NA
AVL10696.1|3906127_3907522_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	1.4e-18
AVL10697.1|3907696_3908590_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVL10698.1|3908626_3908890_-	hypothetical protein	NA	NA	NA	NA	NA
AVL10699.1|3908961_3910047_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.7e-102
AVL10700.1|3910046_3910946_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
AVL10701.1|3911003_3911882_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
AVL10702.1|3911886_3912423_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	63.8	2.2e-52
AVL10703.1|3912446_3913283_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	32.0	9.1e-21
>prophage 8
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	4359058	4415291	4933784	portal,capsid,head,tail,lysis,terminase,transposase	Enterobacteria_phage(34.62%)	75	NA	NA
AVL11127.1|4359058_4361485_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AVL11128.1|4361683_4361989_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVL11850.1|4362096_4362807_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVL11129.1|4362809_4363370_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVL11130.1|4363404_4363746_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11131.1|4363880_4364207_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVL11132.1|4364243_4364432_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11133.1|4364412_4365627_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVL11134.1|4365638_4366658_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
AVL11135.1|4366715_4366826_+	transporter	NA	NA	NA	NA	NA
AVL11136.1|4366845_4368141_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.8	2.2e-154
AVL11137.1|4368160_4368412_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVL11138.1|4368484_4370956_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVL11139.1|4371048_4371240_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVL11140.1|4371236_4371425_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVL11141.1|4371911_4372529_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11142.1|4372488_4372644_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AVL11143.1|4372836_4373295_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AVL11144.1|4373321_4373549_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL11145.1|4373532_4374054_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11146.1|4373980_4375000_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	1.8e-55
AVL11147.1|4375040_4375463_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.3e-63
AVL11148.1|4375459_4375816_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AVL11149.1|4376968_4377148_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11150.1|4377122_4377305_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AVL11151.1|4377482_4378796_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL11152.1|4378840_4378963_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AVL11153.1|4379232_4379565_-	protein FlxA	NA	NA	NA	NA	NA
AVL11154.1|4379767_4380073_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11155.1|4380097_4380337_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVL11156.1|4380336_4380624_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVL11157.1|4380695_4380851_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVL11158.1|4381067_4381319_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11159.1|4381385_4381664_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11160.1|4381665_4382715_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AVL11161.1|4382728_4383115_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.5	1.3e-62
AVL11162.1|4383146_4384359_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AVL11163.1|4385163_4385376_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AVL11164.1|4385676_4385892_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVL11165.1|4386645_4386861_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVL11166.1|4386865_4387177_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVL11167.1|4387173_4387707_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVL11168.1|4387703_4388201_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AVL11169.1|4388564_4388777_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVL11170.1|4388787_4388976_+	cold-shock protein	NA	NA	NA	NA	NA
AVL11171.1|4389006_4389279_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11172.1|4389450_4389624_+	protein GnsB	NA	NA	NA	NA	NA
AVL11173.1|4389775_4390186_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVL11174.1|4390243_4390477_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVL11175.1|4390582_4390726_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVL11176.1|4390865_4391411_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AVL11177.1|4391385_4393311_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AVL11178.1|4393307_4393514_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVL11179.1|4393510_4395112_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AVL11180.1|4395092_4396412_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
AVL11181.1|4396421_4396754_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
AVL11182.1|4396809_4397835_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
AVL11183.1|4397876_4398272_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AVL11184.1|4398283_4398637_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AVL11185.1|4398648_4399227_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AVL11186.1|4399223_4399619_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AVL11851.1|4399626_4400367_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
AVL11187.1|4400382_4400805_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
AVL11188.1|4400786_4401221_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVL11189.1|4401213_4403793_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
AVL11190.1|4403789_4404119_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	2.8e-58
AVL11191.1|4404118_4404817_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
AVL11192.1|4404822_4405566_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AVL11193.1|4405463_4406135_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AVL11194.1|4406195_4409675_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.6	0.0e+00
AVL11195.1|4409742_4410342_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
AVL11852.1|4410406_4413478_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
AVL11196.1|4413477_4414053_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AVL11197.1|4414150_4414741_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVL11198.1|4415057_4415291_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 9
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	4623395	4674681	4933784	plate,tail,holin,tRNA,terminase	Escherichia_phage(74.55%)	65	NA	NA
AVL11367.1|4623395_4623941_-|tail	phage tail protein	tail	Q8W612	Enterobacteria_phage	75.8	5.4e-75
AVL11368.1|4623943_4625497_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	77.7	1.2e-223
AVL11369.1|4625493_4626120_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
AVL11370.1|4626103_4627330_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.5	1.7e-225
AVL11371.1|4627370_4628531_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
AVL11372.1|4628680_4629028_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
AVL11373.1|4629310_4630024_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
AVL11374.1|4630023_4631031_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.7	4.0e-180
AVL11375.1|4631030_4631297_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
AVL11376.1|4631293_4631962_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
AVL11377.1|4631965_4634041_-	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.7	2.8e-127
AVL11378.1|4634105_4634723_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	3.6e-83
AVL11379.1|4634719_4635151_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
AVL11380.1|4635174_4636512_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	5.7e-243
AVL11381.1|4636511_4637456_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
AVL11382.1|4637442_4637883_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	97.3	1.6e-80
AVL11383.1|4637879_4638320_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
AVL11384.1|4638319_4638790_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
AVL11385.1|4638847_4639876_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	9.6e-190
AVL11386.1|4639890_4640508_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
AVL11387.1|4640500_4641823_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
AVL11862.1|4641803_4642523_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	98.3	3.6e-135
AVL11388.1|4642581_4644018_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.4	2.3e-266
AVL11389.1|4644035_4645364_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	1.9e-262
AVL11390.1|4645353_4646445_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
AVL11391.1|4646448_4646658_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11392.1|4646635_4647568_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	5.4e-83
AVL11393.1|4647560_4648349_-	transcriptional regulator	NA	A0A2P1CCG3	Lactobacillus_phage	41.9	5.9e-46
AVL11394.1|4648472_4648769_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	9.5e-50
AVL11395.1|4648907_4649099_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11396.1|4649140_4649518_-	peptidase M15	NA	Q9MBZ3	Enterobacteria_phage	97.6	2.3e-64
AVL11397.1|4649520_4649796_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
AVL11398.1|4649785_4650178_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.9	2.6e-55
AVL11399.1|4650176_4650374_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11400.1|4650353_4651097_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVL11401.1|4651326_4651869_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.9	6.0e-74
AVL11402.1|4651865_4652156_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
AVL11403.1|4652155_4652755_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
AVL11404.1|4653221_4653374_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.6	9.6e-14
AVL11405.1|4655373_4656414_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.8	3.8e-61
AVL11406.1|4656446_4656878_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.4	1.6e-61
AVL11407.1|4656893_4657655_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.3	3.8e-119
AVL11408.1|4657688_4658354_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	3.5e-84
AVL11409.1|4658352_4658736_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11410.1|4659346_4659598_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11411.1|4659598_4659895_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11412.1|4659907_4660330_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.7e-68
AVL11413.1|4660352_4660649_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AVL11414.1|4660772_4661249_+	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	52.1	2.2e-11
AVL11415.1|4661511_4661691_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11416.1|4661701_4661854_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
AVL11417.1|4662274_4662496_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	8.1e-38
AVL11863.1|4662495_4662666_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
AVL11418.1|4662740_4663016_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	98.9	2.5e-44
AVL11419.1|4663117_4666189_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.0	0.0e+00
AVL11420.1|4666200_4667253_+	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	63.6	8.5e-117
AVL11421.1|4667316_4667511_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
AVL11422.1|4667503_4667692_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AVL11423.1|4667791_4668007_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVL11424.1|4668008_4669244_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
AVL11425.1|4669295_4670231_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
AVL11426.1|4670359_4671733_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVL11427.1|4671762_4671936_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11428.1|4672210_4673194_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVL11864.1|4673448_4674681_+	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	4867926	4912295	4933784	head,tail,holin,tRNA,terminase	Enterobacteria_phage(46.15%)	56	NA	NA
AVL11619.1|4867926_4869033_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVL11876.1|4869068_4869710_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AVL11620.1|4869713_4871084_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AVL11621.1|4871251_4871923_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVL11622.1|4871922_4873383_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AVL11623.1|4873458_4874580_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AVL11624.1|4874725_4875955_-	peptidase T	NA	NA	NA	NA	NA
AVL11877.1|4876010_4876226_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11625.1|4876204_4877341_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVL11626.1|4877324_4878188_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVL11878.1|4878420_4879134_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	1.3e-79
AVL11627.1|4879172_4879361_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11628.1|4879537_4880119_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	95.9	1.1e-110
AVL11629.1|4880115_4880304_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	98.4	1.3e-28
AVL11630.1|4880500_4880707_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	9.0e-31
AVL11631.1|4880862_4881324_-	XRE family transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	67.2	1.5e-41
AVL11632.1|4881469_4882159_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	89.5	8.6e-118
AVL11633.1|4882292_4882565_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.6e-35
AVL11634.1|4882686_4882914_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11635.1|4883398_4883710_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11879.1|4883709_4884417_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	79.5	2.2e-100
AVL11636.1|4884436_4884613_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	83.9	2.2e-22
AVL11637.1|4884631_4884940_-	XRE family transcriptional regulator	NA	A0A088CD40	Shigella_phage	89.2	3.1e-43
AVL11638.1|4884929_4885259_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	90.8	1.5e-40
AVL11639.1|4885283_4885943_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	70.4	2.4e-77
AVL11640.1|4885939_4886164_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11641.1|4886160_4887087_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	97.1	5.8e-162
AVL11642.1|4887097_4887976_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	96.4	1.2e-140
AVL11643.1|4887972_4889364_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	98.1	1.7e-261
AVL11880.1|4889375_4889618_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
AVL11644.1|4889617_4890001_+	antitermination protein	NA	A0A088CD47	Shigella_phage	77.0	1.2e-52
AVL11645.1|4890181_4891285_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	75.9	1.3e-152
AVL11646.1|4891794_4891992_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AVL11647.1|4892142_4893189_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.4	8.8e-191
AVL11648.1|4893385_4893607_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11649.1|4893869_4894361_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11881.1|4894558_4894984_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	86.5	1.5e-59
AVL11650.1|4894980_4895133_+	DUF3927 domain-containing protein	NA	S4TRP5	Salmonella_phage	63.4	1.6e-05
AVL11651.1|4895220_4895610_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
AVL11652.1|4895599_4895878_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
AVL11653.1|4895879_4896425_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	87.3	5.2e-94
AVL11654.1|4896552_4896768_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11655.1|4897194_4897404_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	60.0	5.4e-15
AVL11656.1|4897527_4897743_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11657.1|4897743_4897968_-	hypothetical protein	NA	NA	NA	NA	NA
AVL11658.1|4897952_4898141_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11659.1|4898377_4898926_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	7.2e-59
AVL11660.1|4900814_4901024_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	49.2	1.0e-10
AVL11661.1|4902578_4904195_+	peptidase S49 family protein	NA	A0A0K2FI53	Enterobacteria_phage	52.8	3.8e-100
AVL11662.1|4904235_4904571_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	4.0e-20
AVL11663.1|4906108_4906483_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	59.8	3.1e-29
AVL11664.1|4906469_4907048_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	88.9	1.1e-89
AVL11665.1|4907044_4907446_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	83.5	6.6e-62
AVL11666.1|4907456_4908197_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	85.7	2.4e-110
AVL11667.1|4908945_4909407_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	47.1	7.2e-20
AVL11668.1|4911965_4912295_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	82.4	4.9e-47
>prophage 11
CP027255	Escherichia coli strain EC11 chromosome, complete genome	4933784	4917805	4926306	4933784		Enterobacteria_phage(44.44%)	11	NA	NA
AVL11669.1|4917805_4918426_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	99.5	5.3e-111
AVL11670.1|4918447_4920814_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	99.5	4.4e-214
AVL11671.1|4921396_4921768_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	96.7	1.2e-62
AVL11672.1|4921799_4922042_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	8.3e-36
AVL11673.1|4922045_4922192_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	89.6	2.7e-21
AVL11674.1|4922199_4922454_+	excisionase	NA	Q859D3	Escherichia_coli_phage	86.9	3.6e-37
AVL11675.1|4922487_4923774_+	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	96.3	4.8e-247
AVL11676.1|4923794_4924496_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
AVL11677.1|4924555_4924663_+	hypothetical protein	NA	NA	NA	NA	NA
AVL11678.1|4924643_4925375_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVL11679.1|4925379_4926306_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
