The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	739244	784488	4972718	terminase,tail,protease,portal,lysis,integrase,coat	Enterobacteria_phage(79.41%)	69	730014:730030	792783:792799
730014:730030	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
AVL56036.1|739244_740297_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
AVL56037.1|740579_741683_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AVL56038.1|741694_742945_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
AVL60066.1|743150_743819_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	4.7e-129
AVL56039.1|744190_744541_-	DNA-binding protein	NA	Q76H29	Enterobacteria_phage	100.0	3.7e-61
AVL56040.1|744752_745037_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
AVL56041.1|745029_745314_-	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
AVL56042.1|745313_745958_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
AVL56043.1|745944_746178_-	hypothetical protein	NA	NA	NA	NA	NA
AVL56044.1|746174_746684_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
AVL56045.1|746680_746851_-	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
AVL56046.1|746861_747155_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
AVL56047.1|747201_747486_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AVL56048.1|747485_748193_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
AVL56049.1|748322_748511_-	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AVL56050.1|748491_748650_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
AVL56051.1|748734_749049_-	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
AVL56052.1|749324_749612_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
AVL56053.1|749645_750290_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
AVL56054.1|750373_750568_-	restriction endonuclease	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
AVL56055.1|750781_751369_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
AVL56056.1|751381_751684_-	regulator	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
AVL56057.1|752047_752251_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AVL56058.1|752289_753369_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
AVL56059.1|753533_754223_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AVL56060.1|754333_754549_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AVL56061.1|754659_754941_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AVL56062.1|755123_755945_+	replication of DNA	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
AVL56063.1|755941_757318_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
AVL56064.1|757314_757584_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
AVL56065.1|757639_758095_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.7e-80
AVL56066.1|758091_758265_+	protein ninD	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
AVL56067.1|758231_758408_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
AVL56068.1|758410_758752_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AVL56069.1|758744_758921_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
AVL56070.1|758913_759525_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
AVL56071.1|759521_759746_+	protein ninY	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
AVL56072.1|759742_759946_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AVL56073.1|759926_760106_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
AVL56074.1|760102_760876_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
AVL56075.1|760988_761222_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
AVL56076.1|761306_761510_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AVL60067.1|761487_761985_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
AVL56077.1|761981_762449_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
AVL56078.1|762483_762708_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
AVL56079.1|762661_763192_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
AVL56080.1|763414_763657_+	DUF2560 domain-containing protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
AVL56081.1|763660_764050_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
AVL56082.1|764049_764454_+	Decoration protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
AVL56083.1|764457_764946_+	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
AVL56084.1|764923_766423_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
AVL56085.1|766422_768600_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
AVL56086.1|768613_769525_+	scaffolding protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
AVL56087.1|769524_770817_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
AVL56088.1|770857_771418_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
AVL56089.1|771401_771902_+	hypothetical protein	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
AVL56090.1|771861_773280_+	hypothetical protein	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
AVL56091.1|773283_773985_+|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	100.0	1.7e-76
AVL56092.1|773984_774440_+	hypothetical protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
AVL56093.1|774442_775132_+	DNA transfer protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
AVL56094.1|775142_776579_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	99.8	1.5e-244
AVL56095.1|776578_778555_+	DNA transfer protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
AVL56096.1|778693_778987_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
AVL56097.1|779007_779256_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
AVL56098.1|779391_781395_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
AVL56099.1|781453_782911_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
AVL56100.1|782900_783833_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AVL56101.1|783829_784192_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AVL56102.1|784308_784488_+	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
792783:792799	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	1377130	1385862	4972718	transposase,protease	Dickeya_phage(14.29%)	9	NA	NA
AVL56641.1|1377130_1378249_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVL56642.1|1378245_1380192_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AVL56643.1|1380172_1380367_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56644.1|1380321_1380543_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVL56645.1|1380866_1381187_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVL56646.1|1381217_1383494_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVL56647.1|1383546_1383729_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56648.1|1383685_1384144_+|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AVL56649.1|1384606_1385862_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	1422579	1534734	4972718	terminase,tail,protease,holin,lysis,portal,integrase,tRNA	Salmonella_phage(41.38%)	113	1438834:1438853	1510622:1510641
AVL56676.1|1422579_1423341_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVL56677.1|1423513_1424197_+	cytidylate kinase	NA	NA	NA	NA	NA
AVL56678.1|1424310_1425984_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVL56679.1|1426139_1426424_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AVL56680.1|1426653_1428918_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
AVL56681.1|1428954_1430703_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
AVL56682.1|1430699_1431677_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVL56683.1|1431720_1432953_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVL56684.1|1433004_1433187_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56685.1|1433183_1433930_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVL56686.1|1434140_1435034_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56687.1|1435013_1435790_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVL56688.1|1435925_1436729_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVL56689.1|1436721_1438044_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVL56690.1|1438024_1438729_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AVL56691.1|1438728_1443195_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1438834:1438853	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AVL56692.1|1443539_1445381_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AVL56693.1|1445640_1446189_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AVL56694.1|1446216_1446864_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVL56695.1|1446925_1448116_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AVL56696.1|1448300_1449392_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AVL56697.1|1449998_1451399_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AVL56698.1|1451599_1452061_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVL56699.1|1452057_1452291_-	hypothetical protein	NA	NA	NA	NA	NA
AVL56700.1|1452377_1453592_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AVL56701.1|1455349_1456552_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVL56702.1|1456746_1458039_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
AVL56703.1|1458083_1458332_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AVL56704.1|1458372_1458612_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AVL56705.1|1458654_1459812_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AVL56706.1|1459774_1462660_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
AVL56707.1|1462786_1463086_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AVL56708.1|1463107_1463266_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AVL56709.1|1463258_1463519_-	hypothetical protein	NA	NA	NA	NA	NA
AVL56710.1|1463568_1463979_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AVL56711.1|1464098_1464338_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AVL56712.1|1464303_1464678_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AVL56713.1|1464762_1465746_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AVL56714.1|1465748_1466498_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AVL56715.1|1466508_1466856_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AVL56716.1|1466852_1467164_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AVL56717.1|1467241_1467532_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56718.1|1467823_1468057_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AVL56719.1|1468168_1468390_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56720.1|1469074_1469281_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AVL56721.1|1469283_1469895_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AVL56722.1|1469891_1470038_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVL56723.1|1470027_1470825_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
AVL56724.1|1470891_1471209_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56725.1|1471382_1471508_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56726.1|1471643_1472093_-	hypothetical protein	NA	NA	NA	NA	NA
AVL56727.1|1472453_1473140_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AVL60098.1|1473415_1473745_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVL56728.1|1473728_1474181_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AVL60099.1|1474198_1474678_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AVL56729.1|1474885_1475419_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AVL56730.1|1475375_1477514_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AVL56731.1|1477510_1477717_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AVL60100.1|1477743_1479261_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AVL60101.1|1479184_1481266_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AVL56732.1|1481356_1481680_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AVL56733.1|1481672_1481972_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AVL56734.1|1481952_1482519_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AVL56735.1|1482515_1482917_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AVL56736.1|1482928_1483678_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AVL56737.1|1483723_1484122_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AVL56738.1|1484118_1484448_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AVL60102.1|1484527_1487515_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AVL56739.1|1487511_1487844_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AVL56740.1|1487942_1488440_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AVL56741.1|1488556_1489090_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVL56742.1|1489179_1489875_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
AVL56743.1|1490519_1491224_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AVL56744.1|1493141_1494647_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	6.9e-120
AVL56745.1|1494685_1494928_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56746.1|1494981_1497420_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
AVL56747.1|1497419_1498001_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.0	1.2e-93
AVL56748.1|1498476_1499445_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
AVL56749.1|1500092_1500719_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AVL56750.1|1500787_1501087_-	hypothetical protein	NA	NA	NA	NA	NA
AVL56751.1|1501071_1501758_-	virulence protein	NA	NA	NA	NA	NA
AVL56752.1|1502028_1502220_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AVL56753.1|1502646_1505259_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AVL56754.1|1505466_1506477_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AVL56755.1|1506642_1507185_+	cell division protein ZapC	NA	NA	NA	NA	NA
AVL56756.1|1507181_1508291_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVL56757.1|1508389_1510498_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVL56758.1|1510510_1512418_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1510622:1510641	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AVL56759.1|1512432_1513686_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVL56760.1|1513690_1515331_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AVL56761.1|1515327_1515891_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56762.1|1516146_1516314_+	ribosome modulation factor	NA	NA	NA	NA	NA
AVL56763.1|1516413_1516932_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVL56764.1|1517000_1518761_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVL56765.1|1518946_1519399_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AVL56766.1|1519470_1520523_-	outer membrane protein A	NA	NA	NA	NA	NA
AVL56767.1|1520879_1521389_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVL56768.1|1521605_1522211_+	DNA transformation protein	NA	NA	NA	NA	NA
AVL56769.1|1522197_1524351_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVL56770.1|1524369_1524816_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AVL56771.1|1524939_1526994_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AVL56772.1|1527029_1527488_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AVL56773.1|1527582_1528245_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AVL56774.1|1528415_1528832_+	CoA-binding protein	NA	NA	NA	NA	NA
AVL56775.1|1528876_1529194_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVL56776.1|1529251_1530463_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVL56777.1|1530677_1531226_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVL56778.1|1531251_1532031_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVL56779.1|1532079_1532361_+	acylphosphatase	NA	NA	NA	NA	NA
AVL56780.1|1532357_1532687_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVL56781.1|1532773_1533433_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AVL56782.1|1533498_1533708_+	hypothetical protein	NA	NA	NA	NA	NA
AVL56783.1|1534053_1534734_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2276132	2326293	4972718	tRNA,integrase,tail,protease	Moraxella_phage(14.29%)	59	2316709:2316731	2326424:2326446
AVL57517.1|2276132_2276828_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVL57518.1|2276885_2278796_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AVL57519.1|2278926_2279271_+	RidA family protein	NA	NA	NA	NA	NA
AVL57520.1|2279276_2279456_-	YoaH family protein	NA	NA	NA	NA	NA
AVL57521.1|2279536_2280901_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
AVL57522.1|2280904_2281483_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AVL57523.1|2281746_2283111_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVL57524.1|2283248_2284850_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVL57525.1|2284871_2286431_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AVL57526.1|2286418_2286754_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57527.1|2286903_2287872_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVL57528.1|2287924_2288725_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AVL57529.1|2288737_2289589_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AVL57530.1|2289646_2290105_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AVL60133.1|2290460_2291081_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AVL57531.1|2291077_2291887_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AVL57532.1|2291952_2293698_-	cell division protein FtsI	NA	NA	NA	NA	NA
AVL57533.1|2293917_2294127_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AVL57534.1|2294139_2294283_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AVL57535.1|2294931_2295219_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57536.1|2295289_2295433_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AVL57537.1|2295590_2295830_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57538.1|2296041_2296833_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AVL57539.1|2297008_2298382_+	MFS transporter	NA	NA	NA	NA	NA
AVL57540.1|2298429_2299311_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVL57541.1|2299504_2301553_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVL57542.1|2301572_2302259_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVL57543.1|2302356_2302941_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVL57544.1|2302982_2304266_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVL57545.1|2304228_2306868_+	MCE family protein	NA	NA	NA	NA	NA
AVL60134.1|2306945_2308385_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVL57546.1|2308499_2308739_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVL57547.1|2308849_2309041_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVL57548.1|2309059_2309710_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AVL57549.1|2309933_2310098_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57550.1|2310382_2311105_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVL57551.1|2311788_2312184_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
AVL57552.1|2312513_2312990_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57553.1|2313377_2313797_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVL57554.1|2313925_2314120_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57555.1|2314166_2314436_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AVL57556.1|2314601_2314742_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57557.1|2316205_2316574_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
AVL57558.1|2316511_2316769_-	hypothetical protein	NA	NA	NA	NA	NA
2316709:2316731	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
AVL60135.1|2317059_2317260_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57559.1|2317877_2318792_+	protein PagO	NA	NA	NA	NA	NA
AVL57560.1|2318924_2319083_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57561.1|2319092_2319707_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVL57562.1|2320459_2320726_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57563.1|2320854_2320980_-	arsenic transporter	NA	NA	NA	NA	NA
AVL57564.1|2321242_2321359_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVL57565.1|2321549_2321750_+	phage virulence factor	NA	NA	NA	NA	NA
AVL57566.1|2321846_2322728_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
AVL57567.1|2323200_2323389_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57568.1|2323453_2323621_+	lytic enzyme	NA	NA	NA	NA	NA
AVL57569.1|2323877_2324411_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AVL57570.1|2324464_2324695_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVL60137.1|2324884_2325379_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
AVL60136.1|2325438_2326293_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
2326424:2326446	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
>prophage 5
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2331735	2375324	4972718	terminase,tail,lysis,integrase,head,transposase	Edwardsiella_phage(20.0%)	67	2331226:2331240	2373164:2373178
2331226:2331240	attL	GCATTAATGCCAACT	NA	NA	NA	NA
AVL57575.1|2331735_2332311_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
AVL57576.1|2332310_2333762_-	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	71.2	2.9e-43
AVL57577.1|2333751_2334354_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AVL57578.1|2334355_2335597_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
AVL57579.1|2335593_2335950_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AVL57580.1|2335962_2336640_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
AVL57581.1|2336620_2337490_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AVL57582.1|2337486_2337789_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AVL57583.1|2337788_2338499_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
AVL57584.1|2338495_2340667_-	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AVL57585.1|2340650_2340833_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVL57586.1|2340874_2341279_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AVL57587.1|2341278_2341725_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AVL57588.1|2341725_2343210_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
AVL57589.1|2343190_2343736_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57590.1|2343720_2344086_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
AVL57591.1|2344082_2344667_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AVL57592.1|2344660_2345116_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
AVL57593.1|2345122_2345470_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
AVL57594.1|2345473_2346502_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AVL57595.1|2346501_2346984_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
AVL57596.1|2346985_2348332_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
AVL57597.1|2348328_2349018_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AVL57598.1|2349058_2350579_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
AVL57599.1|2350578_2352000_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
AVL57600.1|2351965_2352718_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
AVL57601.1|2352788_2352971_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60138.1|2353196_2353637_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
AVL57602.1|2353657_2354146_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
AVL60139.1|2354123_2354426_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVL57603.1|2354592_2355051_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AVL57604.1|2355007_2355190_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57605.1|2355864_2356071_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57606.1|2356187_2356415_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57607.1|2356548_2357478_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57608.1|2357464_2357995_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57609.1|2358026_2358368_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
AVL57610.1|2358707_2359019_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
AVL57611.1|2359015_2359210_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AVL57612.1|2359206_2359806_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
AVL57613.1|2359869_2360118_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57614.1|2360367_2360520_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVL57615.1|2360726_2360999_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57616.1|2360995_2361391_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
AVL57617.1|2361403_2361865_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AVL57618.1|2361857_2362865_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
AVL57619.1|2362908_2363403_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57620.1|2363389_2363644_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AVL57621.1|2363742_2364141_+	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AVL57622.1|2364438_2364627_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57623.1|2364571_2364751_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57624.1|2365011_2365287_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57625.1|2365290_2365497_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AVL57626.1|2365572_2365908_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57627.1|2366048_2368739_+	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
AVL57628.1|2368731_2369562_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
AVL57629.1|2369597_2369918_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
AVL57630.1|2369910_2370243_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
AVL57631.1|2370853_2371033_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
AVL60140.1|2371323_2371560_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57632.1|2371620_2371899_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AVL57633.1|2371873_2372953_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
AVL60141.1|2373158_2373278_-	hypothetical protein	NA	NA	NA	NA	NA
2373164:2373178	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
AVL57634.1|2373335_2373689_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVL57635.1|2373705_2374581_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57636.1|2374581_2374956_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVL57637.1|2375093_2375324_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2450774	2529434	4972718	terminase,tail,protease,portal,holin,integrase,head,transposase,capsid,plate	Salmonella_phage(79.41%)	106	2457312:2457327	2531057:2531072
AVL57713.1|2450774_2451233_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AVL57714.1|2451413_2452619_-	lysine-N-methylase	NA	NA	NA	NA	NA
AVL57715.1|2452697_2454185_-	flagellin FliC	NA	NA	NA	NA	NA
AVL57716.1|2454441_2455845_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
AVL57717.1|2455859_2456267_+	flagellar protein FliS	NA	NA	NA	NA	NA
AVL57718.1|2456266_2456635_+	flagellar protein FliT	NA	NA	NA	NA	NA
AVL57719.1|2456706_2458191_+	alpha-amylase	NA	NA	NA	NA	NA
2457312:2457327	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
AVL57720.1|2458230_2458656_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57721.1|2458781_2460047_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVL57722.1|2460043_2460277_+	SirA-like protein	NA	NA	NA	NA	NA
AVL57723.1|2460541_2460928_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57724.1|2461047_2461362_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AVL57725.1|2461578_2463261_+	flagellar M-ring protein	NA	NA	NA	NA	NA
AVL57726.1|2463253_2464249_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AVL57727.1|2464241_2464949_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AVL57728.1|2464948_2466319_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
AVL57729.1|2466340_2466784_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AVL57730.1|2466780_2467998_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AVL57731.1|2468102_2468570_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AVL57732.1|2468574_2469579_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AVL57733.1|2469575_2469989_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AVL57734.1|2469988_2470366_+	flagellar protein FliO	NA	NA	NA	NA	NA
AVL57735.1|2470365_2471103_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AVL57736.1|2471112_2471382_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AVL57737.1|2471390_2472185_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AVL57738.1|2472466_2473090_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVL57739.1|2473128_2473377_-	DsrB protein	NA	NA	NA	NA	NA
AVL60145.1|2473451_2473679_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AVL57740.1|2473988_2474804_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AVL57741.1|2474782_2476495_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
AVL57742.1|2476659_2476905_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVL57743.1|2476921_2477839_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVL57744.1|2478008_2478929_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVL57745.1|2478917_2479388_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AVL57746.1|2479368_2480799_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVL57747.1|2480872_2481568_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AVL57748.1|2481659_2481959_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57749.1|2482608_2483805_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AVL60146.1|2484065_2484254_-	cold-shock protein	NA	NA	NA	NA	NA
AVL57750.1|2484264_2484477_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVL57751.1|2484931_2486200_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AVL57752.1|2486202_2486622_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVL57753.1|2486748_2486910_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57754.1|2486887_2487130_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57755.1|2488103_2488316_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
AVL57756.1|2488312_2488726_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
AVL57757.1|2488961_2489195_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
AVL57758.1|2489308_2489914_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
AVL57759.1|2489883_2491446_-|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
AVL57760.1|2491432_2492020_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AVL57761.1|2492022_2493102_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
AVL57762.1|2493094_2493508_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
AVL57763.1|2493512_2494046_-|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
AVL57764.1|2494045_2495104_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
AVL57765.1|2495100_2496441_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.8	2.0e-251
AVL57766.1|2496474_2498403_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
AVL57767.1|2498487_2498814_-|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
AVL57768.1|2498810_2499167_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AVL57769.1|2499166_2500663_-|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
AVL57770.1|2500652_2500817_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
AVL57771.1|2500820_2501381_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
AVL57772.1|2501377_2501890_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
AVL57773.1|2501861_2502266_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
AVL57774.1|2502262_2502586_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AVL57775.1|2502588_2502789_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
AVL57776.1|2502839_2504045_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
AVL57777.1|2504059_2504746_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	6.5e-126
AVL57778.1|2504687_2505929_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
AVL57779.1|2505928_2506111_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AVL57780.1|2506122_2507856_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
AVL57781.1|2507852_2508356_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.0e-88
AVL57782.1|2508472_2508823_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
AVL60147.1|2508873_2509206_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
AVL57783.1|2509505_2509850_-	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	80.0	3.0e-39
AVL57784.1|2510057_2510672_-	endolysin	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
AVL57785.1|2510671_2510953_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
AVL57786.1|2510939_2511326_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
AVL60148.1|2511471_2511729_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
AVL57787.1|2511879_2512632_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
AVL60149.1|2512645_2513635_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
AVL57788.1|2513642_2514548_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.1e-162
AVL57789.1|2514519_2514909_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
AVL57790.1|2514905_2515799_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
AVL57791.1|2515798_2516323_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	2.4e-96
AVL57792.1|2516282_2517101_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
AVL57793.1|2517097_2517322_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AVL57794.1|2517318_2518476_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
AVL57795.1|2518472_2519027_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AVL57796.1|2519055_2519280_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AVL57797.1|2519218_2519404_-	amino acid permease	NA	NA	NA	NA	NA
AVL57798.1|2519377_2520073_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
AVL57799.1|2520278_2520617_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
AVL57800.1|2520579_2520996_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	6.4e-76
AVL57801.1|2521060_2521246_-	hypothetical protein	NA	NA	NA	NA	NA
AVL57802.1|2521343_2521715_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
AVL57803.1|2521772_2522600_+	DUF2303 domain-containing protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
AVL57804.1|2522736_2523276_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AVL57805.1|2523346_2523880_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
AVL57806.1|2523881_2524139_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
AVL57807.1|2524149_2524731_+	molecular chaperone DnaJ	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
AVL57808.1|2524734_2525304_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AVL57809.1|2525328_2525571_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AVL57810.1|2525572_2526562_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AVL57811.1|2526853_2527651_+	protein MtfA	NA	NA	NA	NA	NA
AVL57812.1|2528022_2528313_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AVL57813.1|2528960_2529434_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2531057:2531072	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2616139	2626645	4972718		Enterobacteria_phage(37.5%)	10	NA	NA
AVL57899.1|2616139_2617453_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AVL57900.1|2617479_2618559_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AVL57901.1|2618563_2619337_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVL57902.1|2619333_2620326_-	protein RfbI	NA	NA	NA	NA	NA
AVL57903.1|2620331_2620883_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AVL57904.1|2620883_2621762_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AVL57905.1|2621809_2622709_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AVL57906.1|2622708_2623794_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AVL57907.1|2624170_2625064_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVL57908.1|2625241_2626645_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2694953	2704124	4972718	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVL57962.1|2694953_2696987_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AVL57963.1|2697227_2697686_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVL57964.1|2697857_2698388_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57965.1|2698444_2698912_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVL57966.1|2698958_2699678_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL57967.1|2699674_2701360_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AVL57968.1|2701582_2702314_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVL57969.1|2702373_2702481_+	hypothetical protein	NA	NA	NA	NA	NA
AVL57970.1|2702461_2703193_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL57971.1|2703176_2704124_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	2776007	2788298	4972718	holin,tail	Salmonella_phage(45.45%)	11	NA	NA
AVL58039.1|2776007_2776511_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AVL58040.1|2776538_2776829_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AVL58041.1|2777176_2779006_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AVL58042.1|2779059_2779503_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AVL58043.1|2779880_2780408_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AVL58044.1|2780410_2781652_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AVL58045.1|2782244_2782574_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AVL58046.1|2782870_2784202_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AVL58047.1|2784230_2784599_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AVL60157.1|2784613_2785603_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AVL58048.1|2785931_2788298_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 10
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	3044119	3110362	4972718	terminase,tail,protease,holin,transposase,tRNA,capsid	Salmonella_phage(85.19%)	74	NA	NA
AVL58289.1|3044119_3046138_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
AVL58290.1|3046153_3047017_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AVL58291.1|3047147_3047861_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
AVL58292.1|3048035_3049070_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AVL58293.1|3049086_3049965_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AVL58294.1|3050044_3050683_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AVL58295.1|3050682_3051153_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AVL58296.1|3051199_3051553_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	1.3e-13
AVL58297.1|3051712_3052171_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AVL58298.1|3052127_3052343_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58299.1|3052450_3053518_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVL58300.1|3053725_3055189_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AVL58301.1|3055228_3055588_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AVL58302.1|3055614_3056340_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AVL58303.1|3056410_3057700_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.0e-63
AVL58304.1|3057787_3058414_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVL60165.1|3058827_3059865_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AVL58305.1|3059864_3060503_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	44.0	1.5e-31
AVL58306.1|3060691_3062758_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AVL58307.1|3062762_3064304_+	exopolyphosphatase	NA	NA	NA	NA	NA
AVL58308.1|3064339_3066553_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVL58309.1|3066649_3066787_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58310.1|3066965_3067157_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
AVL58311.1|3067235_3067472_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58312.1|3067521_3067713_+	hypothetical protein	NA	NA	NA	NA	NA
AVL58313.1|3067697_3068027_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVL58314.1|3068684_3069167_-	DUF2514 domain-containing protein	NA	T1SAQ9	Salmonella_phage	100.0	3.2e-79
AVL58315.1|3069163_3069793_-	endolysin	NA	T1SBJ3	Salmonella_phage	100.0	1.4e-119
AVL58316.1|3069782_3070091_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
AVL58317.1|3070077_3070482_-	hypothetical protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
AVL60166.1|3070639_3070915_+	GtrA family protein	NA	T1S9I9	Salmonella_phage	100.0	1.8e-47
AVL58318.1|3070982_3072905_+	acyltransferase	NA	M1F3D2	Salmonella_phage	99.8	0.0e+00
AVL60167.1|3075447_3075708_+	hypothetical protein	NA	T1SA06	Salmonella_phage	100.0	7.6e-43
AVL58319.1|3075908_3078383_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	100.0	0.0e+00
AVL58320.1|3078387_3080190_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	100.0	0.0e+00
AVL58321.1|3080186_3083000_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	100.0	0.0e+00
AVL58322.1|3083012_3083555_-	hypothetical protein	NA	T1SA02	Salmonella_phage	98.9	1.1e-70
AVL58323.1|3083554_3084019_-	hypothetical protein	NA	T1SA73	Salmonella_phage	100.0	1.8e-87
AVL58324.1|3084018_3086496_-	hypothetical protein	NA	T1S9I3	Salmonella_phage	100.0	0.0e+00
AVL58325.1|3086495_3087101_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	100.0	2.8e-112
AVL58326.1|3087100_3087436_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	100.0	5.3e-57
AVL58327.1|3087500_3087785_-	hypothetical protein	NA	T1SA01	Salmonella_phage	100.0	2.5e-47
AVL58328.1|3087777_3088170_-	hypothetical protein	NA	T1SA71	Salmonella_phage	100.0	3.2e-61
AVL58329.1|3088182_3089190_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	100.0	2.6e-192
AVL58330.1|3089200_3089917_-	peptidase	NA	T1SAP9	Salmonella_phage	100.0	1.3e-92
AVL58331.1|3089919_3090216_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	100.0	6.2e-49
AVL58332.1|3090212_3091883_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	100.0	0.0e+00
AVL58333.1|3091897_3092104_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
AVL60168.1|3092854_3093223_+|protease	membrane protease subunit	protease	T1S9H7	Salmonella_phage	99.2	5.7e-60
AVL58334.1|3093265_3094747_-|terminase	terminase	terminase	M1F3C4	Salmonella_phage	100.0	2.9e-296
AVL60169.1|3094743_3095337_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	100.0	3.0e-103
AVL58335.1|3095440_3095749_-	hypothetical protein	NA	H2D0I8	Salmonella_phage	100.0	6.6e-54
AVL58336.1|3095890_3096250_-	Eaf protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
AVL58337.1|3096246_3096504_-	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	100.0	2.0e-40
AVL60170.1|3096500_3097124_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	100.0	4.7e-123
AVL58338.1|3097135_3097615_-	hypothetical protein	NA	T1SBJ7	Salmonella_phage	100.0	3.2e-79
AVL58339.1|3097676_3098021_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	100.0	3.3e-62
AVL58340.1|3098141_3098957_-	Pyocin large subunit	NA	T1SA92	Salmonella_phage	100.0	1.3e-152
AVL58341.1|3098999_3099203_-	hypothetical protein	NA	T1S9K0	Salmonella_phage	100.0	2.0e-30
AVL58342.1|3099348_3099582_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
AVL58343.1|3099737_3100334_+	XRE family transcriptional regulator	NA	T1SBJ6	Salmonella_phage	100.0	6.9e-108
AVL58344.1|3100525_3100708_+	hypothetical protein	NA	T1SA20	Salmonella_phage	100.0	8.5e-25
AVL58345.1|3100712_3101015_+	hypothetical protein	NA	T1SA88	Salmonella_phage	100.0	2.6e-47
AVL58346.1|3101011_3101836_+	exodeoxyribonuclease VIII	NA	T1S9J7	Salmonella_phage	100.0	1.1e-164
AVL58347.1|3102236_3103118_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	100.0	6.1e-161
AVL58348.1|3103167_3103416_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	100.0	4.0e-41
AVL58349.1|3103525_3103825_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	100.0	1.1e-48
AVL58350.1|3103817_3103976_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	100.0	5.3e-23
AVL58351.1|3103972_3105040_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	100.0	1.3e-202
AVL58352.1|3105036_3105630_+	adenine methylase	NA	T1SA14	Salmonella_phage	100.0	8.1e-117
AVL58353.1|3105626_3105806_+	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
AVL58354.1|3105802_3107056_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	99.8	2.3e-238
AVL58355.1|3107248_3108826_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVL58356.1|3108895_3110362_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 11
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	3168030	3273661	4972718	terminase,tail,portal,lysis,holin,head,transposase,tRNA,capsid	Salmonella_phage(32.76%)	111	NA	NA
AVL58393.1|3168030_3168762_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVL58394.1|3168880_3169684_+	inositol monophosphatase	NA	NA	NA	NA	NA
AVL58395.1|3169828_3170707_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AVL58396.1|3170888_3171932_+	sulfite reductase subunit alpha	NA	NA	NA	NA	NA
AVL58397.1|3171935_3172754_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AVL58398.1|3172764_3173778_+	anaerobic sulfite reductase subunit AsrC	NA	NA	NA	NA	NA
AVL58399.1|3173778_3174765_-	nickel transporter	NA	NA	NA	NA	NA
AVL60173.1|3174755_3175394_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AVL58400.1|3175519_3176797_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AVL58401.1|3176791_3177931_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AVL58402.1|3178126_3179380_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AVL58403.1|3179704_3180895_+	flavohemoprotein	NA	NA	NA	NA	NA
AVL58404.1|3181076_3182621_+	transcriptional regulator CadC	NA	NA	NA	NA	NA
AVL58405.1|3182981_3184313_+	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AVL58406.1|3184395_3186540_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AVL58407.1|3186595_3188056_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AVL58408.1|3188104_3188443_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVL58409.1|3188519_3189857_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AVL58410.1|3189853_3190618_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVL58411.1|3190619_3192005_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AVL58412.1|3192699_3196587_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
AVL58413.1|3196608_3196842_+	hypothetical protein	NA	NA	NA	NA	NA
AVL58414.1|3196842_3198387_+	lytic transglycosylase F	NA	NA	NA	NA	NA
AVL58415.1|3198437_3198989_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AVL58416.1|3199013_3199649_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVL58417.1|3199652_3201014_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AVL58418.1|3201024_3201918_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVL58419.1|3202033_3202882_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVL58420.1|3202920_3203838_-	oxidoreductase	NA	NA	NA	NA	NA
AVL58421.1|3203859_3205056_-	MFS transporter	NA	NA	NA	NA	NA
AVL58422.1|3205171_3206098_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AVL58423.1|3206135_3206396_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AVL58424.1|3206507_3206888_-	holo-ACP synthase	NA	NA	NA	NA	NA
AVL58425.1|3206887_3207619_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVL58426.1|3207630_3208359_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVL58427.1|3208370_3209276_-	GTPase Era	NA	NA	NA	NA	NA
AVL60174.1|3209272_3209953_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AVL58428.1|3210226_3211201_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AVL58429.1|3211217_3213017_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AVL58430.1|3213421_3214915_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
AVL58431.1|3215465_3215603_+	hypothetical protein	NA	NA	NA	NA	NA
AVL58432.1|3215849_3216395_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL60175.1|3217059_3217125_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58433.1|3217187_3217400_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AVL58434.1|3217506_3217734_+	phage virulence factor	NA	NA	NA	NA	NA
AVL58435.1|3217830_3218409_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AVL58436.1|3218398_3219223_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AVL58437.1|3219219_3221592_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
AVL58438.1|3221645_3221888_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58439.1|3221926_3225289_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AVL58440.1|3225350_3225998_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AVL58441.1|3225895_3226633_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AVL58442.1|3226639_3227338_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AVL58443.1|3227347_3227677_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AVL58444.1|3227679_3230775_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
AVL58445.1|3230746_3231085_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AVL58446.1|3231081_3231477_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AVL58447.1|3231527_3232274_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AVL58448.1|3232281_3232683_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
AVL58449.1|3232679_3233258_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AVL58450.1|3233244_3233622_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
AVL58451.1|3233632_3233998_-	DNA packaging protein	NA	NA	NA	NA	NA
AVL58452.1|3234055_3235084_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
AVL58453.1|3235138_3235486_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AVL58454.1|3235498_3236995_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
AVL58455.1|3236984_3238565_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AVL58456.1|3238561_3238765_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AVL58457.1|3238748_3240680_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
AVL58458.1|3240651_3241197_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AVL58459.1|3241241_3241448_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58460.1|3241482_3241884_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVL58461.1|3242140_3242644_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60176.1|3242971_3243418_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
AVL58462.1|3243450_3244065_-	endolysin	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
AVL58463.1|3244064_3244346_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AVL58464.1|3244332_3244722_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
AVL58465.1|3244811_3245000_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58466.1|3245054_3245246_+	hypothetical protein	NA	NA	NA	NA	NA
AVL58467.1|3245526_3245952_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AVL58468.1|3246084_3246810_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
AVL58469.1|3247010_3247589_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
AVL58470.1|3248600_3249506_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.7e-162
AVL58471.1|3249477_3249867_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
AVL58472.1|3250755_3251238_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
AVL58473.1|3251239_3252199_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
AVL58474.1|3252195_3252420_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AVL58475.1|3252416_3253559_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
AVL58476.1|3253555_3254110_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
AVL58477.1|3254138_3254363_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AVL58478.1|3254301_3254487_-	amino acid permease	NA	NA	NA	NA	NA
AVL58479.1|3254460_3255156_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AVL58480.1|3255509_3255668_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AVL58481.1|3255689_3256040_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
AVL58482.1|3256166_3259094_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
AVL58483.1|3260255_3260495_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AVL58484.1|3260535_3260820_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AVL58485.1|3260797_3262027_-	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	93.9	5.4e-232
AVL58486.1|3262378_3262495_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL58487.1|3262524_3263004_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AVL58488.1|3263000_3263957_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AVL58489.1|3263956_3264607_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AVL58490.1|3264638_3265214_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AVL58491.1|3265374_3265554_-	hypothetical protein	NA	NA	NA	NA	NA
AVL58492.1|3265638_3267261_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AVL58493.1|3267245_3267983_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AVL58494.1|3268113_3269448_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AVL60177.1|3269465_3270365_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL58495.1|3270467_3271055_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVL58496.1|3271116_3271500_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AVL58497.1|3271818_3272508_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AVL58498.1|3272623_3273661_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 12
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	4497846	4540539	4972718	transposase,tRNA,integrase	Escherichia_phage(25.0%)	42	4501595:4501609	4529613:4529627
AVL59612.1|4497846_4499211_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AVL59613.1|4499414_4500632_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
AVL59614.1|4500628_4500997_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVL59615.1|4501354_4502308_-	replication protein	NA	NA	NA	NA	NA
4501595:4501609	attL	ATAAATATCCATCGC	NA	NA	NA	NA
AVL59616.1|4502294_4502522_-	DNA-binding protein	NA	NA	NA	NA	NA
AVL59617.1|4502672_4505432_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AVL59618.1|4505528_4506062_-	regulator	NA	NA	NA	NA	NA
AVL59619.1|4506064_4506676_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59620.1|4506675_4506897_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59621.1|4507071_4507362_+	hypothetical protein	NA	NA	NA	NA	NA
AVL59622.1|4507381_4507636_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59623.1|4507635_4511040_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVL59624.1|4511043_4512468_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AVL59625.1|4512711_4513569_+	hypothetical protein	NA	NA	NA	NA	NA
AVL59626.1|4513565_4513961_+	hypothetical protein	NA	NA	NA	NA	NA
AVL59627.1|4514375_4514645_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59628.1|4514722_4514908_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59629.1|4515793_4516666_-|integrase	integrase	integrase	NA	NA	NA	NA
AVL59630.1|4517734_4519396_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.8	7.1e-09
AVL59631.1|4519392_4521318_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVL59632.1|4521395_4523939_-	subtilase	NA	NA	NA	NA	NA
AVL59633.1|4523959_4524949_-	ATP-binding protein	NA	NA	NA	NA	NA
AVL59634.1|4525027_4525612_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.1	5.5e-49
AVL59635.1|4525635_4525947_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL59636.1|4525885_4526899_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVL60228.1|4527044_4527836_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVL59637.1|4527999_4528347_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVL59638.1|4528340_4529312_+	sulfonamide-resistant dihydropteroate synthase Sul1-delta	NA	NA	NA	NA	NA
AVL59639.1|4529528_4530743_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
4529613:4529627	attR	GCGATGGATATTTAT	NA	NA	NA	NA
AVL59640.1|4530770_4530953_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AVL59641.1|4530949_4531576_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVL59642.1|4531679_4532855_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AVL59643.1|4532875_4533667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL59644.1|4533758_4535291_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVL59645.1|4535517_4536171_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
AVL60229.1|4536376_4537243_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
AVL59646.1|4537459_4537807_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVL59647.1|4537800_4538640_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVL59648.1|4538569_4538749_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59649.1|4538767_4539268_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVL59650.1|4539573_4539687_-	NTP-binding protein	NA	NA	NA	NA	NA
AVL59651.1|4539774_4540539_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 13
CP027410	Salmonella enterica subsp. enterica strain FDAARGOS_317 chromosome, complete genome	4972718	4911461	4931880	4972718	plate,tail	Burkholderia_phage(47.37%)	25	NA	NA
AVL59970.1|4911461_4912190_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
AVL59971.1|4912386_4912677_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59972.1|4912925_4913381_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59973.1|4913377_4913983_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AVL59974.1|4913987_4915733_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AVL59975.1|4915735_4916368_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AVL59976.1|4916360_4917476_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AVL59977.1|4917466_4917826_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVL59978.1|4917989_4919537_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AVL59979.1|4919536_4920466_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AVL59980.1|4920462_4920825_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AVL59981.1|4921152_4921875_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AVL59982.1|4921884_4922928_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AVL59983.1|4922915_4923125_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVL59984.1|4924076_4926431_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AVL59985.1|4926527_4926656_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVL59986.1|4926615_4926933_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVL59987.1|4926984_4927509_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVL59988.1|4927508_4928936_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AVL59989.1|4928925_4929123_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVL59990.1|4929119_4929575_-	hypothetical protein	NA	NA	NA	NA	NA
AVL59991.1|4929734_4930049_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVL59992.1|4930061_4930667_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AVL59993.1|4930669_4930957_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AVL59994.1|4931532_4931880_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
CP027409	Salmonella enterica subsp. enterica strain FDAARGOS_317 plasmid unnamed, complete sequence	220137	55133	130161	220137	integrase,transposase	Salmonella_phage(21.74%)	83	80658:80674	133311:133324
AVL55206.1|55133_55814_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
AVL55207.1|55958_56147_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55208.1|56195_56552_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55209.1|56544_57015_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55210.1|57525_57948_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AVL55211.1|57947_59222_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
AVL55212.1|59303_60281_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AVL55213.1|60277_61483_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AVL55214.1|61897_62839_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AVL55215.1|62870_63437_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVL55216.1|63493_63829_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55385.1|64012_64429_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AVL55217.1|64514_65630_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55218.1|65888_66377_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVL55219.1|67031_67772_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVL55220.1|67978_68539_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
AVL55221.1|68522_70187_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVL55222.1|70119_71145_+	AAA family ATPase	NA	NA	NA	NA	NA
AVL55223.1|71333_72371_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVL55224.1|72979_73873_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
AVL55225.1|74046_74211_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AVL55226.1|74384_75152_+	virulence protein SpvA	NA	NA	NA	NA	NA
AVL55227.1|75333_77109_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
AVL55228.1|77389_78115_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
AVL55229.1|78375_79026_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
AVL55230.1|79633_79984_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
AVL55231.1|80050_80611_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
80658:80674	attL	CGTCCGGATGGCTGGCG	NA	NA	NA	NA
AVL55232.1|81330_81816_-	hypothetical protein	NA	NA	NA	NA	NA
80658:80674	attL	CGTCCGGATGGCTGGCG	NA	NA	NA	NA
AVL55233.1|81809_82319_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AVL55386.1|82322_82472_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVL55234.1|82484_83036_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVL55235.1|83044_83827_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AVL55236.1|83861_84383_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVL55237.1|84379_84670_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVL55238.1|84671_84977_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVL55239.1|84978_85197_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVL55240.1|85872_86394_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55241.1|86877_87174_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVL55242.1|87679_88657_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.8	1.8e-100
AVL55243.1|90279_90480_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55244.1|90628_90931_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL55245.1|91205_91724_+	fimbrial protein	NA	NA	NA	NA	NA
AVL55246.1|91951_94360_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
AVL55247.1|94352_95045_+	fimbrial chaperone protein	NA	NA	NA	NA	NA
AVL55248.1|95059_95617_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55249.1|95869_96745_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55250.1|97176_97389_+	regulator	NA	NA	NA	NA	NA
AVL55251.1|97373_97724_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVL55252.1|97968_98622_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AVL55253.1|98754_99654_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55254.1|99743_100301_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
AVL55255.1|100737_102387_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL55256.1|102389_103250_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL55257.1|103351_104875_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AVL55387.1|104864_105647_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.6	1.3e-32
AVL55258.1|105822_106323_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVL55259.1|106341_106521_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55260.1|106450_107290_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
107134:107150	attR	CGTCCGGATGGCTGGCG	NA	NA	NA	NA
AVL55261.1|107283_107631_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
107134:107150	attR	CGTCCGGATGGCTGGCG	NA	NA	NA	NA
AVL55262.1|107848_109084_-|transposase	IS256 family transposase ISEc58	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
AVL55263.1|109196_109391_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55264.1|109351_110881_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVL55265.1|111069_112707_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	60.6	1.8e-174
AVL55388.1|112762_113083_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
AVL55389.1|113289_114114_-	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
AVL55390.1|114355_115147_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVL55266.1|115295_116309_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVL55267.1|116247_116862_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVL55268.1|116987_117548_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVL55269.1|117550_120517_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVL55391.1|120525_120942_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55270.1|121076_121310_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55271.1|121418_121685_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55392.1|121684_122179_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55272.1|122234_122837_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AVL55273.1|123190_124537_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55274.1|124815_126696_+	colicin	NA	NA	NA	NA	NA
AVL55275.1|126713_127061_-	colicin transporter	NA	NA	NA	NA	NA
AVL55276.1|127179_127527_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55277.1|127544_128135_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55278.1|128131_128392_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55279.1|128960_129374_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55280.1|129375_130161_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
133311:133324	attR	AACAGGCCCGTCTG	NA	NA	NA	NA
>prophage 2
CP027409	Salmonella enterica subsp. enterica strain FDAARGOS_317 plasmid unnamed, complete sequence	220137	185420	217068	220137	integrase,transposase	Escherichia_phage(28.57%)	38	177922:177935	200740:200753
177922:177935	attL	TGGCTTCGTGCAGG	NA	NA	NA	NA
AVL55346.1|185420_186575_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
AVL55347.1|188163_188820_-	prepilin peptidase	NA	NA	NA	NA	NA
AVL55348.1|188804_189365_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVL55349.1|189374_189989_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
AVL55350.1|190006_191104_-	pilus assembly protein PilR	NA	NA	NA	NA	NA
AVL55351.1|191116_192670_-	ATP-binding protein	NA	NA	NA	NA	NA
AVL55352.1|192680_193133_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AVL55353.1|193119_194415_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
AVL55354.1|194407_196090_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
AVL55355.1|196103_196541_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
AVL55356.1|196540_197608_-	pili assembly chaperone	NA	NA	NA	NA	NA
AVL55357.1|197641_198232_-	pili assembly chaperone	NA	NA	NA	NA	NA
AVL55358.1|198281_198734_-	pili assembly chaperone	NA	NA	NA	NA	NA
AVL55359.1|198776_199031_-	pilus assembly protein	NA	NA	NA	NA	NA
AVL55360.1|199298_199865_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AVL55361.1|199878_200562_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AVL55362.1|200664_200844_+	hypothetical protein	NA	NA	NA	NA	NA
200740:200753	attR	TGGCTTCGTGCAGG	NA	NA	NA	NA
AVL55396.1|200815_201349_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AVL55363.1|201354_201477_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AVL55364.1|201790_202027_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AVL55365.1|201995_202259_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
AVL55366.1|202732_202939_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55398.1|202935_203256_-	hypothetical protein	NA	NA	NA	NA	NA
AVL55397.1|203231_204263_+	replication initiation protein	NA	NA	NA	NA	NA
AVL55367.1|205171_205441_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55368.1|205437_205719_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVL55369.1|205758_206607_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
AVL55370.1|206924_208574_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL55371.1|208576_209437_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL55372.1|209538_211062_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AVL55399.1|211051_211834_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.6	1.3e-32
AVL55373.1|212009_212510_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVL55374.1|212528_212708_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55375.1|212637_213477_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVL55376.1|213470_213818_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVL55377.1|214035_215271_-|transposase	IS256 family transposase ISEc58	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
AVL55378.1|215383_215578_+	hypothetical protein	NA	NA	NA	NA	NA
AVL55379.1|215538_217068_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
