The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	640871	661768	4776422	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
AVL61018.1|640871_641513_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
AVL64885.1|642091_642508_-	serine acetyltransferase	NA	NA	NA	NA	NA
AVL61019.1|642888_643344_-	hypothetical protein	NA	NA	NA	NA	NA
AVL61020.1|643340_643955_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AVL61021.1|643961_645620_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
AVL61022.1|645622_646255_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
AVL61023.1|646247_647363_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
AVL61024.1|647353_647713_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVL61025.1|647876_649424_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AVL61026.1|649423_650353_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AVL61027.1|650349_650712_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AVL61028.1|651039_651762_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AVL61029.1|651771_652815_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AVL61030.1|652802_653012_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVL61031.1|653011_653965_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AVL61032.1|653964_656319_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AVL61033.1|656415_656544_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVL61034.1|656503_656821_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVL61035.1|656872_657397_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
AVL61036.1|657396_658824_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AVL61037.1|658813_659011_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVL61038.1|659007_659463_-	hypothetical protein	NA	NA	NA	NA	NA
AVL61039.1|659622_659937_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVL61040.1|659949_660555_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AVL61041.1|660557_660845_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AVL61042.1|661420_661768_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	1430098	1473694	4776422	integrase,lysis,portal,tail,protease,coat,terminase	Enterobacteria_phage(44.78%)	68	1433945:1433990	1473210:1473255
AVL61715.1|1430098_1431151_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
AVL61716.1|1431433_1432537_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.0e-60
AVL61717.1|1432548_1433799_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
1433945:1433990	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
AVL64913.1|1434004_1434673_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	6.1e-129
AVL61718.1|1435044_1435395_-	DNA-binding protein	NA	A0A075B8K2	Enterobacteria_phage	100.0	6.4e-61
AVL61719.1|1435397_1436033_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
AVL61720.1|1436133_1436313_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
AVL61721.1|1436409_1437096_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
AVL61722.1|1437106_1437370_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
AVL61723.1|1437371_1437857_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
AVL61724.1|1437853_1438480_-	hNH endonuclease	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
AVL64914.1|1438476_1438641_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
AVL61725.1|1438651_1438948_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
AVL61726.1|1438994_1439279_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
AVL61727.1|1439278_1439896_-	recombinase	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
AVL61728.1|1440025_1440214_-	protein kil	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
AVL61729.1|1440194_1440353_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
AVL61730.1|1440438_1440750_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
AVL61731.1|1440897_1441101_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
AVL61732.1|1441100_1441337_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
AVL61733.1|1441373_1441568_-	restriction endonuclease	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
AVL61734.1|1441782_1442361_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
AVL61735.1|1442381_1442684_-	regulator	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
AVL61736.1|1443037_1443688_-	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
AVL61737.1|1443768_1443954_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AVL61738.1|1444060_1444339_+	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
AVL61739.1|1444373_1444520_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AVL61740.1|1444512_1445328_+	DNA replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
AVL61741.1|1445324_1446701_+	replicative DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
AVL61742.1|1446756_1447212_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.4e-79
AVL61743.1|1447208_1447382_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AVL61744.1|1447348_1447525_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AVL61745.1|1447521_1447860_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.3e-62
AVL61746.1|1447852_1448029_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
AVL61747.1|1448021_1448633_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
AVL61748.1|1448629_1448854_+	protein ninY	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
AVL61749.1|1448850_1449054_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
AVL61750.1|1449034_1449214_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
AVL61751.1|1449210_1449834_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
AVL61752.1|1449923_1450133_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
AVL61753.1|1450272_1450476_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AVL61754.1|1450453_1450951_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
AVL61755.1|1451039_1451477_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
AVL61756.1|1451511_1451703_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
AVL61757.1|1451689_1452376_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
AVL61758.1|1452678_1452921_+	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AVL61759.1|1452922_1453102_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
AVL61760.1|1453125_1453614_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
AVL61761.1|1453591_1455091_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
AVL61762.1|1455090_1457268_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
AVL61763.1|1457281_1458193_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
AVL61764.1|1458192_1459485_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
AVL61765.1|1459523_1459733_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
AVL61766.1|1459716_1460217_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
AVL61767.1|1460176_1461595_+	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
AVL61768.1|1461598_1462300_+|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
AVL61769.1|1462299_1462755_+	hypothetical protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
AVL61770.1|1462757_1463450_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
AVL61771.1|1463459_1464755_+	acyltransferase	NA	Q716G3	Shigella_phage	84.5	2.1e-181
AVL61772.1|1464754_1466752_+	DNA transfer protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
AVL61773.1|1466842_1467328_-	hypothetical protein	NA	NA	NA	NA	NA
AVL61774.1|1467730_1467985_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
AVL61775.1|1468120_1470124_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
AVL61776.1|1470182_1471640_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
AVL61777.1|1471629_1472562_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
AVL61778.1|1472558_1472921_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AVL61779.1|1473037_1473217_+	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	100.0	1.9e-16
AVL61780.1|1473418_1473694_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
1473210:1473255	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 3
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	2077919	2085942	4776422	protease,integrase,transposase	Dickeya_phage(14.29%)	10	2079170:2079184	2091322:2091336
AVL62336.1|2077919_2079038_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVL62337.1|2079034_2080981_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
2079170:2079184	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AVL62338.1|2080961_2081156_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62339.1|2081110_2081332_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVL62340.1|2081655_2081976_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVL62341.1|2082006_2084283_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVL62342.1|2084334_2084517_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62343.1|2084473_2084932_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVL62344.1|2085205_2085403_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62345.1|2085564_2085942_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
2091322:2091336	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	2136551	2234510	4776422	lysis,portal,tail,transposase,protease,terminase,tRNA	Salmonella_phage(46.55%)	107	NA	NA
AVL62385.1|2136551_2137355_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVL62386.1|2137347_2138670_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVL62387.1|2138650_2139355_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AVL62388.1|2139354_2143821_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVL62389.1|2144165_2145986_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AVL62390.1|2146245_2146794_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AVL62391.1|2146821_2147469_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVL62392.1|2147530_2148721_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AVL62393.1|2148905_2149997_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AVL62394.1|2150603_2152004_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AVL62395.1|2152204_2152666_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVL62396.1|2152662_2152896_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62397.1|2152982_2154197_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AVL62398.1|2154441_2155875_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AVL62399.1|2155955_2157158_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVL62400.1|2157352_2158645_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AVL62401.1|2158689_2158938_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AVL64943.1|2158978_2159218_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
AVL62402.1|2159223_2160093_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
AVL62403.1|2160089_2160770_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
AVL62404.1|2160766_2161552_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
AVL62405.1|2161557_2161854_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
AVL62406.1|2161944_2162145_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AVL62407.1|2162432_2162639_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
AVL62408.1|2162665_2163100_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62409.1|2163101_2163527_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62410.1|2163569_2163965_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
AVL62411.1|2164069_2164306_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
AVL62412.1|2164271_2164646_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
AVL62413.1|2164737_2165643_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AVL62414.1|2165639_2166341_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
AVL64944.1|2166385_2166787_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
AVL62415.1|2166783_2167317_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
AVL62416.1|2167318_2167576_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
AVL62417.1|2167586_2167988_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
AVL62418.1|2168095_2168740_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62419.1|2168970_2169204_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AVL62420.1|2169320_2169569_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AVL62421.1|2169603_2170206_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AVL62422.1|2170205_2170412_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AVL62423.1|2170414_2171026_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
AVL62424.1|2171022_2171169_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVL62425.1|2171158_2171956_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AVL62426.1|2172122_2172341_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62427.1|2172378_2172567_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62428.1|2172621_2172810_+	hypothetical protein	NA	NA	NA	NA	NA
AVL64945.1|2173012_2173315_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVL62429.1|2173292_2173832_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
AVL64946.1|2174148_2174634_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
AVL62430.1|2174844_2175378_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AVL62431.1|2175334_2177473_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
AVL62432.1|2177469_2177676_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AVL64947.1|2177702_2179220_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
AVL64948.1|2179143_2181222_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
AVL62433.1|2181312_2181636_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AVL62434.1|2181628_2181928_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AVL62435.1|2181908_2182475_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AVL62436.1|2182471_2182873_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AVL62437.1|2182884_2183634_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AVL62438.1|2183679_2184078_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AVL62439.1|2184074_2184404_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AVL64949.1|2184483_2187471_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
AVL62440.1|2187467_2187800_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AVL62441.1|2187898_2188423_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
AVL62442.1|2188512_2189046_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVL62443.1|2189135_2189831_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AVL62444.1|2189840_2190578_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
AVL62445.1|2190475_2191180_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
AVL62446.1|2194640_2194883_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62447.1|2194936_2197312_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
AVL62448.1|2197812_2198133_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
AVL62449.1|2198122_2198704_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
AVL62450.1|2198900_2199623_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AVL62451.1|2199835_2200054_+	Hin recombinase	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
AVL62452.1|2200273_2201494_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AVL62453.1|2201490_2201988_-	hypothetical protein	NA	NA	NA	NA	NA
AVL62454.1|2202422_2205035_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AVL62455.1|2205242_2206253_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVL62456.1|2206418_2206961_+	cell division protein ZapC	NA	NA	NA	NA	NA
AVL62457.1|2206957_2208067_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVL62458.1|2208165_2210274_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVL62459.1|2210286_2212194_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AVL62460.1|2212208_2213462_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVL62461.1|2213466_2215107_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AVL62462.1|2215103_2215667_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62463.1|2215922_2216090_+	ribosome modulation factor	NA	NA	NA	NA	NA
AVL62464.1|2216189_2216708_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVL62465.1|2216776_2218537_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVL62466.1|2218722_2219175_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AVL64950.1|2219246_2220299_-	outer membrane protein A	NA	NA	NA	NA	NA
AVL62467.1|2220655_2221165_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVL62468.1|2221381_2221987_+	DNA transformation protein	NA	NA	NA	NA	NA
AVL62469.1|2221973_2224127_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVL62470.1|2224145_2224592_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AVL62471.1|2224715_2226770_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AVL62472.1|2226805_2227264_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AVL62473.1|2227358_2228021_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AVL62474.1|2228191_2228608_+	CoA-binding protein	NA	NA	NA	NA	NA
AVL62475.1|2228652_2228970_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVL62476.1|2229027_2230239_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVL62477.1|2230453_2231002_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVL62478.1|2231027_2231807_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVL62479.1|2231855_2232137_+	acylphosphatase	NA	NA	NA	NA	NA
AVL62480.1|2232133_2232463_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVL62481.1|2232549_2233209_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AVL62482.1|2233274_2233484_+	hypothetical protein	NA	NA	NA	NA	NA
AVL62483.1|2233829_2234510_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	3133633	3144234	4776422		Morganella_phage(25.0%)	13	NA	NA
AVL63380.1|3133633_3135064_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AVL63381.1|3135137_3135833_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
AVL63382.1|3135912_3136224_-	hypothetical protein	NA	NA	NA	NA	NA
AVL63383.1|3136874_3138071_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
AVL64990.1|3138328_3138517_-	cold-shock protein	NA	NA	NA	NA	NA
AVL63384.1|3138527_3138740_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVL63385.1|3139194_3140463_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
AVL63386.1|3140465_3140885_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVL63387.1|3141011_3141173_-	hypothetical protein	NA	NA	NA	NA	NA
AVL63388.1|3141150_3141393_-	hypothetical protein	NA	NA	NA	NA	NA
AVL63389.1|3141653_3142451_+	protein MtfA	NA	NA	NA	NA	NA
AVL63390.1|3142822_3143113_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
AVL63391.1|3143760_3144234_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 6
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	3230229	3240735	4776422		Enterobacteria_phage(37.5%)	10	NA	NA
AVL63476.1|3230229_3231543_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AVL63477.1|3231569_3232649_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AVL63478.1|3232653_3233427_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVL63479.1|3233423_3234416_-	protein RfbI	NA	NA	NA	NA	NA
AVL63480.1|3234421_3234973_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AVL64995.1|3234973_3235852_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AVL63481.1|3235899_3236799_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AVL63482.1|3236798_3237884_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AVL63483.1|3238260_3239154_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVL63484.1|3239331_3240735_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 7
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	3309011	3318182	4776422	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVL63539.1|3309011_3311045_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AVL63540.1|3311285_3311744_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVL63541.1|3311915_3312446_+	lipoprotein	NA	NA	NA	NA	NA
AVL63542.1|3312502_3312970_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVL63543.1|3313016_3313736_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL63544.1|3313732_3315418_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVL63545.1|3315640_3316372_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVL63546.1|3316431_3316539_+	hypothetical protein	NA	NA	NA	NA	NA
AVL63547.1|3316519_3317251_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL63548.1|3317234_3318182_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
CP027412	Salmonella enterica strain FDAARGOS_319 chromosome, complete genome	4776422	3390232	3402516	4776422	holin,tail	Salmonella_phage(40.0%)	10	NA	NA
AVL63616.1|3390232_3390736_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AVL63617.1|3390763_3391054_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AVL63618.1|3393277_3393721_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AVL63619.1|3394098_3394626_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AVL63620.1|3394628_3395870_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AVL63621.1|3396462_3396792_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AVL63622.1|3397088_3398420_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
AVL63623.1|3398448_3398817_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AVL65000.1|3398831_3399821_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AVL63624.1|3400149_3402516_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 1
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	0	31294	232341	transposase	Burkholderia_phage(22.22%)	26	NA	NA
AVL60249.1|668_1100_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AVL60250.1|1247_1598_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
AVL60251.1|1766_3593_-	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
AVL60252.1|4156_4456_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVL60253.1|4808_5735_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60254.1|5746_7303_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL60255.1|7343_8792_-	ATP-binding protein	NA	NA	NA	NA	NA
AVL60256.1|8791_10915_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL60257.1|10901_11744_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL60258.1|12954_13791_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVL60259.1|13790_14594_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVL60260.1|14993_16430_-	glutathione synthase	NA	NA	NA	NA	NA
AVL60261.1|16597_17302_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVL60262.1|17846_18167_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVL60263.1|18159_18546_+	amino acid-binding protein	NA	NA	NA	NA	NA
AVL60264.1|18553_19240_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVL60265.1|19217_19844_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVL60266.1|19922_21128_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AVL60267.1|21240_21909_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AVL60268.1|22347_23556_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	6.7e-235
AVL60269.1|23625_24755_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
AVL60270.1|24785_25409_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	1.1e-36
AVL60271.1|25534_28420_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AVL60272.1|28483_29188_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL60273.1|29799_30225_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60274.1|30478_31294_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
>prophage 2
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	38265	47196	232341		Caulobacter_phage(33.33%)	10	NA	NA
AVL60284.1|38265_38841_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AVL60285.1|38908_39487_-	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
AVL60286.1|39535_40576_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AVL60287.1|40598_41054_-	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AVL60288.1|41076_42234_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AVL60289.1|42233_42815_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
AVL60290.1|43138_44197_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AVL60291.1|44206_45349_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
AVL60292.1|45341_46115_+	hypothetical protein	NA	NA	NA	NA	NA
AVL60293.1|46116_47196_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
>prophage 3
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	58539	59715	232341		Salmonella_phage(100.0%)	1	NA	NA
AVL60305.1|58539_59715_+	recombinase	NA	A0A1B0V7J3	Salmonella_phage	26.6	1.6e-15
>prophage 4
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	79454	81239	232341		Bacillus_phage(100.0%)	1	NA	NA
AVL60328.1|79454_81239_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.7	3.5e-22
>prophage 5
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	95144	98161	232341	transposase	Escherichia_phage(50.0%)	4	NA	NA
AVL60337.1|95144_96125_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVL60466.1|96163_96289_-	ABC transporter	NA	NA	NA	NA	NA
AVL60338.1|96473_97112_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60339.1|97123_98161_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 6
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	101266	102271	232341		Aeromonas_phage(100.0%)	1	NA	NA
AVL60344.1|101266_102271_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 7
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	118634	131303	232341	transposase	Salmonella_phage(44.44%)	12	NA	NA
AVL60358.1|118634_119510_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.0	2.1e-60
AVL60359.1|119986_121042_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
AVL60360.1|121059_121260_+	hypothetical protein	NA	NA	NA	NA	NA
AVL60361.1|121256_121973_+	hypothetical protein	NA	NA	NA	NA	NA
AVL60362.1|122207_123062_+	hypothetical protein	NA	NA	NA	NA	NA
AVL60363.1|123070_123883_-	DNA modification methylase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
AVL60364.1|124252_125416_+	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
AVL60365.1|125663_127355_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	2.6e-67
AVL60366.1|127750_128134_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AVL60367.1|128130_128478_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AVL60368.1|128527_130063_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
AVL60369.1|130379_131303_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.5	5.4e-168
>prophage 8
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	136069	137125	232341		Salmonella_phage(100.0%)	1	NA	NA
AVL60468.1|136069_137125_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.6	1.4e-82
>prophage 9
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	142169	143920	232341		Klebsiella_phage(33.33%)	3	NA	NA
AVL60374.1|142169_142781_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
AVL60375.1|142801_143065_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
AVL60376.1|143158_143920_-	SAM-dependent methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
>prophage 10
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	149279	150074	232341		Hepacivirus(100.0%)	1	NA	NA
AVL60379.1|149279_150074_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
>prophage 11
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	156113	156407	232341		Escherichia_phage(100.0%)	1	NA	NA
AVL60386.1|156113_156407_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	6.4e-06
>prophage 12
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	161421	163223	232341	transposase	Escherichia_phage(100.0%)	2	NA	NA
AVL60396.1|161421_162444_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.9e-201
AVL60397.1|162440_163223_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
>prophage 13
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	172460	173642	232341		Erwinia_phage(100.0%)	1	NA	NA
AVL60410.1|172460_173642_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
>prophage 14
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	191128	192418	232341		Salmonella_phage(100.0%)	1	NA	NA
AVL60422.1|191128_192418_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	4.2e-09
>prophage 15
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	197116	198794	232341		Cronobacter_phage(100.0%)	2	NA	NA
AVL60430.1|197116_198376_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.0e-96
AVL60431.1|198359_198794_-	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
>prophage 16
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	205752	207910	232341		Pacmanvirus(50.0%)	2	NA	NA
AVL60441.1|205752_206268_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AVL60442.1|206482_207910_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
>prophage 17
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	212809	214887	232341		Bacillus_phage(100.0%)	2	NA	NA
AVL60448.1|212809_214210_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AVL60449.1|214206_214887_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 18
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	219981	227238	232341		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AVL60455.1|219981_220719_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AVL60456.1|220752_220950_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVL60457.1|220990_223438_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
AVL60458.1|223564_224005_-	hypothetical protein	NA	NA	NA	NA	NA
AVL60459.1|224091_227238_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	8.0e-62
>prophage 19
CP027411	Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence	232341	230610	231291	232341		Bacillus_phage(100.0%)	1	NA	NA
AVL60463.1|230610_231291_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
