The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	0	6608	1675227	tRNA	Salmonella_phage(50.0%)	3	NA	NA
AVL42355.1|582_3147_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
AVL42356.1|3240_5433_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	31.9	9.4e-09
AVL42357.1|5444_6608_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	1.3e-89
>prophage 2
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	11615	15920	1675227	tRNA	Bacillus_virus(33.33%)	5	NA	NA
AVL42362.1|11615_12803_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.6	1.5e-64
AVL42363.1|12803_13250_+	EamA-like transporter family protein	NA	NA	NA	NA	NA
AVL42364.1|13256_14210_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVL42365.1|14246_15581_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.0	5.7e-09
AVL42366.1|15602_15920_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	50.6	1.3e-15
>prophage 3
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	23730	25908	1675227		uncultured_virus(100.0%)	1	NA	NA
AVL42372.1|23730_25908_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.5	5.3e-81
>prophage 4
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	31677	34532	1675227		Streptococcus_phage(50.0%)	5	NA	NA
AVL42378.1|31677_32199_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	6.9e-27
AVL42379.1|32296_33106_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVL42380.1|33182_33941_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AVL42381.1|33951_34155_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVL42382.1|34250_34532_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	41.6	7.2e-07
>prophage 5
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	38897	51398	1675227	tRNA	Iris_mild_mosaic_virus(20.0%)	13	NA	NA
AVL42383.1|38897_41354_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	7.0e-13
AVL42384.1|41569_41995_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AVL42385.1|42012_42942_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
AVL42386.1|42941_43277_+	hypothetical protein	NA	NA	NA	NA	NA
AVL42387.1|43398_44154_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.2	1.1e-57
AVL42388.1|44282_45041_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
AVL42389.1|45052_46369_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AVL42390.1|46510_47764_+	glucose-1-phosphate adenylyltransferase	NA	G3MA50	Bacillus_virus	26.0	1.4e-12
AVL42391.1|47778_49170_+	glycogen synthase	NA	NA	NA	NA	NA
AVL42392.1|49223_49910_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AVL42393.1|49957_50188_+	acyl carrier protein	NA	NA	NA	NA	NA
AVL42394.1|50189_50891_+	ribonuclease III	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	31.8	1.2e-26
AVL42395.1|50891_51398_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.8	5.8e-23
>prophage 6
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	56860	67090	1675227	protease	Bodo_saltans_virus(20.0%)	7	NA	NA
AVL42402.1|56860_59545_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	2.0e-29
AVL42403.1|59557_59932_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVL42404.1|59934_61608_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.7	1.4e-52
AVL42405.1|61620_62895_+	trigger factor	NA	NA	NA	NA	NA
AVL42406.1|62952_63531_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	3.0e-55
AVL42407.1|63533_64766_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.3	3.5e-130
AVL43687.1|64774_67090_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	42.5	1.3e-162
>prophage 7
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	70374	75373	1675227		Singapore_grouper_iridovirus(33.33%)	6	NA	NA
AVL42411.1|70374_71193_+	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	40.2	2.2e-56
AVL42412.1|71243_71825_+	septum formation protein Maf	NA	NA	NA	NA	NA
AVL42413.1|71885_72245_+	hypothetical protein	NA	NA	NA	NA	NA
AVL42414.1|72249_72927_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	38.8	3.3e-13
AVL42415.1|72990_73389_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AVL42416.1|73573_75373_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.0	3.3e-20
>prophage 8
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	78757	80469	1675227		Clostridium_phage(50.0%)	2	NA	NA
AVL42420.1|78757_79279_-	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	41.2	1.1e-19
AVL42421.1|79416_80469_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.5	6.0e-30
>prophage 9
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	88134	101928	1675227	tRNA,protease	Bacillus_phage(30.0%)	14	NA	NA
AVL42428.1|88134_89502_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	43.2	2.2e-48
AVL42429.1|89513_89966_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AVL42430.1|89974_91366_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	38.4	2.1e-70
AVL42431.1|91375_92695_+|protease	protease	protease	Q6DW11	Phage_TP	38.8	1.3e-53
AVL42432.1|92712_93387_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	6.1e-36
AVL42433.1|93373_94900_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVL42434.1|94936_95794_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	A0A1V0SF38	Hokovirus	25.7	9.3e-05
AVL42435.1|95795_96689_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	49.0	1.1e-69
AVL42436.1|96685_97771_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AVL42437.1|97780_98140_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AVL42438.1|98526_99711_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.2	6.8e-38
AVL42439.1|99752_100613_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	32.6	7.9e-28
AVL42440.1|100683_101367_+	deoxyguanosine kinase	NA	S5MMC6	Bacillus_phage	32.8	1.0e-25
AVL42441.1|101424_101928_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	43.7	2.4e-21
>prophage 10
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	106015	126585	1675227	tRNA	Hokovirus(10.0%)	21	NA	NA
AVL42446.1|106015_107635_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	25.1	3.9e-44
AVL42447.1|107643_108528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL42448.1|108561_108774_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
AVL42449.1|108853_110038_-	FAD-binding protein	NA	A0A2K9L162	Tupanvirus	39.0	4.0e-54
AVL42450.1|110046_110598_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVL42451.1|110606_110837_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
AVL42452.1|110863_111511_-	transporter	NA	NA	NA	NA	NA
AVL42453.1|111669_112323_-	DNA lyase	NA	NA	NA	NA	NA
AVL42454.1|112441_112702_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AVL42455.1|112711_113779_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	36.7	9.8e-20
AVL42456.1|113782_114241_+	hypothetical protein	NA	NA	NA	NA	NA
AVL42457.1|114250_114820_+	HD domain-containing protein	NA	NA	NA	NA	NA
AVL42458.1|114820_116680_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.0	5.2e-61
AVL42459.1|116679_117114_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	8.8e-28
AVL42460.1|117163_118108_-	pyridine nucleotide-disulfide oxidoreductase	NA	G3MA85	Bacillus_virus	36.5	9.2e-46
AVL42461.1|118118_119327_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	28.2	2.7e-26
AVL43689.1|119335_121990_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AVL42462.1|122003_123635_-	RNA helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	34.5	4.0e-57
AVL43690.1|123624_124515_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AVL42463.1|124504_125185_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.6	1.1e-48
AVL42464.1|125193_126585_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	3.2e-23
>prophage 11
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	133231	143296	1675227		Planktothrix_phage(33.33%)	7	NA	NA
AVL42471.1|133231_133921_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.1e-39
AVL42472.1|133917_134979_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVL42473.1|134978_136211_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42474.1|136225_136564_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42475.1|136565_138380_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.3	2.2e-24
AVL42476.1|138980_140033_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42477.1|140041_143296_-	DUF4280 domain-containing protein	NA	A0A0X8WP96	Ralstonia_phage	38.1	8.7e-11
>prophage 12
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	150488	158084	1675227		Salicola_phage(25.0%)	6	NA	NA
AVL42486.1|150488_151916_+	nicotinate phosphoribosyltransferase	NA	A0A248SJ77	Salicola_phage	48.1	2.8e-115
AVL42487.1|151961_153353_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	25.1	1.2e-14
AVL42488.1|153349_154033_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVL42489.1|154032_154614_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42490.1|154624_156346_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.0e-30
AVL42491.1|156329_158084_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	3.6e-19
>prophage 13
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	166605	172696	1675227		Pseudomonas_phage(50.0%)	3	NA	NA
AVL42499.1|166605_168483_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	1.2e-23
AVL42500.1|168483_169578_+	relaxase	NA	NA	NA	NA	NA
AVL42501.1|169597_172696_-	DEAD/DEAH box helicase	NA	F2Y0S4	Organic_Lake_phycodnavirus	20.7	7.3e-07
>prophage 14
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	181305	181524	1675227		Erysipelothrix_phage(100.0%)	1	NA	NA
AVL42506.1|181305_181524_-	XRE family transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	40.3	6.6e-08
>prophage 15
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	193492	194296	1675227		Staphylococcus_virus(100.0%)	1	NA	NA
AVL42508.1|193492_194296_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	54.6	1.4e-82
>prophage 16
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	199193	205844	1675227		Streptococcus_phage(33.33%)	6	NA	NA
AVL42511.1|199193_199949_-	replication initiation protein	NA	A0A2P0VK56	Streptococcus_phage	34.6	9.7e-14
AVL43693.1|200036_200318_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42512.1|200324_200483_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42513.1|200479_201880_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	31.5	6.7e-53
AVL42514.1|201876_203019_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AVL42515.1|203027_205844_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.2	2.2e-268
>prophage 17
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	210090	218708	1675227	protease,tRNA	Powai_lake_megavirus(25.0%)	6	NA	NA
AVL42521.1|210090_211464_-|tRNA	cysteine--tRNA ligase	tRNA	A0A161HRB7	Powai_lake_megavirus	33.8	4.3e-52
AVL42522.1|211474_213814_-	endonuclease MutS2	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.4	5.0e-08
AVL42523.1|214021_214213_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVL42524.1|214326_216378_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.4	4.8e-100
AVL42525.1|216367_217561_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AVL42526.1|217562_218708_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	32.1	1.6e-23
>prophage 18
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	222332	223310	1675227		Planktothrix_phage(100.0%)	1	NA	NA
AVL42531.1|222332_223310_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.7e-31
>prophage 19
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	231594	232671	1675227		Mycobacterium_phage(100.0%)	1	NA	NA
AVL42541.1|231594_232671_-	peptide chain release factor 1	NA	A0A2I2MPK0	Mycobacterium_phage	41.7	6.2e-06
>prophage 20
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	237345	237849	1675227		Synechococcus_phage(100.0%)	1	NA	NA
AVL42545.1|237345_237849_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	54.3	3.9e-19
>prophage 21
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	250705	251437	1675227		Planktothrix_phage(100.0%)	1	NA	NA
AVL42557.1|250705_251437_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	4.8e-26
>prophage 22
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	260503	262381	1675227		Aureococcus_anophage(50.0%)	3	NA	NA
AVL43694.1|260503_261223_-	di-trans,poly-cis-decaprenylcistransferase	NA	A0A076FI83	Aureococcus_anophage	30.2	1.6e-18
AVL42565.1|261182_261896_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AVL42566.1|261943_262381_-	dUTP diphosphatase	NA	L7TM70	Rhizobium_phage	45.5	2.0e-27
>prophage 23
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	269745	270588	1675227		Synechococcus_phage(100.0%)	1	NA	NA
AVL42575.1|269745_270588_-	RNA polymerase sigma factor RpoD/SigA	NA	G8CLC7	Synechococcus_phage	28.6	4.8e-22
>prophage 24
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	273740	278249	1675227		Planktothrix_phage(50.0%)	4	NA	NA
AVL42579.1|273740_274472_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.6e-26
AVL42580.1|274653_275625_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42581.1|275621_276590_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42582.1|276827_278249_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	32.2	1.7e-59
>prophage 25
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	283087	285992	1675227		Hokovirus(33.33%)	3	NA	NA
AVL42589.1|283087_284143_-	hypothetical protein	NA	A0A1V0SFX9	Hokovirus	28.4	1.6e-06
AVL42590.1|284154_284856_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.7e-20
AVL42591.1|284948_285992_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	7.1e-23
>prophage 26
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	298055	298496	1675227		Clostridium_botulinum_D_phage(100.0%)	1	NA	NA
AVL42603.1|298055_298496_-	nucleoside 2-deoxyribosyltransferase	NA	Q2WG40	Clostridium_botulinum_D_phage	39.5	2.4e-20
>prophage 27
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	301538	305028	1675227		Sphingomonas_phage(66.67%)	3	NA	NA
AVL42607.1|301538_302540_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	H9NCD1	Sphingomonas_phage	65.6	4.0e-124
AVL42608.1|302554_304639_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	57.8	7.3e-237
AVL43696.1|304638_305028_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	H9NCC2	Sphingomonas_phage	41.0	6.9e-24
>prophage 28
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	316936	318940	1675227		Bacillus_phage(100.0%)	1	NA	NA
AVL42619.1|316936_318940_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.2	1.5e-77
>prophage 29
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	324550	325666	1675227		Enterococcus_phage(100.0%)	1	NA	NA
AVL42628.1|324550_325666_-	ribonuclease M5	NA	A0A0C5K935	Enterococcus_phage	33.0	4.6e-20
>prophage 30
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	331068	332373	1675227		Geobacillus_virus(100.0%)	1	NA	NA
AVL42636.1|331068_332373_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	48.2	2.9e-106
>prophage 31
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	335673	337194	1675227		Bacillus_virus(100.0%)	1	NA	NA
AVL42640.1|335673_337194_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.9e-16
>prophage 32
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	350120	366028	1675227		Vibrio_phage(28.57%)	11	NA	NA
AVL42653.1|350120_350654_-	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	39.2	4.7e-15
AVL42654.1|350894_351437_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42655.1|352365_353505_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	2.5e-37
AVL42656.1|353506_355306_-	DNA primase	NA	A0A1B0WMR3	Flavobacterium_phage	25.0	7.6e-33
AVL42657.1|355349_355535_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVL42658.1|355547_356093_-	guanylate kinase	NA	A0A1W6JK60	Lactococcus_phage	41.1	1.0e-17
AVL42659.1|356139_360111_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	28.2	9.8e-73
AVL42660.1|360140_363599_-	DNA-directed RNA polymerase subunit beta	NA	F2Y186	Organic_Lake_phycodnavirus	23.7	3.6e-39
AVL42661.1|363764_364130_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVL42662.1|364154_364649_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVL42663.1|365290_366028_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	7.0e-17
>prophage 33
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	369131	370385	1675227		Moraxella_phage(100.0%)	1	NA	NA
AVL43701.1|369131_370385_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	2.6e-40
>prophage 34
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	375879	377350	1675227		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVL42674.1|375879_376590_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	6.1e-18
AVL42675.1|376591_377350_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	4.2e-17
>prophage 35
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	381760	390442	1675227		Bacillus_phage(33.33%)	10	NA	NA
AVL42680.1|381760_383629_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	2.2e-35
AVL42681.1|383666_383855_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42682.1|384043_384355_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42683.1|384351_385074_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL43702.1|385087_385822_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL43703.1|385814_386732_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	4.9e-44
AVL42684.1|386753_386987_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL42685.1|387415_388432_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVL43704.1|388496_389237_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42686.1|389635_390442_+	XRE family transcriptional regulator	NA	A0A142LP08	Marinitoga_camini_virus	40.8	6.7e-05
>prophage 36
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	395559	408287	1675227	integrase,tRNA	Streptococcus_phage(16.67%)	12	400102:400118	420415:420431
AVL42691.1|395559_396186_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	34.0	1.3e-24
AVL42692.1|396194_397034_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AVL42693.1|397047_398400_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	41.1	1.6e-91
AVL42694.1|398411_399512_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVL42695.1|399508_400075_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42696.1|400084_400843_-	hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	32.5	2.8e-21
400102:400118	attL	TAGTAACATTTTCATCT	NA	NA	NA	NA
AVL42697.1|400949_402125_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AVL42698.1|402133_403033_-|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	33.2	4.7e-31
AVL42699.1|403041_405348_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.9	2.5e-97
AVL42700.1|405340_406150_-	hypothetical protein	NA	NA	NA	NA	NA
AVL42701.1|406155_406893_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVL42702.1|406904_408287_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.8	6.4e-88
420415:420431	attR	TAGTAACATTTTCATCT	NA	NA	NA	NA
>prophage 37
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	413845	414925	1675227		Bacillus_virus(100.0%)	1	NA	NA
AVL42703.1|413845_414925_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	7.8e-25
>prophage 38
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	420013	421033	1675227		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVL43705.1|420013_421033_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	1.8e-10
>prophage 39
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	428784	434519	1675227	tRNA	Klosneuvirus(50.0%)	4	NA	NA
AVL42714.1|428784_431382_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.8	1.6e-68
AVL42715.1|431383_431812_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVL42716.1|431863_433357_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL42717.1|433364_434519_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	53.4	1.1e-109
>prophage 40
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	445244	447857	1675227		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVL42730.1|445244_447857_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	28.5	1.3e-73
>prophage 41
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	450860	456775	1675227	tRNA	Wolbachia_phage(33.33%)	6	NA	NA
AVL42733.1|450860_451649_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	49.2	4.2e-68
AVL42734.1|451931_452192_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVL42735.1|452249_453074_-	TdeIII family type II restriction endonuclease	NA	NA	NA	NA	NA
AVL42736.1|453089_454127_-	DNA adenine methylase	NA	A0A0P0YN17	Yellowstone_lake_phycodnavirus	28.2	5.4e-23
AVL42737.1|454167_454854_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AVL43708.1|454873_456775_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	39.5	5.1e-128
>prophage 42
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	464192	466159	1675227		Mycoplasma_phage(50.0%)	2	NA	NA
AVL42742.1|464192_465056_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.4	2.5e-05
AVL42743.1|465055_466159_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	1.5e-34
>prophage 43
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	476420	481217	1675227	tRNA	Klosneuvirus(25.0%)	6	NA	NA
AVL42750.1|476420_476951_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.1	4.0e-30
AVL42751.1|476959_478174_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AVL43711.1|478251_479097_-	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.0	1.8e-37
AVL42752.1|479101_479770_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AVL42753.1|479780_480707_-|tRNA	methionyl-tRNA formyltransferase	tRNA	Q58MV3	Prochlorococcus_phage	41.2	1.6e-10
AVL42754.1|480716_481217_-	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	36.4	4.1e-21
>prophage 44
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	489853	490564	1675227		Staphylococcus_phage(100.0%)	1	NA	NA
AVL42761.1|489853_490564_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	5.5e-19
>prophage 45
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	500119	502478	1675227	integrase	Bacillus_phage(50.0%)	2	486257:486272	501777:501792
486257:486272	attL	TATTTGTATTCTTTCT	NA	NA	NA	NA
AVL42766.1|500119_500983_-|integrase	integrase	integrase	A0A1D6X8B0	Bacillus_phage	26.9	1.1e-16
AVL42767.1|500999_502478_-	DUF229 domain-containing protein	NA	A0A2K9L727	Tupanvirus	20.9	1.2e-12
501777:501792	attR	TATTTGTATTCTTTCT	NA	NA	NA	NA
>prophage 46
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	507925	513160	1675227	tRNA	Indivirus(50.0%)	3	NA	NA
AVL42771.1|507925_509506_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	34.9	1.7e-23
AVL42772.1|509627_510500_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVL42773.1|510562_513160_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.7e-180
>prophage 47
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	522011	531588	1675227	tRNA	Emiliania_huxleyi_virus(25.0%)	5	NA	NA
AVL42786.1|522011_522611_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	44.8	5.6e-33
AVL42787.1|522690_524409_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	31.4	1.7e-66
AVL42788.1|524474_528872_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.2	3.0e-30
AVL42789.1|528871_530302_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
AVL42790.1|530301_531588_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.1	1.6e-80
>prophage 48
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	539154	540135	1675227		Tupanvirus(100.0%)	1	NA	NA
AVL42798.1|539154_540135_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.6	1.6e-56
>prophage 49
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	543537	548101	1675227		Staphylococcus_phage(50.0%)	4	NA	NA
AVL42801.1|543537_545034_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.1e-19
AVL42802.1|545093_546092_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
AVL42803.1|546138_547308_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AVL42804.1|547456_548101_-	uridine kinase	NA	A0A167RCH2	Powai_lake_megavirus	43.4	1.4e-37
>prophage 50
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	554376	555069	1675227		Bacillus_virus(100.0%)	1	NA	NA
AVL42812.1|554376_555069_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.1	3.4e-13
>prophage 51
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	580681	584784	1675227		Tetraselmis_virus(50.0%)	3	NA	NA
AVL42826.1|580681_581425_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.1e-20
AVL42827.1|581601_583593_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AVL42828.1|583662_584784_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.0	2.2e-22
>prophage 52
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	589852	590866	1675227		Agrobacterium_phage(100.0%)	1	NA	NA
AVL42833.1|589852_590866_-	adenine methyltransferase	NA	A0A2L0UZL7	Agrobacterium_phage	32.6	2.1e-27
>prophage 53
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	594317	594986	1675227		Planktothrix_phage(100.0%)	1	NA	NA
AVL42838.1|594317_594986_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	4.2e-21
>prophage 54
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	598110	599175	1675227		Planktothrix_phage(100.0%)	1	NA	NA
AVL42841.1|598110_599175_+	polyamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	5.5e-23
>prophage 55
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	606355	606919	1675227		Lactococcus_phage(100.0%)	1	NA	NA
AVL42845.1|606355_606919_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	28.2	3.3e-11
>prophage 56
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	612168	613785	1675227		Vibrio_phage(100.0%)	1	NA	NA
AVL42854.1|612168_613785_+	PTS sugar transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	43.8	6.0e-05
>prophage 57
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	618470	620098	1675227		Bacillus_phage(50.0%)	2	NA	NA
AVL42860.1|618470_618881_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	38.3	4.9e-12
AVL42861.1|618997_620098_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	1.7e-19
>prophage 58
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	644034	646674	1675227	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AVL42883.1|644034_646674_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.5	2.3e-163
>prophage 59
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	650362	651355	1675227		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVL42889.1|650362_651355_+	lactate dehydrogenase	NA	M1H214	Paramecium_bursaria_Chlorella_virus	36.4	1.6e-45
>prophage 60
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	662720	666760	1675227	transposase	Pithovirus(50.0%)	6	NA	NA
AVL42892.1|662720_663431_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.1	9.1e-14
AVL42893.1|663440_664361_-	manganese transporter	NA	NA	NA	NA	NA
AVL42894.1|664646_665093_+	hypothetical protein	NA	NA	NA	NA	NA
AVL42895.1|665150_665489_+	hypothetical protein	NA	NA	NA	NA	NA
AVL42896.1|665607_666177_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVL42897.1|666319_666760_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	43.4	2.7e-24
>prophage 61
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	674903	675692	1675227		Aureococcus_anophage(100.0%)	1	NA	NA
AVL42908.1|674903_675692_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	29.3	3.2e-12
>prophage 62
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	691253	702354	1675227		Aureococcus_anophage(33.33%)	5	NA	NA
AVL42923.1|691253_692438_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.2	2.3e-33
AVL42924.1|692459_694535_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.5	5.5e-67
AVL42925.1|694549_695020_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVL42926.1|695051_695423_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVL43723.1|695811_702354_-	hypothetical protein	NA	Q9LA54	Enterobacteria_phage	21.9	4.2e-20
>prophage 63
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	750775	751762	1675227		Thermus_virus(100.0%)	1	NA	NA
AVL42939.1|750775_751762_-	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	35.5	1.8e-44
>prophage 64
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	755475	759234	1675227		Enterobacterial_phage(100.0%)	1	NA	NA
AVL42945.1|755475_759234_+	peptidase S6	NA	Q9LA58	Enterobacterial_phage	23.6	8.8e-23
>prophage 65
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	773874	774819	1675227		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVL42960.1|773874_774819_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	28.9	5.4e-14
>prophage 66
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	784432	785836	1675227		Tupanvirus(100.0%)	1	NA	NA
AVL42970.1|784432_785836_-	sulfatase	NA	A0A2K9L1A5	Tupanvirus	26.4	1.6e-14
>prophage 67
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	793243	795959	1675227		Planktothrix_phage(50.0%)	3	NA	NA
AVL42976.1|793243_794344_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	1.7e-19
AVL42977.1|794354_795191_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
AVL43726.1|795209_795959_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	W8CYX9	Bacillus_phage	35.6	1.9e-06
>prophage 68
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	806166	806883	1675227		Escherichia_phage(100.0%)	1	NA	NA
AVL42985.1|806166_806883_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.5	4.3e-19
>prophage 69
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	809905	811660	1675227		Salmonella_virus(100.0%)	1	NA	NA
AVL42990.1|809905_811660_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	30.2	3.7e-32
>prophage 70
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	820500	820710	1675227		Staphylococcus_phage(100.0%)	1	NA	NA
AVL42998.1|820500_820710_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	62.1	1.4e-18
>prophage 71
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	824549	825659	1675227		Mycobacterium_phage(100.0%)	1	NA	NA
AVL43004.1|824549_825659_-	site-specific DNA-methyltransferase	NA	A0A222ZMD5	Mycobacterium_phage	29.5	1.2e-31
>prophage 72
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	834033	836685	1675227		Lactococcus_phage(100.0%)	1	NA	NA
AVL43011.1|834033_836685_+	single-stranded-DNA-specific exonuclease RecJ	NA	M1IDD9	Lactococcus_phage	25.0	2.1e-39
>prophage 73
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	848805	858632	1675227		Planktothrix_phage(40.0%)	9	NA	NA
AVL43018.1|848805_850374_-	hypothetical protein	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	6.7e-17
AVL43019.1|850398_851997_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL43020.1|852009_852921_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	6.8e-22
AVL43021.1|852907_854029_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	9.3e-13
AVL43022.1|854032_854998_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL43023.1|854997_855972_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL43024.1|856151_856715_-	N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	28.0	1.9e-06
AVL43025.1|857029_857515_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43026.1|857642_858632_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	47.3	1.1e-68
>prophage 74
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	866018	876203	1675227		Synechococcus_phage(28.57%)	8	NA	NA
AVL43032.1|866018_867524_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	45.5	1.5e-61
AVL43033.1|867520_868069_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.2	1.6e-18
AVL43034.1|868056_869058_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.1	1.8e-68
AVL43035.1|869079_870447_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.4	4.0e-50
AVL43036.1|870469_871183_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.3	4.4e-40
AVL43037.1|871201_871999_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43038.1|872001_872481_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	5.5e-31
AVL43039.1|872492_876203_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.6	4.3e-30
>prophage 75
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	881651	883247	1675227		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVL43045.1|881651_883247_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.3	6.3e-140
>prophage 76
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	895781	899680	1675227	tRNA	Tupanvirus(33.33%)	3	NA	NA
AVL43060.1|895781_897665_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.6	1.8e-56
AVL43061.1|897701_898403_-	glycoside hydrolase	NA	A0A1U9WQS3	Geobacillus_phage	26.0	5.3e-14
AVL43062.1|898411_899680_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	5.4e-102
>prophage 77
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	904047	904758	1675227		Bodo_saltans_virus(100.0%)	1	NA	NA
AVL43068.1|904047_904758_-	ABC transporter	NA	A0A2H4UUX5	Bodo_saltans_virus	24.8	3.5e-05
>prophage 78
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	909715	912262	1675227		Pyramimonas_orientalis_virus(100.0%)	1	NA	NA
AVL43074.1|909715_912262_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	24.2	4.5e-39
>prophage 79
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	919427	920753	1675227		Bacillus_phage(100.0%)	1	NA	NA
AVL43080.1|919427_920753_-	chromosomal replication initiator protein DnaA	NA	A0A1B1P8D0	Bacillus_phage	26.3	3.8e-05
>prophage 80
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	924451	925900	1675227		Mycoplasma_phage(100.0%)	1	NA	NA
AVL43083.1|924451_925900_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.8	5.7e-55
>prophage 81
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	930148	932135	1675227		Bacillus_phage(100.0%)	2	NA	NA
AVL43090.1|930148_931483_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	3.4e-22
AVL43091.1|931457_932135_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.5	2.4e-32
>prophage 82
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	952295	963586	1675227		Faecalibacterium_phage(20.0%)	12	NA	NA
AVL43100.1|952295_952700_+	single-stranded DNA-binding protein	NA	A0A2K9V3K2	Faecalibacterium_phage	42.2	7.4e-21
AVL43101.1|952716_952950_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AVL43102.1|953133_955101_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43103.1|955303_955546_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AVL43104.1|955681_956806_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.7	4.9e-30
AVL43105.1|956818_959989_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	29.0	1.1e-111
AVL43106.1|959985_960411_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AVL43107.1|960403_960994_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43108.1|961007_961409_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AVL43109.1|961538_962135_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43110.1|962165_962789_-	nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	1.5e-15
AVL43111.1|962788_963586_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	8.4e-08
>prophage 83
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	974707	987349	1675227		Catovirus(50.0%)	7	NA	NA
AVL43122.1|974707_978787_+	restriction endonuclease	NA	A0A1V0SEE0	Indivirus	23.3	4.0e-29
AVL43123.1|978885_979932_+	hypothetical protein	NA	A0A1V0SF57	Hokovirus	31.8	7.1e-23
AVL43124.1|980017_980548_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43732.1|980639_980966_+	DNA-binding protein	NA	NA	NA	NA	NA
AVL43125.1|980965_982297_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVL43126.1|982334_984815_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	27.7	5.8e-31
AVL43127.1|984859_987349_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.4	1.8e-32
>prophage 84
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	992072	994965	1675227		Pandoravirus(33.33%)	3	NA	NA
AVL43134.1|992072_992639_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	30.4	1.8e-12
AVL43135.1|992625_993603_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.5	1.7e-42
AVL43136.1|993624_994965_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	35.9	3.4e-38
>prophage 85
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1002319	1008194	1675227		Vibrio_phage(33.33%)	4	NA	NA
AVL43139.1|1002319_1003978_+	signal peptide peptidase SppA	NA	W6ATY3	Vibrio_phage	22.1	1.1e-12
AVL43140.1|1003998_1004919_+	cation transporter	NA	A0A1V0SED0	Indivirus	29.2	3.8e-20
AVL43141.1|1005182_1007243_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43142.1|1007324_1008194_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.2	3.4e-10
>prophage 86
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1016448	1021428	1675227		Erysipelothrix_phage(66.67%)	3	NA	NA
AVL43150.1|1016448_1017987_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	38.0	1.4e-27
AVL43151.1|1018687_1018897_+	XRE family transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	40.6	8.9e-10
AVL43152.1|1019841_1021428_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.3	1.9e-48
>prophage 87
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1041557	1042547	1675227		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVL43164.1|1041557_1042547_+	steryl acetyl hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	29.3	6.3e-13
>prophage 88
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1046663	1049782	1675227		Klosneuvirus(50.0%)	2	NA	NA
AVL43169.1|1046663_1048238_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	28.9	3.8e-20
AVL43170.1|1048234_1049782_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	29.0	3.3e-16
>prophage 89
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1060525	1061242	1675227		Planktothrix_phage(100.0%)	1	NA	NA
AVL43177.1|1060525_1061242_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	8.3e-31
>prophage 90
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1066990	1096124	1675227	tRNA	Acanthamoeba_polyphaga_mimivirus(16.67%)	25	NA	NA
AVL43182.1|1066990_1067800_+	transketolase	NA	A0A2K9L6P9	Tupanvirus	34.8	6.9e-34
AVL43183.1|1067809_1068730_+	transketolase	NA	NA	NA	NA	NA
AVL43184.1|1068740_1069691_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43185.1|1069692_1070955_+	peptidase M23	NA	D7RWE0	Brochothrix_phage	39.4	4.6e-08
AVL43186.1|1070973_1072701_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.7	1.6e-133
AVL43187.1|1072708_1074193_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AVL43188.1|1074267_1075248_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	27.5	1.4e-17
AVL43189.1|1075274_1076264_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	27.9	2.6e-14
AVL43190.1|1077118_1078081_-	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
AVL43191.1|1078081_1079080_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	2.4e-60
AVL43192.1|1079184_1079745_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AVL43193.1|1079976_1082472_+	DUF87 domain-containing protein	NA	S5VNE3	Mycobacterium_phage	50.1	2.8e-86
AVL43194.1|1082486_1083545_+	rod shape-determining protein	NA	NA	NA	NA	NA
AVL43195.1|1083553_1084087_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.0	1.4e-14
AVL43196.1|1084073_1084760_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVL43735.1|1084890_1085346_+	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	55.3	8.9e-39
AVL43197.1|1085569_1085977_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43198.1|1085951_1087043_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43199.1|1087064_1087595_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AVL43200.1|1088096_1090613_+	type VI secretion system ATPase TssH	NA	A0A1L2CUT6	Pectobacterium_phage	35.3	2.2e-118
AVL43201.1|1090673_1091705_+	heat-inducible transcription repressor HrcA	NA	NA	NA	NA	NA
AVL43202.1|1091713_1092259_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVL43203.1|1092271_1094080_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.0e-137
AVL43204.1|1094121_1094988_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AVL43205.1|1094987_1096124_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	32.5	1.0e-22
>prophage 91
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1124785	1126051	1675227		Bacillus_phage(100.0%)	1	NA	NA
AVL43227.1|1124785_1126051_+	DNA repair protein	NA	O64031	Bacillus_phage	31.0	1.3e-42
>prophage 92
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1144642	1145197	1675227	transposase	unidentified_phage(100.0%)	1	NA	NA
AVL43241.1|1144642_1145197_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	35.2	2.8e-10
>prophage 93
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1149509	1153823	1675227		Vaccinia_virus(50.0%)	3	NA	NA
AVL43244.1|1149509_1151276_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	45.4	4.9e-133
AVL43245.1|1151301_1152747_+	glucuronide permease	NA	NA	NA	NA	NA
AVL43246.1|1152830_1153823_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.4	1.6e-11
>prophage 94
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1163087	1163441	1675227		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVL43258.1|1163087_1163441_-	hypothetical protein	NA	F2Y302	Organic_Lake_phycodnavirus	40.6	6.7e-10
>prophage 95
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1170868	1173959	1675227		Listeria_phage(66.67%)	4	NA	NA
AVL43266.1|1170868_1172176_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	37.7	9.0e-84
AVL43267.1|1172187_1172979_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVL43268.1|1173082_1173592_+	DUF4065 domain-containing protein	NA	A8ATC0	Listeria_phage	36.4	2.4e-16
AVL43269.1|1173506_1173959_+	hypothetical protein	NA	A8ATC1	Listeria_phage	34.5	1.7e-10
>prophage 96
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1190244	1198438	1675227	tRNA	Bacillus_virus(66.67%)	6	NA	NA
AVL43294.1|1190244_1192227_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.7	7.4e-138
AVL43295.1|1192237_1194850_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.3e-113
AVL43296.1|1194863_1195628_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVL43297.1|1195632_1196085_+	YfcE family phosphodiesterase	NA	NA	NA	NA	NA
AVL43298.1|1196081_1197410_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43299.1|1197421_1198438_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	41.1	1.7e-29
>prophage 97
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1205499	1210354	1675227		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVL43744.1|1205499_1206171_-	restriction endonuclease	NA	G9E547	Ostreococcus_lucimarinus_virus	33.5	3.3e-13
AVL43307.1|1207999_1210354_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	27.0	6.0e-70
>prophage 98
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1226181	1244258	1675227	transposase,protease,tRNA	Bacillus_phage(25.0%)	17	NA	NA
AVL43310.1|1226181_1227033_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	33.2	5.6e-34
AVL43311.1|1227428_1228583_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43312.1|1228748_1229345_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	49.2	1.1e-49
AVL43313.1|1229516_1230740_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVL43314.1|1230962_1233077_+	anaerobic ribonucleoside-triphosphate reductase	NA	K7NS24	Klebsiella_phage	39.8	3.5e-130
AVL43315.1|1233073_1233679_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A1L2CUK3	Pectobacterium_phage	47.4	3.0e-34
AVL43316.1|1233766_1234753_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43317.1|1234763_1235510_+	NADPH-dependent oxidoreductase	NA	A0A1V0E011	Clostridioides_phage	24.7	1.5e-06
AVL43318.1|1235487_1236357_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43319.1|1236356_1237340_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43320.1|1237351_1237753_+	NfeD family protein	NA	NA	NA	NA	NA
AVL43321.1|1237768_1238650_+	SPFH/Band 7/PHB domain protein	NA	M1PGF9	Moumouvirus	31.6	3.3e-21
AVL43322.1|1238653_1239301_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVL43323.1|1239313_1240381_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AVL43324.1|1240433_1240685_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43747.1|1240708_1242535_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	7.7e-49
AVL43325.1|1242527_1244258_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	1.2e-40
>prophage 99
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1254217	1262033	1675227		Bodo_saltans_virus(33.33%)	7	NA	NA
AVL43333.1|1254217_1255207_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	21.7	1.1e-14
AVL43334.1|1255213_1255648_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AVL43335.1|1255902_1258176_+	exo-alpha-sialidase	NA	Q9III6	Frog_adenovirus	28.7	1.4e-07
AVL43336.1|1258233_1258911_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL43337.1|1259077_1259515_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVL43338.1|1259629_1260463_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AVL43339.1|1260470_1262033_-	DUF814 domain-containing protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	37.4	5.6e-08
>prophage 100
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1266353	1270103	1675227	integrase	unidentified_phage(50.0%)	7	1261978:1261994	1274759:1274775
1261978:1261994	attL	TCTTCTTTTAATTCTTT	NA	NA	NA	NA
AVL43343.1|1266353_1267394_-|integrase	site-specific integrase	integrase	H7BVF7	unidentified_phage	23.1	7.6e-17
AVL43344.1|1267399_1267636_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43345.1|1267694_1268054_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVL43346.1|1268422_1268623_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43347.1|1268640_1268994_+	replication initiator RepA	NA	NA	NA	NA	NA
AVL43348.1|1269043_1269415_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43349.1|1269416_1270103_+	phage repressor protein	NA	A0A2D1GQG9	Lysinibacillus_phage	34.1	5.7e-21
1274759:1274775	attR	AAAGAATTAAAAGAAGA	NA	NA	NA	NA
>prophage 101
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1296171	1301732	1675227		Clostridioides_phage(33.33%)	6	NA	NA
AVL43379.1|1296171_1296687_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	47.1	6.8e-19
AVL43380.1|1296683_1297604_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
AVL43381.1|1297800_1298046_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43382.1|1298145_1299315_+	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	37.3	7.0e-11
AVL43383.1|1299329_1299695_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43384.1|1299728_1301732_+	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	1.5e-24
>prophage 102
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1324930	1332129	1675227		Amsacta_moorei_entomopoxvirus(33.33%)	7	NA	NA
AVL43400.1|1324930_1325797_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	28.6	5.5e-21
AVL43401.1|1325799_1326534_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL43402.1|1326582_1327464_-	EamA family transporter	NA	NA	NA	NA	NA
AVL43403.1|1327628_1328381_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-13
AVL43404.1|1328380_1329796_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVL43405.1|1329805_1330927_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVL43406.1|1330926_1332129_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	34.5	2.0e-77
>prophage 103
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1335942	1339047	1675227		Indivirus(100.0%)	1	NA	NA
AVL43411.1|1335942_1339047_+	DUF1611 domain-containing protein	NA	A0A1V0SE00	Indivirus	31.8	7.0e-18
>prophage 104
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1348898	1350701	1675227		Streptococcus_phage(100.0%)	1	NA	NA
AVL43423.1|1348898_1350701_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	27.0	1.1e-55
>prophage 105
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1356088	1360363	1675227		Bacillus_phage(33.33%)	4	NA	NA
AVL43424.1|1356088_1357135_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	57.2	5.0e-101
AVL43425.1|1357138_1357705_+	regulatory protein RecX	NA	NA	NA	NA	NA
AVL43426.1|1357701_1358283_+	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	A0A0N9Z738	Cassava_brown_streak_virus	33.2	5.7e-14
AVL43427.1|1358293_1360363_+	DNA helicase RecG	NA	E3T5E1	Cafeteria_roenbergensis_virus	23.8	9.8e-08
>prophage 106
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1372610	1381076	1675227		Bacillus_phage(25.0%)	7	NA	NA
AVL43437.1|1372610_1374332_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-22
AVL43438.1|1374321_1376043_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	31.2	5.8e-22
AVL43439.1|1376052_1376508_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVL43440.1|1376519_1379105_+	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	33.8	1.2e-44
AVL43441.1|1379132_1379792_+	HAD family hydrolase	NA	NA	NA	NA	NA
AVL43442.1|1379788_1380193_+	HD domain-containing protein	NA	NA	NA	NA	NA
AVL43443.1|1380179_1381076_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	1.0e-09
>prophage 107
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1385840	1388627	1675227	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVL43754.1|1385840_1388627_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.7	3.4e-88
>prophage 108
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1392606	1393581	1675227		uncultured_virus(100.0%)	1	NA	NA
AVL43755.1|1392606_1393581_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	1.3e-05
>prophage 109
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1409171	1409750	1675227		Streptococcus_phage(100.0%)	1	NA	NA
AVL43463.1|1409171_1409750_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	36.9	3.5e-24
>prophage 110
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1416092	1421462	1675227	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
AVL43468.1|1416092_1417268_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	28.3	1.4e-32
AVL43469.1|1417355_1417784_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AVL43470.1|1417793_1418465_+	thymidylate kinase	NA	R4ZGJ3	Mythimna_separata_entomopoxvirus	28.2	1.3e-09
AVL43471.1|1418461_1419706_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	24.6	4.8e-18
AVL43472.1|1419698_1421462_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	24.7	1.0e-13
>prophage 111
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1425302	1433133	1675227		Enterobacterial_phage(50.0%)	2	NA	NA
AVL43756.1|1425302_1429166_+	peptidase S6	NA	Q9LA58	Enterobacterial_phage	24.1	2.0e-22
AVL43473.1|1429287_1433133_+	peptidase S6	NA	Q9LA54	Enterobacteria_phage	21.1	1.5e-17
>prophage 112
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1442569	1445774	1675227		Lactococcus_phage(50.0%)	2	NA	NA
AVL43478.1|1442569_1443259_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	32.5	8.8e-06
AVL43479.1|1443536_1445774_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.9	4.2e-174
>prophage 113
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1450690	1451875	1675227		Aureococcus_anophage(100.0%)	1	NA	NA
AVL43483.1|1450690_1451875_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.2	2.3e-33
>prophage 114
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1464545	1466348	1675227		Wolbachia_phage(100.0%)	1	NA	NA
AVL43496.1|1464545_1466348_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	1.6e-59
>prophage 115
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1470336	1471827	1675227	tRNA	Catovirus(100.0%)	1	NA	NA
AVL43500.1|1470336_1471827_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.7	4.6e-92
>prophage 116
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1484169	1486732	1675227		Streptococcus_phage(50.0%)	2	NA	NA
AVL43514.1|1484169_1485228_-	hypothetical protein	NA	M1PS09	Streptococcus_phage	22.6	2.0e-09
AVL43515.1|1485517_1486732_+	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	35.4	2.3e-09
>prophage 117
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1490042	1494175	1675227		Bacillus_phage(50.0%)	2	NA	NA
AVL43759.1|1490042_1490624_+	glycoside hydrolase	NA	A0A0A0RVE6	Bacillus_phage	34.3	4.4e-06
AVL43519.1|1492195_1494175_+	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	23.9	2.1e-36
>prophage 118
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1514415	1516753	1675227	tRNA	Bacillus_phage(50.0%)	2	NA	NA
AVL43539.1|1514415_1514886_+	dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	41.9	2.9e-24
AVL43540.1|1514878_1516753_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	34.5	6.0e-97
>prophage 119
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1519831	1523030	1675227		Bacillus_virus(50.0%)	4	NA	NA
AVL43544.1|1519831_1520434_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.3	2.0e-09
AVL43545.1|1520441_1521386_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AVL43546.1|1521387_1521669_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43547.1|1521758_1523030_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.1	4.5e-56
>prophage 120
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1531097	1531715	1675227		Bacillus_virus(100.0%)	1	NA	NA
AVL43553.1|1531097_1531715_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	34.0	7.1e-23
>prophage 121
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1537818	1544583	1675227		Streptococcus_phage(33.33%)	5	NA	NA
AVL43559.1|1537818_1539117_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.2	3.4e-160
AVL43560.1|1539155_1540025_-	DUF4300 domain-containing protein	NA	NA	NA	NA	NA
AVL43561.1|1540026_1540587_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43562.1|1540586_1542794_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	39.8	7.2e-118
AVL43563.1|1542807_1544583_-	signal peptide peptidase SppA	NA	A0A0K2CMR9	Citrobacter_phage	24.9	3.2e-15
>prophage 122
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1549383	1550082	1675227		Streptococcus_phage(100.0%)	1	NA	NA
AVL43764.1|1549383_1550082_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	43.3	5.4e-35
>prophage 123
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1561214	1569018	1675227		Wood_mouse_herpesvirus(16.67%)	7	NA	NA
AVL43766.1|1561214_1561979_+	uracil-DNA glycosylase	NA	D0PPD4	Wood_mouse_herpesvirus	31.4	1.4e-15
AVL43574.1|1561981_1563442_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.2	1.9e-98
AVL43575.1|1563449_1565477_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.4	4.6e-111
AVL43576.1|1565477_1566491_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	44.0	1.3e-69
AVL43577.1|1566539_1566944_+	transcriptional repressor	NA	NA	NA	NA	NA
AVL43578.1|1567054_1568071_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	3.0e-18
AVL43579.1|1568070_1569018_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.3e-15
>prophage 124
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1578511	1587366	1675227		Planktothrix_phage(28.57%)	11	NA	NA
AVL43588.1|1578511_1579540_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.2	5.0e-29
AVL43589.1|1579536_1580094_+	CvpA family protein	NA	NA	NA	NA	NA
AVL43590.1|1580097_1581315_+	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	28.8	2.2e-28
AVL43591.1|1581307_1582423_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AVL43592.1|1582412_1583255_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.4	6.3e-06
AVL43593.1|1583340_1583538_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	60.0	3.0e-15
AVL43594.1|1583613_1584546_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL43595.1|1584535_1585318_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL43596.1|1585298_1586009_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	1.6e-10
AVL43597.1|1585995_1586676_+	hypothetical protein	NA	G9BWD6	Planktothrix_phage	29.8	1.8e-11
AVL43598.1|1586736_1587366_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	31.2	9.8e-12
>prophage 125
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1590676	1592846	1675227		Streptococcus_phage(33.33%)	3	NA	NA
AVL43601.1|1590676_1591021_+	glutaredoxin	NA	M1PLC0	Streptococcus_phage	43.4	1.2e-16
AVL43602.1|1591029_1592358_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	36.6	6.6e-42
AVL43603.1|1592366_1592846_+	cytidine deaminase	NA	A0A2R8FFD0	Brazilian_cedratvirus	55.3	9.7e-44
>prophage 126
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1597726	1605166	1675227	integrase	Halovirus(25.0%)	12	1593926:1593943	1611279:1611296
1593926:1593943	attL	AATGAAAATATAGAAATA	NA	NA	NA	NA
AVL43606.1|1597726_1598434_+	hypothetical protein	NA	R4TNY5	Halovirus	29.7	5.9e-13
AVL43607.1|1598452_1599307_+	YitT family protein	NA	NA	NA	NA	NA
AVL43608.1|1599421_1599772_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVL43609.1|1599918_1600980_-|integrase	site-specific integrase	integrase	H7BVE3	unidentified_phage	28.7	7.4e-28
AVL43610.1|1600954_1601248_-	hypothetical protein	NA	NA	NA	NA	NA
AVL43611.1|1601265_1601658_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVL43612.1|1602215_1602563_-	XRE family transcriptional regulator	NA	A0A0A8WEL4	Clostridium_phage	50.7	1.7e-10
AVL43613.1|1603041_1603392_+	replication initiator RepA	NA	NA	NA	NA	NA
AVL43614.1|1603671_1603905_+	DUF739 domain-containing protein	NA	NA	NA	NA	NA
AVL43615.1|1603894_1604080_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43616.1|1604100_1604484_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43617.1|1604485_1605166_+	phage repressor protein	NA	A0A2D1GQG9	Lysinibacillus_phage	36.0	5.1e-22
1611279:1611296	attR	AATGAAAATATAGAAATA	NA	NA	NA	NA
>prophage 127
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1631136	1637716	1675227	integrase	Clostridium_phage(33.33%)	7	1634064:1634089	1639958:1639983
AVL43644.1|1631136_1631664_+	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	45.2	1.2e-18
AVL43770.1|1631670_1632600_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43645.1|1632898_1633207_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43646.1|1633470_1633656_+	hypothetical protein	NA	NA	NA	NA	NA
AVL43647.1|1633723_1634089_+	hypothetical protein	NA	NA	NA	NA	NA
1634064:1634089	attL	TTCACTCTATGTTTAATATAGAGTGA	NA	NA	NA	NA
AVL43648.1|1634122_1636114_+	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.7	2.0e-26
AVL43649.1|1636654_1637716_-|integrase	site-specific integrase	integrase	H7BVE3	unidentified_phage	27.6	8.2e-27
1639958:1639983	attR	TTCACTCTATGTTTAATATAGAGTGA	NA	NA	NA	NA
>prophage 128
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1649259	1650993	1675227		unidentified_phage(100.0%)	1	NA	NA
AVL43658.1|1649259_1650993_+	NUDIX domain-containing protein	NA	H7BUW3	unidentified_phage	27.3	9.3e-20
>prophage 129
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1660870	1662472	1675227		uncultured_virus(100.0%)	1	NA	NA
AVL43670.1|1660870_1662472_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	7.0e-155
>prophage 130
CP027400	Streptobacillus moniliformis strain FDAARGOS_310 chromosome, complete genome	1675227	1667411	1669009	1675227		Planktothrix_phage(50.0%)	3	NA	NA
AVL43679.1|1667411_1668071_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	8.1e-33
AVL43680.1|1668134_1668443_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVL43681.1|1668571_1669009_+	DNA starvation/stationary phase protection protein	NA	A0A222YTY5	Streptomyces_phage	32.8	1.6e-05
