The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	151875	167524	4960650	protease,tail,plate	Enterobacterial_phage(16.67%)	21	NA	NA
AVL34269.1|151875_152820_-|protease	protease	protease	NA	NA	NA	NA
AVL34270.1|152987_153230_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	1.7e-25
AVL34271.1|153479_154202_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	51.1	6.3e-63
AVL34272.1|154158_154413_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34273.1|154466_154946_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	61.6	1.6e-38
AVL34274.1|155208_155487_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	47.2	1.6e-14
AVL34275.1|155488_156004_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	58.4	1.9e-53
AVL34276.1|156000_156330_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVL34277.1|156638_157169_+	ATP-binding protein	NA	NA	NA	NA	NA
AVL34278.1|157173_157338_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AVL34279.1|157364_158873_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	45.8	3.9e-107
AVL34280.1|158914_159283_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVL34281.1|159284_159584_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVL34282.1|159704_161051_+	chemotaxis protein	NA	NA	NA	NA	NA
AVL34283.1|161154_162561_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	32.8	5.4e-18
AVL34284.1|162557_163628_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	29.8	2.5e-39
AVL34285.1|163643_164237_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AVL34286.1|164236_164674_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.9e-18
AVL34287.1|164677_165814_+|plate	phage baseplate protein	plate	B5TK75	Pseudomonas_phage	30.5	7.7e-31
AVL34288.1|165810_166407_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.8	6.2e-32
AVL34289.1|166456_167524_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	48.4	1.6e-46
>prophage 2
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	597117	610855	4960650	tRNA,integrase	Pectobacterium_phage(53.33%)	22	593205:593219	604286:604300
593205:593219	attL	TTTTGCTCTGGCCTT	NA	NA	NA	NA
AVL34627.1|597117_598200_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	9.4e-103
AVL34628.1|598174_598441_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	1.1e-09
AVL34629.1|598513_599026_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	45.9	7.4e-34
AVL34630.1|599022_601179_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.9	1.6e-98
AVL34631.1|601192_601465_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34632.1|601605_601836_-	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	43.7	1.6e-12
AVL34633.1|602053_602389_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34634.1|602615_602852_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34635.1|602973_603198_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34636.1|603372_603765_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.4	1.0e-30
AVL34637.1|603846_604044_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	49.2	7.1e-09
AVL34638.1|604084_604525_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	53.1	1.9e-33
604286:604300	attR	AAGGCCAGAGCAAAA	NA	NA	NA	NA
AVL34639.1|604538_604790_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AVL34640.1|604782_604971_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34641.1|604983_606018_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	55.3	1.5e-41
AVL38219.1|606046_606454_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	47.2	1.2e-31
AVL34642.1|606468_606969_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	44.5	3.9e-19
AVL34643.1|606965_609131_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.4	1.9e-216
AVL34644.1|609277_609460_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34645.1|609534_610128_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	56.6	2.0e-59
AVL34646.1|610136_610421_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	78.7	6.1e-38
AVL38220.1|610429_610855_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	62.5	2.4e-38
>prophage 3
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	614550	638990	4960650	terminase,tail,head	Cronobacter_phage(55.0%)	27	NA	NA
AVL34651.1|614550_614868_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	62.1	9.3e-27
AVL34652.1|614851_615358_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.1	3.4e-47
AVL34653.1|615342_615678_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVL34654.1|615953_616274_-	hypothetical protein	NA	NA	NA	NA	NA
AVL34655.1|616566_616893_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34656.1|617061_617664_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.0	4.0e-71
AVL34657.1|617663_619145_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.0	1.1e-250
AVL38221.1|619189_620632_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.3	2.6e-132
AVL34658.1|620633_621533_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	59.7	2.2e-97
AVL34659.1|621569_622313_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34660.1|622364_623714_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	9.8e-126
AVL34661.1|623714_624143_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34662.1|624153_625236_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	43.8	4.4e-76
AVL34663.1|625246_625531_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34664.1|625533_625914_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	49.6	7.2e-26
AVL34665.1|625913_626225_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34666.1|626221_626572_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.4	1.8e-26
AVL34667.1|626573_626942_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.0	7.7e-41
AVL34668.1|626938_627322_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	68.5	5.7e-47
AVL34669.1|627346_628096_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	48.8	4.0e-52
AVL34670.1|628235_628925_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	50.9	3.0e-54
AVL34671.1|628917_632670_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.9	2.2e-159
AVL34672.1|632666_633140_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	53.9	1.6e-46
AVL34673.1|633139_633610_+	DUF1833 domain-containing protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
AVL34674.1|633645_634038_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	43.5	1.2e-28
AVL34675.1|634024_636520_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	49.1	4.4e-220
AVL34676.1|636578_638990_+	hypothetical protein	NA	A0A291AXF7	Shigella_phage	43.6	2.2e-43
>prophage 4
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	721004	732334	4960650	tRNA	Anomala_cuprea_entomopoxvirus(16.67%)	10	NA	NA
AVL34751.1|721004_722531_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	6.3e-12
AVL34752.1|722865_723678_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVL34753.1|723821_724535_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AVL34754.1|724646_724859_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	43.5	3.4e-09
AVL34755.1|725311_727240_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
AVL34756.1|727243_727795_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
AVL34757.1|727890_728088_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVL34758.1|728125_728482_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVL34759.1|728949_729933_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	3.8e-34
AVL34760.1|729946_732334_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	4.3e-07
>prophage 5
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	1277170	1314105	4960650	head,portal,integrase,capsid,plate,tail,holin	Escherichia_phage(38.24%)	47	1277326:1277376	1314273:1314323
AVL38261.1|1277170_1277320_+|integrase	integrase	integrase	F1C5B2	Cronobacter_phage	73.0	6.3e-10
1277326:1277376	attL	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
AVL35206.1|1277594_1278206_+	protein cII	NA	NA	NA	NA	NA
AVL35207.1|1278200_1279238_-	beta family protein	NA	NA	NA	NA	NA
AVL35208.1|1279237_1279780_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AVL38262.1|1279780_1280281_-	transmembrane HD family hydrolase	NA	NA	NA	NA	NA
AVL35209.1|1280714_1281725_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	61.3	1.1e-116
AVL35210.1|1281734_1282322_-	transcriptional regulator	NA	A0A1S6KZZ7	Salmonella_phage	35.3	9.5e-25
AVL38263.1|1282521_1282701_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35211.1|1282728_1283250_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	38.3	2.3e-22
AVL35212.1|1283250_1283709_-	hypothetical protein	NA	NA	NA	NA	NA
AVL38264.1|1284125_1284593_+	replication protein B	NA	M1SV55	Escherichia_phage	53.9	2.1e-43
AVL38265.1|1284660_1284912_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AVL35213.1|1284923_1285142_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	53.5	1.1e-13
AVL35214.1|1285138_1287409_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	60.2	1.1e-265
AVL35215.1|1287521_1287716_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35216.1|1288171_1289041_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVL35217.1|1289358_1289613_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AVL35218.1|1289609_1289951_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVL35219.1|1290689_1293716_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
AVL35220.1|1293794_1294814_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.1	9.3e-153
AVL35221.1|1294813_1296577_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	80.4	3.2e-286
AVL35222.1|1296719_1297541_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	61.1	2.5e-92
AVL35223.1|1297562_1298630_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.8	9.8e-145
AVL35224.1|1298633_1299290_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	67.6	6.8e-72
AVL35225.1|1299379_1299886_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	78.7	2.6e-71
AVL35226.1|1299885_1300089_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	8.0e-24
AVL35227.1|1300079_1300301_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	6.0e-25
AVL35228.1|1300284_1300794_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	80.2	9.6e-74
AVL35229.1|1300790_1301216_+	protein lysB	NA	O80310	Escherichia_phage	65.2	2.4e-38
AVL35230.1|1301103_1301349_+|holin	holin	holin	S4TNY4	Salmonella_phage	78.2	3.2e-27
AVL35231.1|1301311_1301779_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	78.7	7.2e-68
AVL35232.1|1301771_1302218_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.2	2.5e-49
AVL35233.1|1302251_1302917_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35234.1|1303034_1303670_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	81.5	1.2e-94
AVL35235.1|1303666_1304014_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	73.0	1.7e-42
AVL35236.1|1304018_1304927_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.8	1.0e-134
AVL35237.1|1304919_1305525_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.9	2.0e-86
AVL35238.1|1305529_1306804_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	44.7	4.6e-101
AVL35239.1|1306806_1307385_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	44.5	4.4e-43
AVL35240.1|1307514_1308705_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	89.4	1.2e-207
AVL35241.1|1308717_1309236_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	92.4	2.2e-89
AVL35242.1|1309296_1309578_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	84.1	2.6e-33
AVL35243.1|1309610_1309730_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
AVL35244.1|1309722_1312167_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	69.0	4.2e-268
AVL35245.1|1312181_1312661_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.9	1.9e-71
AVL35246.1|1312660_1313821_+	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	78.8	2.9e-166
AVL35247.1|1313904_1314105_+	late control protein B	NA	E5G6Q4	Salmonella_phage	63.9	1.6e-16
1314273:1314323	attR	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
>prophage 6
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	1926930	2039393	4960650	head,lysis,terminase,portal,integrase,transposase,capsid,plate,tail,holin	Salmonella_phage(18.99%)	134	1991638:1991683	2039425:2039470
AVL35756.1|1926930_1927167_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
AVL35757.1|1927590_1927980_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35758.1|1928396_1928702_+|holin	holin	holin	NA	NA	NA	NA
AVL35759.1|1928703_1929093_+	peptidase M15	NA	A0A2I6PFM8	Proteus_phage	54.9	2.3e-35
AVL35760.1|1929089_1929428_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35761.1|1929990_1930401_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35762.1|1930614_1931865_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35763.1|1931939_1933220_+	thermolabile hemolysin	NA	NA	NA	NA	NA
AVL35764.1|1933526_1934453_-	transcriptional regulator MelR	NA	NA	NA	NA	NA
AVL35765.1|1934723_1936073_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
AVL35766.1|1936162_1937584_+	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
AVL35767.1|1937586_1937841_+	hypothetical protein	NA	NA	NA	NA	NA
AVL38298.1|1938237_1939791_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AVL35768.1|1939762_1940632_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AVL35769.1|1941258_1943547_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.3	4.2e-60
AVL35770.1|1943888_1944413_+|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	65.7	1.0e-62
AVL35771.1|1945680_1946010_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35772.1|1946376_1947297_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35773.1|1947671_1948328_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35774.1|1948328_1948577_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35775.1|1950532_1950988_+	hypothetical protein	NA	G9L674	Escherichia_phage	66.0	1.1e-47
AVL35776.1|1950989_1952021_+	serine/threonine protein kinase	NA	D2X3B9	Enterobacteria_phage	48.9	2.4e-84
AVL38299.1|1952222_1952432_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
AVL35777.1|1952532_1953168_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	6.0e-33
AVL38300.1|1953167_1954307_-	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	46.2	3.1e-32
AVL35778.1|1954752_1955349_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	40.1	3.0e-34
AVL35779.1|1955345_1956482_-|plate	phage baseplate protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
AVL35780.1|1956485_1956923_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	2.0e-19
AVL35781.1|1956919_1957513_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	35.2	2.0e-06
AVL35782.1|1957509_1958583_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.3	5.0e-40
AVL35783.1|1958579_1959986_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	28.3	3.0e-24
AVL35784.1|1960043_1961846_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
AVL35785.1|1961963_1962266_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVL35786.1|1962267_1962642_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVL35787.1|1962654_1964145_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.3	6.0e-100
AVL35788.1|1964144_1964336_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AVL35789.1|1964340_1964886_-	ATP-binding protein	NA	NA	NA	NA	NA
AVL35790.1|1964882_1965227_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35791.1|1965226_1965634_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35792.1|1965635_1966682_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.8	1.4e-39
AVL35793.1|1966791_1967193_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.2	8.2e-12
AVL35794.1|1967192_1967777_-	DNA primase	NA	NA	NA	NA	NA
AVL35795.1|1967776_1968634_-	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	39.5	3.0e-51
AVL35796.1|1968630_1970199_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	7.0e-99
AVL35797.1|1970267_1970531_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVL35798.1|1970539_1972519_-|terminase	terminase	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
AVL35799.1|1972487_1973099_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AVL35800.1|1973210_1973735_-	Fis family transcriptional regulator	NA	A0A1W6DY33	Salmonella_phage	48.8	1.7e-33
AVL35801.1|1973811_1974456_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	30.9	2.6e-07
AVL35802.1|1974803_1975085_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	76.3	3.7e-35
AVL38301.1|1975117_1975618_-	DUF2514 domain-containing protein	NA	Q7Y3V2	Yersinia_phage	86.1	5.2e-72
AVL35803.1|1975635_1976031_-	peptidase M15	NA	K0NZV5	Escherichia_virus	65.1	5.9e-39
AVL35804.1|1976020_1976359_-|holin	phage holin, lambda family	holin	A0A0N7CER3	Salmonella_phage	47.1	7.9e-16
AVL35805.1|1976632_1977130_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35806.1|1977563_1977770_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35807.1|1977885_1978302_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35808.1|1980144_1980570_-	antitermination protein	NA	S5M7R9	Escherichia_phage	57.1	9.5e-35
AVL35809.1|1980831_1981881_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.5	8.6e-69
AVL35810.1|1981932_1984608_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.9	1.4e-232
AVL35811.1|1984604_1985000_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35812.1|1985113_1985317_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35813.1|1985319_1985490_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVL35814.1|1985467_1985665_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35815.1|1985657_1986452_-	phage antirepressor Ant	NA	F1C5A3	Cronobacter_phage	44.3	1.2e-41
AVL38302.1|1986444_1986741_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL35816.1|1986895_1987972_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35817.1|1987968_1988481_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35818.1|1988589_1988796_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVL35819.1|1988905_1989910_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35820.1|1990285_1991473_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.0	2.3e-131
1991638:1991683	attL	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVL35821.1|1991970_1993806_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	31.9	1.1e-63
AVL35822.1|1993862_1995905_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	58.0	8.4e-44
AVL38303.1|1995962_1998326_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	49.6	8.6e-218
AVL35823.1|1998444_1998837_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	46.8	2.6e-31
AVL35824.1|1998872_1999343_-	DUF1833 domain-containing protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
AVL35825.1|1999342_1999816_-	hypothetical protein	NA	B1GS45	Salmonella_phage	54.2	3.2e-47
AVL35826.1|1999812_2003076_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	40.0	1.9e-154
AVL35827.1|2003106_2003484_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35828.1|2003544_2004225_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	54.4	1.5e-66
AVL35829.1|2004277_2005021_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.0	8.5e-55
AVL35830.1|2005077_2005452_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35831.1|2005448_2005820_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	63.3	8.3e-35
AVL35832.1|2005821_2006163_-	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	48.5	1.3e-18
AVL35833.1|2006172_2006394_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35834.1|2006396_2006567_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	55.6	3.0e-16
AVL35835.1|2006566_2006965_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	81.8	1.4e-59
AVL35836.1|2007028_2007214_-	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	58.7	9.2e-11
AVL35837.1|2007224_2008322_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	71.9	1.2e-150
AVL35838.1|2008332_2008773_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	62.8	1.6e-40
AVL35839.1|2008772_2010050_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	78.3	9.1e-190
AVL35840.1|2010053_2010977_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	63.9	3.6e-103
AVL35841.1|2010936_2012307_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	73.1	8.0e-184
AVL35842.1|2012504_2013824_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	89.7	3.0e-236
AVL35843.1|2013807_2014275_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.5	1.8e-55
AVL35844.1|2014308_2014944_-	hypothetical protein	NA	I6S676	Salmonella_phage	70.9	1.8e-85
AVL35845.1|2015294_2015870_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	58.8	3.7e-58
AVL35846.1|2016214_2016400_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35847.1|2016415_2016874_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.3	9.0e-23
AVL35848.1|2016858_2017371_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	1.8e-48
AVL38304.1|2017370_2017652_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
AVL35849.1|2018106_2018931_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	50.7	1.0e-72
AVL35850.1|2018927_2019287_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	69.5	5.2e-42
AVL35851.1|2019283_2019574_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
AVL35852.1|2019685_2020354_-	serine/threonine-protein phosphatase	NA	K7PJY0	Enterobacterial_phage	62.4	3.5e-76
AVL35853.1|2020346_2020733_-	DUF2591 domain-containing protein	NA	A0A2I7QJ87	Vibrio_phage	37.0	2.6e-07
AVL35854.1|2020827_2021211_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	76.9	1.2e-52
AVL35855.1|2021207_2021645_-	recombination protein NinB	NA	E5AGF7	Erwinia_phage	83.4	3.3e-67
AVL35856.1|2021637_2021949_-	hypothetical protein	NA	A0A0A0YR00	Erwinia_phage	36.6	6.1e-07
AVL38305.1|2021945_2022302_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	36.8	7.0e-07
AVL35857.1|2022652_2023003_-	hypothetical protein	NA	Q7Y3W5	Yersinia_phage	75.2	1.7e-45
AVL35858.1|2023263_2023458_-	hypothetical protein	NA	NA	NA	NA	NA
AVL35859.1|2023457_2024861_-	helicase DnaB	NA	A0A0N7C224	Escherichia_phage	61.7	1.9e-164
AVL35860.1|2024850_2025753_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	47.2	1.6e-63
AVL35861.1|2025919_2026210_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	61.9	4.8e-22
AVL35862.1|2026345_2026576_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	47.1	1.0e-06
AVL38306.1|2026734_2027433_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.5	5.3e-83
AVL35863.1|2027764_2028112_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35864.1|2028739_2029102_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35865.1|2029151_2029394_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35866.1|2029941_2030253_+	hypothetical protein	NA	A0A2I7RGU7	Vibrio_phage	42.6	2.3e-14
AVL35867.1|2031520_2031910_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35868.1|2032260_2032509_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35869.1|2032480_2033161_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	69.5	1.8e-91
AVL35870.1|2033157_2033754_+	DUF669 domain-containing protein	NA	K7PHD7	Enterobacteria_phage	51.6	2.7e-43
AVL35871.1|2033780_2034047_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35872.1|2034086_2034290_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AVL35873.1|2034493_2035000_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	45.9	9.7e-10
AVL35874.1|2034999_2035893_+	hypothetical protein	NA	A0A2K9VK66	Klebsiella_phage	60.4	4.1e-96
AVL38307.1|2035908_2036139_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35875.1|2036135_2036435_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35876.1|2036499_2036706_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35877.1|2036713_2036932_+	hypothetical protein	NA	NA	NA	NA	NA
AVL35878.1|2036928_2037564_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	74.0	1.1e-87
AVL35879.1|2038238_2039393_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
2039425:2039470	attR	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 7
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	2066260	2074972	4960650		Tupanvirus(14.29%)	8	NA	NA
AVL35900.1|2066260_2067271_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.2	4.5e-83
AVL35901.1|2067330_2068701_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	28.7	1.8e-34
AVL35902.1|2068713_2070111_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	5.2e-53
AVL35903.1|2070117_2071083_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	48.9	8.7e-84
AVL35904.1|2071088_2072207_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	63.6	3.4e-132
AVL35905.1|2072203_2073280_-	galactosyltransferase	NA	NA	NA	NA	NA
AVL35906.1|2073266_2074115_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	26.4	5.0e-11
AVL38311.1|2074111_2074972_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	34.8	2.2e-09
>prophage 8
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	2435548	2504704	4960650	protease,tRNA,plate	Paramecium_bursaria_Chlorella_virus(33.33%)	55	NA	NA
AVL36194.1|2435548_2436301_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVL36195.1|2436367_2436691_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AVL36196.1|2436844_2438824_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AVL36197.1|2440113_2441268_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	8.7e-131
AVL36198.1|2441325_2441739_-	hypothetical protein	NA	NA	NA	NA	NA
AVL36199.1|2441748_2442180_-	hypothetical protein	NA	NA	NA	NA	NA
AVL38327.1|2442176_2442482_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL36200.1|2442632_2443145_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AVL36201.1|2443242_2443950_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AVL36202.1|2443996_2444728_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AVL36203.1|2444753_2445707_+	glutathione synthase	NA	NA	NA	NA	NA
AVL36204.1|2446240_2446804_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AVL36205.1|2446803_2447226_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVL36206.1|2447408_2448293_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.7	5.3e-80
AVL36207.1|2448296_2449421_+	agmatine deiminase	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	50.0	1.8e-96
AVL38328.1|2449460_2450525_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AVL36208.1|2450619_2451315_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVL36209.1|2451402_2452224_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AVL36210.1|2452352_2452907_+	YggT family protein	NA	NA	NA	NA	NA
AVL36211.1|2452903_2453194_+	YggU family protein	NA	NA	NA	NA	NA
AVL36212.1|2453248_2453842_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AVL36213.1|2453834_2454965_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AVL36214.1|2455053_2455794_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AVL38329.1|2455814_2456732_-	glutaminase	NA	NA	NA	NA	NA
AVL36215.1|2456868_2457195_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AVL36216.1|2457194_2457914_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVL38330.1|2458191_2459253_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AVL36217.1|2459306_2459579_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AVL36218.1|2459636_2460713_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AVL36219.1|2460946_2461696_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVL36220.1|2461766_2463929_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
AVL36221.1|2467064_2467820_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVL38331.1|2468284_2469370_+	lipase	NA	NA	NA	NA	NA
AVL38332.1|2470761_2474358_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.2	2.8e-34
AVL36222.1|2474362_2474977_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL36223.1|2475972_2476584_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVL36224.1|2477635_2478115_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVL36225.1|2478114_2478921_-	ImpE family T6SS protein Cts1E	NA	NA	NA	NA	NA
AVL36226.1|2478946_2479789_-	TagK domain-containing protein	NA	NA	NA	NA	NA
AVL36227.1|2479794_2480055_-	hypothetical protein	NA	NA	NA	NA	NA
AVL36228.1|2480169_2482971_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	2.7e-29
AVL36229.1|2483116_2486950_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVL36230.1|2486958_2488356_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AVL36231.1|2488352_2489702_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVL36232.1|2489705_2490260_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVL36233.1|2490434_2490920_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVL36234.1|2491243_2492746_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVL36235.1|2492769_2493294_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVL36236.1|2493401_2494004_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVL36237.1|2493988_2496655_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVL38333.1|2496751_2497552_-	pilus assembly protein	NA	NA	NA	NA	NA
AVL36238.1|2497663_2498221_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVL36239.1|2498392_2501065_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.3	1.9e-88
AVL36240.1|2501798_2503679_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVL36241.1|2503678_2504704_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	4383095	4391229	4960650	integrase	uncultured_Mediterranean_phage(33.33%)	6	4377547:4377561	4396569:4396583
4377547:4377561	attL	CTGTTTTCATTTCTT	NA	NA	NA	NA
AVL37704.1|4383095_4383848_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	1.6e-64
AVL37705.1|4383870_4384497_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	4.8e-35
AVL37706.1|4384896_4385880_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	32.8	1.3e-07
AVL37707.1|4385934_4386933_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
AVL37708.1|4387039_4389601_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.4	1.3e-25
AVL37709.1|4389759_4391229_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.4	1.3e-22
4396569:4396583	attR	AAGAAATGAAAACAG	NA	NA	NA	NA
>prophage 10
CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	4874038	4882958	4960650		Escherichia_phage(71.43%)	10	NA	NA
AVL38103.1|4874038_4874608_+	N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.5	1.3e-10
AVL38104.1|4874744_4875980_+	alanine transaminase	NA	NA	NA	NA	NA
AVL38105.1|4876155_4876680_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	51.0	7.6e-26
AVL38488.1|4876738_4876813_-	membrane protein YpdK	NA	NA	NA	NA	NA
AVL38106.1|4877321_4877753_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	49.3	6.7e-28
AVL38107.1|4877849_4878395_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AVL38108.1|4878409_4879024_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	48.7	1.9e-44
AVL38109.1|4879127_4879904_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	42.2	7.8e-43
AVL38110.1|4879905_4880523_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	70.2	3.4e-89
AVL38111.1|4880534_4882958_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	55.8	4.8e-264
