The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	757245	766090	4139887		Escherichia_phage(66.67%)	9	NA	NA
AVK35873.1|757245_759699_+	dimethyl sulfoxide reductase DmsA	NA	A0A077SK27	Escherichia_phage	49.7	1.7e-216
AVK35874.1|759710_760328_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
AVK35875.1|760329_761190_+	DMSO reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
AVK35876.1|761275_761887_+	tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	1.9e-23
AVK35877.1|761952_762243_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35878.1|762370_763057_-	protein YiiM	NA	NA	NA	NA	NA
AVK35879.1|763145_763766_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	1.5e-60
AVK35880.1|763897_764038_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35881.1|764134_766090_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	9.7e-82
>prophage 2
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	1297681	1312642	4139887		Escherichia_phage(11.11%)	13	NA	NA
AVK36399.1|1297681_1299037_+	replicative DNA helicase	NA	O80281	Escherichia_phage	75.0	2.5e-193
AVK36400.1|1299116_1300196_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.0	5.2e-29
AVK36401.1|1300251_1301448_+	aromatic-amino-acid aminotransferase	NA	NA	NA	NA	NA
AVK36402.1|1301496_1301763_-	hypothetical protein	NA	A0A2C9CZU7	Yersinia_phage	55.7	1.2e-16
AVK36403.1|1301894_1304729_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
AVK36404.1|1305007_1305526_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	84.6	2.3e-51
AVK36405.1|1306032_1306155_-	hypothetical protein	NA	NA	NA	NA	NA
AVK36406.1|1306719_1308411_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	6.0e-64
AVK36407.1|1308428_1308713_+	acetolactate synthase isozyme 1 small subunit	NA	NA	NA	NA	NA
AVK36408.1|1308755_1309313_-	helix-turn-helix domain protein	NA	S5FUZ3	Shigella_phage	31.7	1.2e-05
AVK36409.1|1309483_1310233_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVK36410.1|1310239_1311250_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	L7TND1	Rhizobium_phage	35.6	6.4e-05
AVK36411.1|1311295_1312642_+	permease family protein	NA	A0A0R6PHV4	Moraxella_phage	69.6	5.5e-153
>prophage 3
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2001546	2009601	4139887	tRNA	Mycobacterium_phage(33.33%)	11	NA	NA
AVK37058.1|2001546_2002752_-	glycine betaine/L-proline transport ATP binding subunit	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
AVK37059.1|2002946_2003087_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37060.1|2003138_2003279_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37061.1|2003357_2004320_-	ribonucleotide reductase, small chain family protein	NA	R4TBI6	Mycobacterium_phage	73.4	1.7e-135
AVK37062.1|2004344_2006426_-	ribonucleoside-diphosphate reductase, alpha subunit	NA	V9VI16	Lactococcus_phage	53.0	2.3e-206
AVK37063.1|2006495_2006912_-	nrdI protein	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
AVK37064.1|2006933_2007152_-	glutaredoxin-like NrdH family protein	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
AVK37065.1|2007275_2007392_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37066.1|2007460_2008543_+|tRNA	tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
AVK37067.1|2008724_2009192_+	methylated-DNA-[]-cysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
AVK37068.1|2009391_2009601_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
>prophage 4
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2023434	2090994	4139887	plate,tail,portal,head,capsid,protease,integrase,lysis,terminase,tRNA	Morganella_phage(18.42%)	91	2032909:2032925	2075779:2075795
AVK37085.1|2023434_2025870_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.0	8.6e-189
AVK37086.1|2025986_2026148_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37087.1|2026233_2026959_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	37.9	6.4e-31
AVK37088.1|2026955_2027633_-	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK37089.1|2027632_2028370_-	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK37090.1|2028568_2029465_-	NMT1/THI5 like family protein	NA	NA	NA	NA	NA
AVK37091.1|2029895_2030264_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37092.1|2030321_2032358_+	thioredoxin-like family protein	NA	NA	NA	NA	NA
AVK37093.1|2032354_2033083_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
2032909:2032925	attL	TGTGAAAGTCACTGATA	NA	NA	NA	NA
AVK37094.1|2033082_2033580_+	thioredoxin-like family protein	NA	NA	NA	NA	NA
AVK37095.1|2033651_2035205_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AVK37096.1|2035201_2036092_-	magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVK37097.1|2036396_2037620_+|integrase	phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	48.3	1.9e-107
AVK37098.1|2037576_2037783_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37099.1|2037779_2038097_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37100.1|2038083_2038860_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37101.1|2038849_2039101_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37102.1|2039097_2039319_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37103.1|2039331_2039901_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.6	4.5e-32
AVK37104.1|2039903_2040131_-	restriction alleviation, Lar family protein	NA	NA	NA	NA	NA
AVK37105.1|2040336_2041134_-	hypothetical protein	NA	H6WRU9	Salmonella_phage	47.3	1.0e-45
AVK37106.1|2041133_2041340_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37107.1|2041326_2041674_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37108.1|2041748_2042168_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37109.1|2042246_2042399_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37110.1|2042356_2042656_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37111.1|2042658_2043054_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37112.1|2043046_2043220_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37113.1|2043411_2043618_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37114.1|2043621_2044134_-	helix-turn-helix family protein	NA	A0A0R6PJ00	Moraxella_phage	47.8	1.5e-05
AVK37115.1|2044217_2044994_-	repressor protein C2	NA	Q8W648	Enterobacteria_phage	53.9	3.4e-70
AVK37116.1|2045200_2045326_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	71.4	1.7e-08
AVK37117.1|2045294_2045573_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	3.4e-17
AVK37118.1|2045837_2046905_+	helicase domain protein	NA	A0A1B5FPA4	Escherichia_phage	72.9	1.7e-136
AVK37119.1|2046894_2047164_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37120.1|2047358_2047484_+	NUMOD4 domain protein	NA	NA	NA	NA	NA
AVK37121.1|2047476_2048226_+	hypothetical protein	NA	A0A286N2P9	Klebsiella_phage	62.0	7.0e-65
AVK37122.1|2048222_2049209_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	60.9	3.1e-113
AVK37123.1|2049208_2049988_+	antitermination family protein	NA	A0A1B5FPA5	Escherichia_phage	39.3	3.1e-47
AVK37124.1|2050200_2050395_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	100.0	1.0e-28
AVK37125.1|2050533_2051571_+	DNA methylase family protein	NA	A0A1W6JP25	Morganella_phage	95.9	9.7e-174
AVK37126.1|2051850_2051988_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37127.1|2052231_2052345_+	putative membrane protein	NA	A0A1W6JNY9	Morganella_phage	97.3	2.2e-15
AVK37128.1|2052337_2052814_+	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	93.0	1.1e-82
AVK37129.1|2052795_2052954_+	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	95.5	9.6e-17
AVK37130.1|2052950_2053403_+|lysis	bacteriophage lysis family protein	lysis	A0A1W6JP00	Morganella_phage	59.5	1.3e-13
AVK37131.1|2053432_2053618_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
AVK37132.1|2053872_2054517_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37133.1|2054476_2054608_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37134.1|2054849_2055431_+	putative dNA-directed RNA polymerase, sigma subunit	NA	NA	NA	NA	NA
AVK37135.1|2055405_2057379_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.3	4.8e-145
AVK37136.1|2057388_2057640_+|head,tail	phage head-to-tail joining family protein	head,tail	NA	NA	NA	NA
AVK37137.1|2057639_2059292_+|portal	phage portal protein, lambda family	portal	A0A291AUL8	Sinorhizobium_phage	35.6	1.3e-92
AVK37138.1|2059288_2060143_+|protease	clp protease family protein	protease	A0A0B4SK12	Proteus_phage	44.3	1.5e-50
AVK37139.1|2060145_2060766_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37140.1|2060765_2061158_+|head	bacteriophage lambda head decoration D family protein	head	A0A067ZIL6	Vibrio_phage	39.8	1.3e-14
AVK37141.1|2061231_2062278_+|capsid	phage major capsid E family protein	capsid	V5Q8X6	Xylella_phage	34.1	1.3e-48
AVK37142.1|2062290_2062662_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37143.1|2062651_2062990_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37144.1|2062989_2063547_+	putative bacteriophage ATP-binding protein	NA	NA	NA	NA	NA
AVK37145.1|2063549_2063717_+	hypothetical protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
AVK37146.1|2063713_2065195_+|tail	phage tail sheath family protein	tail	B5TK67	Pseudomonas_phage	44.9	8.0e-105
AVK37147.1|2065204_2065573_+|tail	phage tail tube family protein	tail	NA	NA	NA	NA
AVK37148.1|2065575_2065839_+	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AVK37149.1|2065981_2067862_+	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	33.3	1.2e-09
AVK37150.1|2067922_2068336_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37151.1|2068381_2068720_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37152.1|2068968_2070369_+	DNA circulation family protein	NA	NA	NA	NA	NA
AVK37153.1|2070365_2071436_+	phage late control D family protein	NA	A0A2I7S9G1	Vibrio_phage	30.7	3.8e-40
AVK37154.1|2071435_2072023_+	bacteriophage Mu Gp45 family protein	NA	NA	NA	NA	NA
AVK37155.1|2072022_2072460_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	56.2	8.3e-18
AVK37156.1|2072460_2073600_+|plate	baseplate J-like family protein	plate	U5P424	Shigella_phage	33.1	6.5e-38
AVK37157.1|2073596_2074190_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37158.1|2074240_2074864_+|tail	putative phage tail collar domain protein	tail	Q8HAB4	Salmonella_phage	38.4	5.4e-10
AVK37159.1|2075234_2075531_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37160.1|2075828_2075957_-|tail	caudovirales tail fiber assembly family protein	tail	E7EKV7	Edwardsiella_phage	53.7	3.1e-05
2075779:2075795	attR	TGTGAAAGTCACTGATA	NA	NA	NA	NA
AVK37161.1|2075956_2076100_-|tail	caudovirales tail fiber assembly family protein	tail	NA	NA	NA	NA
AVK37162.1|2076368_2076641_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37163.1|2076883_2077438_+	DNA-invertase hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.8	3.5e-69
AVK37164.1|2077480_2077765_-	dinI-like family protein	NA	A0A1W6JP10	Morganella_phage	89.9	8.6e-40
AVK37165.1|2077944_2078409_-	putative rRNA maturation factor YbeY	NA	NA	NA	NA	NA
AVK37166.1|2078401_2079484_-	phoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	47.4	1.2e-49
AVK37167.1|2079536_2080976_-|tRNA	tRNA-i(6)A37 thiotransferase enzyme MiaB	tRNA	NA	NA	NA	NA
AVK37168.1|2080994_2081111_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37169.1|2081180_2082362_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AVK37170.1|2083386_2084622_-	ROK family protein	NA	NA	NA	NA	NA
AVK37171.1|2084635_2085799_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AVK37172.1|2085882_2086692_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AVK37173.1|2086742_2086865_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37174.1|2087121_2089152_+	PTS system, N-acetylglucosamine-specific IIBC component	NA	A0A2I7SAJ6	Vibrio_phage	46.8	2.1e-10
AVK37175.1|2089326_2090994_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	2.3e-286
>prophage 5
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2645016	2689737	4139887	transposase,head,integrase,terminase,tail	Morganella_phage(94.12%)	56	2644929:2644985	2695753:2695809
2644929:2644985	attL	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
AVK37740.1|2645016_2646063_-|integrase	phage integrase family protein	integrase	A0A2H5BFK7	Salmonella_phage	69.5	2.4e-140
AVK37741.1|2646705_2646951_-	single-strand binding family protein	NA	A0A1W6JNW8	Morganella_phage	100.0	8.7e-41
AVK37742.1|2647101_2647623_-	ERF superfamily protein	NA	A0A1W6JP21	Morganella_phage	99.4	1.6e-92
AVK37743.1|2648077_2648242_-	hypothetical protein	NA	A0A1W6JNX8	Morganella_phage	100.0	3.2e-23
AVK37744.1|2648238_2648415_-	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
AVK37745.1|2648708_2648834_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37746.1|2649187_2649346_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37747.1|2649804_2650014_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
AVK37748.1|2650042_2650351_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	99.0	6.4e-49
AVK37749.1|2651082_2652156_-	acetyltransferase, GNAT family	NA	Q6SE88	Lactobacillus_prophage	41.5	2.8e-67
AVK37750.1|2652193_2652355_-	hypothetical protein	NA	A0A1W6JP12	Morganella_phage	90.4	1.1e-20
AVK37751.1|2652573_2652738_-	peptidase S24-like family protein	NA	A0A1W6JNY2	Morganella_phage	100.0	1.3e-24
AVK37752.1|2653350_2653530_+	helix-turn-helix family protein	NA	A0A1W6JNW6	Morganella_phage	93.5	7.8e-15
AVK37753.1|2653660_2653987_+	putative phage regulatory protein	NA	A0A1W6JNY4	Morganella_phage	99.1	7.0e-54
AVK37754.1|2654128_2654920_+	phage replication protein O, N-terminal domain	NA	A0A1W6JNY0	Morganella_phage	98.5	8.3e-133
AVK37755.1|2654919_2655648_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	97.9	4.2e-131
AVK37756.1|2656037_2656340_+	ninB family protein	NA	A0A1W6JNZ4	Morganella_phage	99.0	1.9e-53
AVK37757.1|2656809_2656950_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	72.7	3.7e-12
AVK37758.1|2657043_2657199_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37759.1|2657629_2658160_+	bacteriophage Lambda NinG family protein	NA	A0A1W6JNX3	Morganella_phage	98.6	1.9e-80
AVK37760.1|2658449_2658821_+	phage antitermination Q family protein	NA	A0A1W6JNX1	Morganella_phage	96.7	3.8e-64
AVK37761.1|2658830_2660039_-|transposase	transposase DDE domain protein	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVK37762.1|2660599_2660812_+	cold-shock DNA-binding domain protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
AVK37763.1|2661756_2661966_+	bacterial lipid A biosynthesis acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	100.0	2.7e-35
AVK37764.1|2662037_2662799_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AVK37765.1|2663127_2663568_-	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
AVK37766.1|2663874_2664333_+	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVK37767.1|2665981_2666173_+	putative membrane protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AVK37768.1|2666165_2666642_+	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	92.4	8.9e-82
AVK37769.1|2666641_2666782_+	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	87.0	3.0e-14
AVK37770.1|2666778_2667156_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	82.4	4.2e-50
AVK37771.1|2667779_2668295_+	lipocalin / cytosolic fatty-acid binding family protein	NA	A0A1W6JNX6	Morganella_phage	99.4	2.1e-97
AVK37772.1|2668281_2668431_-	hypothetical protein	NA	A0A1W6JNZ3	Morganella_phage	95.9	8.8e-20
AVK37773.1|2668564_2668762_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	95.4	3.6e-29
AVK37774.1|2668815_2669292_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	98.7	1.8e-82
AVK37775.1|2669293_2670778_+|terminase	putative phage terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	99.4	2.1e-299
AVK37776.1|2670779_2672159_+	hypothetical protein	NA	A0A1W6JNV0	Morganella_phage	98.9	3.3e-262
AVK37777.1|2672162_2673224_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A1W6JNT7	Morganella_phage	98.9	4.3e-193
AVK37778.1|2673289_2673976_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	97.4	9.2e-96
AVK37779.1|2673981_2674962_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	98.5	4.9e-175
AVK37780.1|2674986_2675364_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	98.4	4.0e-61
AVK37781.1|2675491_2675707_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	95.8	2.9e-32
AVK37782.1|2675708_2676077_+	putative characterized protein	NA	A0A1W6JNX7	Morganella_phage	97.5	4.3e-60
AVK37783.1|2676073_2676445_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	98.4	2.8e-67
AVK37784.1|2676509_2677265_+|tail	phage major tail 2 family protein	tail	A0A1W6JNT1	Morganella_phage	96.8	4.3e-131
AVK37785.1|2677315_2678008_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	99.1	1.3e-126
AVK37786.1|2678051_2681375_+	tape measure domain protein	NA	A0A1W6JNU2	Morganella_phage	99.5	0.0e+00
AVK37787.1|2681414_2681744_+|tail	phage minor tail family protein	tail	A0A1W6JNT2	Morganella_phage	99.1	1.5e-59
AVK37788.1|2681740_2682439_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	99.1	6.6e-134
AVK37789.1|2682673_2683156_+	nlpC/P60 family protein	NA	A0A1W6JNU8	Morganella_phage	98.8	1.5e-97
AVK37790.1|2683281_2683665_+|tail	putative tail assembly protein I	tail	A0A1W6JP03	Morganella_phage	98.4	6.5e-59
AVK37791.1|2683665_2686800_+	hypothetical protein	NA	A0A1W6JNW2	Morganella_phage	98.4	0.0e+00
AVK37792.1|2686801_2687122_+	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
AVK37793.1|2687118_2687805_+	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.2	1.3e-134
AVK37794.1|2687807_2688074_+	putative lipoprotein	NA	A0A1W6JNS1	Morganella_phage	98.9	5.7e-46
AVK37795.1|2688186_2689737_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	73.8	1.9e-210
2695753:2695809	attR	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
>prophage 6
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2700647	2710918	4139887	tail	Burkholderia_phage(33.33%)	12	NA	NA
AVK37811.1|2700647_2702135_+	hypothetical protein	NA	E5E3F3	Pseudomonas_phage	34.8	4.2e-69
AVK37812.1|2702150_2702603_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
AVK37813.1|2702645_2703104_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	3.5e-27
AVK37814.1|2703186_2705157_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.9	1.1e-16
AVK37815.1|2705153_2705693_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37816.1|2705689_2705983_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37817.1|2705975_2706791_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
AVK37818.1|2706807_2707500_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	40.1	1.8e-35
AVK37819.1|2707496_2707841_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37820.1|2707833_2709021_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.4	1.1e-75
AVK37821.1|2709017_2709680_+	hypothetical protein	NA	Q6IWQ4	Burkholderia_phage	38.3	4.2e-37
AVK37822.1|2709685_2710918_+|tail	putative long tail fiber protein p37	tail	A0A2K9V2I0	Shigella_phage	33.8	2.0e-24
>prophage 7
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2736496	2772187	4139887	head,terminase,tail,protease	Escherichia_phage(36.67%)	44	NA	NA
AVK37855.1|2736496_2736694_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	61.9	4.1e-17
AVK37856.1|2736698_2737145_-	MT-A70 family protein	NA	G8C7S6	Escherichia_phage	63.8	7.4e-46
AVK37857.1|2737287_2737671_-	hypothetical protein	NA	E9NID9	Enterobacter_phage	38.3	8.6e-11
AVK37858.1|2737654_2738068_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37859.1|2738268_2738805_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37860.1|2738890_2739085_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37861.1|2739401_2740403_-	C-5 cytosine-specific DNA methylase family protein	NA	W0LM09	Edwardsiella_phage	61.0	7.1e-113
AVK37862.1|2740434_2740578_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37863.1|2740873_2741965_-	recT family protein	NA	H6WRX0	Salmonella_phage	58.2	1.4e-114
AVK37864.1|2742013_2743711_-	putative exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	46.4	4.4e-107
AVK37865.1|2743694_2743853_-	hypothetical protein	NA	NA	NA	NA	NA
AVK37866.1|2744180_2744771_-	helix-turn-helix family protein	NA	A0A193GYL7	Enterobacter_phage	35.0	1.6e-27
AVK37867.1|2744902_2745121_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37868.1|2745451_2746477_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	56.6	2.4e-47
AVK37869.1|2746520_2746919_+	replication P family protein	NA	NA	NA	NA	NA
AVK37870.1|2747125_2747548_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37871.1|2747537_2747900_+	endodeoxyribonuclease RusA family protein	NA	G8C7V6	Escherichia_phage	60.5	1.2e-33
AVK37872.1|2747980_2748238_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37873.1|2748316_2748757_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37874.1|2748753_2749104_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.1	3.3e-33
AVK37875.1|2749469_2749970_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	54.4	1.0e-43
AVK37876.1|2749969_2751454_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	78.5	9.8e-236
AVK37877.1|2751501_2751834_-	phage family protein	NA	Q716B1	Shigella_phage	72.8	1.2e-37
AVK37878.1|2751795_2751966_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37879.1|2752064_2752271_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37880.1|2752286_2753948_+|head,tail	bacteriophage head to tail connecting family protein	head,tail	T1S9Z7	Salmonella_phage	61.2	3.9e-193
AVK37881.1|2753944_2754268_+	hypothetical protein	NA	Q2A090	Sodalis_phage	47.0	8.3e-15
AVK37882.1|2754264_2754927_+|protease	putative endoprotease	protease	G9L6C4	Escherichia_phage	58.7	2.3e-43
AVK37883.1|2754940_2755921_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	62.2	8.2e-114
AVK37884.1|2755975_2756407_+	putative bbp16	NA	A0A193GYT9	Enterobacter_phage	54.5	4.2e-30
AVK37885.1|2756415_2756745_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37886.1|2756809_2757106_+	hypothetical protein	NA	T1SBJ0	Salmonella_phage	38.9	7.9e-12
AVK37887.1|2757105_2757711_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	63.2	2.0e-70
AVK37888.1|2757710_2760179_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	69.0	0.0e+00
AVK37889.1|2760182_2760647_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	61.0	4.4e-49
AVK37890.1|2760661_2761219_+	hypothetical protein	NA	Q858G1	Salmonella_phage	46.5	1.3e-26
AVK37891.1|2761230_2764038_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.1	3.5e-109
AVK37892.1|2764037_2767433_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	35.6	1.9e-178
AVK37893.1|2767464_2768277_+	hypothetical protein	NA	NA	NA	NA	NA
AVK37894.1|2768318_2768570_-	hypothetical protein	NA	Q858F6	Salmonella_phage	37.3	9.0e-09
AVK37895.1|2768727_2770977_+	right handed beta helix region family protein	NA	G9L6E4	Escherichia_phage	51.0	2.4e-60
AVK37896.1|2771070_2771442_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	38.6	2.5e-15
AVK37897.1|2771434_2771707_+	hypothetical protein	NA	T1SA10	Salmonella_phage	52.2	2.4e-15
AVK37898.1|2771710_2772187_+	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	48.2	5.1e-29
>prophage 8
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3207094	3288677	4139887	portal,head,tRNA,integrase,terminase,tail	Enterobacteria_phage(30.61%)	101	3237208:3237223	3290094:3290109
AVK38375.1|3207094_3208369_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
AVK38376.1|3208504_3209155_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AVK38377.1|3209209_3210328_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38378.1|3210646_3211114_+	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
AVK38379.1|3211173_3211572_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
AVK38380.1|3211959_3212100_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38381.1|3212123_3212456_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38382.1|3212587_3212920_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AVK38383.1|3213029_3213677_+	ribonuclease T	NA	NA	NA	NA	NA
AVK38384.1|3213744_3214425_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38385.1|3214562_3214904_-	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AVK38386.1|3215187_3215808_+	lysE type translocator family protein	NA	NA	NA	NA	NA
AVK38387.1|3215870_3216329_-	putative inner membrane protein	NA	NA	NA	NA	NA
AVK38388.1|3216470_3217169_+	RNA pseudouridylate synthase family protein	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	2.8e-07
AVK38389.1|3217192_3217732_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38390.1|3217801_3218110_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38391.1|3218165_3218384_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38392.1|3218507_3219086_+	superoxide dismutase	NA	NA	NA	NA	NA
AVK38393.1|3219119_3219278_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38394.1|3219529_3220555_+	bacterial regulatory, lacI family protein	NA	C6ZCU4	Enterobacteria_phage	32.5	2.4e-31
AVK38395.1|3220558_3221461_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVK38396.1|3221639_3222794_+	drug resistance transporter, Bcr/CflA subfamily protein	NA	S4TR35	Salmonella_phage	25.1	2.1e-15
AVK38397.1|3223059_3224223_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	8.0e-84
AVK38398.1|3224305_3224971_-	riboflavin synthase, alpha subunit	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
AVK38399.1|3224969_3225083_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38400.1|3225183_3226557_+	multidrug resistance protein MdtK	NA	NA	NA	NA	NA
AVK38401.1|3227274_3228687_+	pyruvate kinase	NA	NA	NA	NA	NA
AVK38402.1|3229012_3229249_+	major outer membrane lipoprotein Lpp	NA	NA	NA	NA	NA
AVK38403.1|3229389_3230472_-	L,D-transpeptidase catalytic domain protein	NA	NA	NA	NA	NA
AVK38404.1|3230570_3230990_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
AVK38405.1|3230998_3232237_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.5	4.5e-85
AVK38406.1|3232236_3233541_-	feS assembly protein SufD	NA	NA	NA	NA	NA
AVK38407.1|3233515_3234262_-	feS assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
AVK38408.1|3234313_3235798_-	feS assembly protein SufB	NA	NA	NA	NA	NA
AVK38409.1|3235813_3236170_-	feS assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	7.8e-14
AVK38410.1|3236401_3236581_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38411.1|3236532_3236958_-	esterase YdiI	NA	NA	NA	NA	NA
AVK38412.1|3236992_3240061_-	FAD linked oxidase, C-terminal domain protein	NA	NA	NA	NA	NA
3237208:3237223	attL	TGCTGACAGACTGCAG	NA	NA	NA	NA
AVK38413.1|3240402_3241386_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38414.1|3241860_3244239_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
AVK38415.1|3244457_3245321_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVK38416.1|3245467_3246517_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.3	3.5e-78
AVK38417.1|3246665_3246866_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38418.1|3247035_3247320_+	dinI-like family protein	NA	A0A1W6JP10	Morganella_phage	87.6	3.3e-39
AVK38419.1|3247580_3248246_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38420.1|3248594_3248852_+	helix-turn-helix family protein	NA	NA	NA	NA	NA
AVK38421.1|3248891_3250472_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	73.4	9.8e-210
AVK38422.1|3250537_3251152_-	putative phage protein	NA	NA	NA	NA	NA
AVK38423.1|3251515_3254677_-	hypothetical protein	NA	A0A1W6JNW2	Morganella_phage	49.7	4.9e-285
AVK38424.1|3254689_3255268_-|tail	bacteriophage lambda tail assembly I family protein	tail	A5LH42	Enterobacteria_phage	45.7	4.9e-42
AVK38425.1|3255237_3255966_-	nlpC/P60 family protein	NA	A0A0P0ZE89	Stx2-converting_phage	60.8	2.6e-88
AVK38426.1|3255983_3256682_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.9	8.5e-65
AVK38427.1|3256693_3257476_-	kilA-N domain protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
AVK38428.1|3257978_3258308_-|tail	phage minor tail family protein	tail	A5LH39	Enterobacteria_phage	54.1	7.1e-30
AVK38429.1|3258310_3261232_-|tail	phage tail tape measure protein, lambda family	tail	E4WL33	Enterobacteria_phage	35.1	9.5e-142
AVK38430.1|3261212_3261479_-|tail	phage tail assembly protein T	tail	K7PH56	Enterobacterial_phage	42.2	3.0e-10
AVK38431.1|3261544_3261943_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	36.4	3.6e-12
AVK38432.1|3261946_3262474_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	75.5	1.9e-64
AVK38433.1|3262483_3262882_-|tail	minor tail protein U	tail	K7PHM6	Enterobacterial_phage	61.7	5.2e-43
AVK38434.1|3262881_3263445_-|tail	prophage minor tail Z family protein	tail	K7PMB7	Enterobacterial_phage	55.6	1.6e-45
AVK38435.1|3263446_3263725_-	ATP-binding sugar transporter from pro-phage family protein	NA	K7PH43	Enterobacteria_phage	43.2	5.5e-15
AVK38436.1|3263729_3264071_-	hypothetical protein	NA	Q9EYD5	Enterobacteria_phage	56.5	5.7e-22
AVK38437.1|3264156_3266193_-|head	mu-like prophage major head subunit gpT family protein	head	K7PKX4	Enterobacterial_phage	65.4	2.2e-254
AVK38438.1|3266164_3267640_-|portal	phage portal protein, lambda family	portal	S5MW34	Escherichia_phage	67.8	2.9e-187
AVK38439.1|3267636_3267855_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	58.6	1.1e-15
AVK38440.1|3267851_3269894_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	73.2	1.8e-288
AVK38441.1|3269962_3270466_-	hypothetical protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
AVK38442.1|3270485_3270599_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38443.1|3270856_3271042_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
AVK38444.1|3271299_3271470_-	hypothetical protein	NA	A0A1W6JNV7	Morganella_phage	73.2	1.5e-15
AVK38445.1|3271438_3271816_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	86.4	4.0e-53
AVK38446.1|3271812_3271971_-	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	93.3	3.7e-16
AVK38447.1|3271952_3272429_-	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	91.7	2.2e-80
AVK38448.1|3272421_3272613_-	putative membrane protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AVK38449.1|3272780_3272969_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38450.1|3273475_3274534_-	DNA methylase family protein	NA	A0A1W6JP25	Morganella_phage	95.0	1.3e-170
AVK38451.1|3274672_3274867_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	96.9	5.1e-28
AVK38452.1|3275134_3275716_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
AVK38453.1|3275777_3276557_-	antitermination family protein	NA	A0A1B5FPA5	Escherichia_phage	39.5	5.6e-49
AVK38454.1|3276556_3277543_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	61.2	4.8e-114
AVK38455.1|3277539_3279117_-	helicase domain protein	NA	A0A286N2P9	Klebsiella_phage	66.4	2.0e-210
AVK38456.1|3279380_3279659_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	46.9	1.1e-12
AVK38457.1|3279726_3279840_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38458.1|3280441_3280660_+	peptidase S24-like family protein	NA	A0A1P8DTH0	Proteus_phage	86.1	2.0e-33
AVK38459.1|3280800_3281565_+	kilA-N domain protein	NA	K7YGK4	Megavirus	45.6	2.1e-08
AVK38460.1|3282092_3282278_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38461.1|3282469_3282643_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38462.1|3282635_3283031_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38463.1|3283033_3283531_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38464.1|3283523_3283943_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38465.1|3284017_3284365_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38466.1|3284351_3284558_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38467.1|3284557_3285352_+	hypothetical protein	NA	H6WRU9	Salmonella_phage	46.3	1.0e-42
AVK38468.1|3285557_3285776_+	restriction alleviation, Lar family protein	NA	NA	NA	NA	NA
AVK38469.1|3285772_3286381_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38470.1|3286377_3286599_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38471.1|3286595_3286853_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38472.1|3286836_3286977_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	47.7	1.5e-05
AVK38473.1|3286973_3287294_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38474.1|3287290_3287497_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38475.1|3287453_3288677_-|integrase	phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	49.8	6.6e-113
3290094:3290109	attR	TGCTGACAGACTGCAG	NA	NA	NA	NA
>prophage 9
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3490589	3557953	4139887	portal,holin,head,capsid,protease,tRNA,integrase,terminase,tail	Morganella_phage(81.13%)	93	3520164:3520178	3558916:3558930
AVK38678.1|3490589_3490787_-	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
AVK38679.1|3490758_3491136_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
AVK38680.1|3491132_3491291_-	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
AVK38681.1|3491272_3491749_-	lysozyme RrrD	NA	A0A1W6JNW4	Morganella_phage	77.7	3.6e-67
AVK38682.1|3491738_3491933_-|holin	putative phage 21-like group II holin	holin	A0A1W6JNY9	Morganella_phage	73.0	3.4e-24
AVK38683.1|3492005_3492443_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.8	1.2e-27
AVK38684.1|3492411_3492525_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38685.1|3492517_3492637_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38686.1|3492808_3493516_+	repressor protein CI	NA	K7P8B2	Enterobacteria_phage	55.7	2.9e-68
AVK38687.1|3493660_3493912_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38688.1|3493882_3494134_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38689.1|3494553_3495369_+	lipoprotein 28	NA	NA	NA	NA	NA
AVK38690.1|3495409_3496084_-	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AVK38691.1|3496104_3497295_-	metallopeptidase M24 family protein	NA	NA	NA	NA	NA
AVK38692.1|3497418_3497565_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38693.1|3497694_3497865_+	putative rECA	NA	NA	NA	NA	NA
AVK38694.1|3497883_3497997_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38695.1|3498110_3498329_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38696.1|3498693_3499569_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVK38697.1|3499676_3499862_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38698.1|3499980_3500469_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38699.1|3500537_3500759_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38700.1|3500912_3501296_-	putative lipoprotein	NA	NA	NA	NA	NA
AVK38701.1|3501736_3502081_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38702.1|3502161_3502374_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38703.1|3502375_3502948_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVK38704.1|3503049_3503763_-	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AVK38705.1|3503762_3504806_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38706.1|3504882_3505014_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38707.1|3505099_3505456_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38708.1|3505684_3505957_-	helix-turn-helix family protein	NA	A0A1W6JNW5	Morganella_phage	96.7	5.1e-42
AVK38709.1|3506437_3507286_-	quinone oxidoreductase 2	NA	NA	NA	NA	NA
AVK38710.1|3507375_3507756_+	hxlR-like helix-turn-helix family protein	NA	NA	NA	NA	NA
AVK38711.1|3507892_3508288_+|integrase	phage integrase family protein	integrase	Q77Z04	Phage_21	67.7	3.4e-42
AVK38712.1|3508462_3509425_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38713.1|3509440_3510442_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38714.1|3512303_3512468_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	Q77Z09	Phage_21	94.4	7.9e-22
AVK38715.1|3512486_3512612_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38716.1|3512722_3512941_-	hypothetical protein	NA	A0A1W6JNT0	Morganella_phage	91.5	4.3e-31
AVK38717.1|3513849_3516591_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	NA	NA	NA	NA
AVK38718.1|3516825_3518352_-|tail	putative tail fiber	tail	A0A1W6JNW0	Morganella_phage	81.9	1.1e-242
AVK38719.1|3518465_3518732_-	putative lipoprotein	NA	A0A1W6JNS1	Morganella_phage	96.6	1.4e-44
AVK38720.1|3518734_3519421_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	94.7	5.7e-130
AVK38721.1|3519739_3522916_-	hypothetical protein	NA	A0A1W6JNZ7	Morganella_phage	89.3	0.0e+00
3520164:3520178	attL	GCCGAAGCCGTGCCT	NA	NA	NA	NA
AVK38722.1|3522948_3523545_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A1W6JNY8	Morganella_phage	87.9	7.2e-89
AVK38723.1|3523618_3524047_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	68.8	2.4e-49
AVK38724.1|3524090_3524813_-	nlpC/P60 family protein	NA	A0A1W6JP31	Morganella_phage	95.2	2.4e-134
AVK38725.1|3524815_3525574_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.4	4.8e-146
AVK38726.1|3525570_3525906_-|tail	phage minor tail family protein	tail	A0A1W6JP11	Morganella_phage	99.1	6.5e-63
AVK38727.1|3525902_3529160_-|tail	phage tail tape measure protein, lambda family	tail	A0A1W6JP49	Morganella_phage	97.4	0.0e+00
AVK38728.1|3529185_3529428_-	hypothetical protein	NA	A0A1W6JP68	Morganella_phage	84.8	1.8e-30
AVK38729.1|3529481_3529865_-|tail	phage tail assembly chaperone family protein	tail	A0A1W6JP08	Morganella_phage	95.3	1.3e-62
AVK38730.1|3529868_3530336_-|tail	phage major tail 2 family protein	tail	A0A1W6JP06	Morganella_phage	92.9	7.7e-78
AVK38731.1|3530395_3530731_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	93.7	1.6e-56
AVK38732.1|3530727_3531177_-	hypothetical protein	NA	A0A1W6JP15	Morganella_phage	96.0	4.2e-73
AVK38733.1|3531169_3531493_-|head,tail	phage head-tail joining family protein	head,tail	A0A1W6JP44	Morganella_phage	96.3	1.4e-54
AVK38734.1|3531503_3531806_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A1W6JNZ5	Morganella_phage	81.0	7.0e-40
AVK38735.1|3531892_3533110_-|capsid	phage major capsid protein, HK97 family	capsid	A0A1W6JP20	Morganella_phage	91.9	3.8e-209
AVK38736.1|3533119_3533728_-|head,protease	phage prohead protease, HK97 family	head,protease	A0A1W6JP53	Morganella_phage	91.0	5.8e-102
AVK38737.1|3533717_3534941_-|portal	phage portal protein, HK97 family	portal	A0A1W6JP33	Morganella_phage	96.1	5.6e-229
AVK38738.1|3534930_3535092_-	putative membrane protein	NA	A0A1W6JP78	Morganella_phage	100.0	3.8e-21
AVK38739.1|3535088_3536819_-	phage Terminase family protein	NA	A0A1W6JP18	Morganella_phage	93.8	0.0e+00
AVK38740.1|3536822_3537293_-|terminase	phage terminase, small subunit, P27 family	terminase	A0A1W6JP17	Morganella_phage	89.7	1.7e-77
AVK38741.1|3537428_3537632_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	95.5	3.4e-30
AVK38742.1|3538111_3538225_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38743.1|3538839_3539367_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	42.1	7.0e-19
AVK38744.1|3539363_3539522_-	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	88.9	4.0e-15
AVK38745.1|3539503_3539980_-	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	91.1	9.9e-81
AVK38746.1|3539972_3540164_-	putative membrane protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AVK38747.1|3540587_3541397_+	hypothetical protein	NA	Q19UP3	Mannheimia_phage	47.5	4.3e-68
AVK38748.1|3542058_3542268_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	1.1e-20
AVK38749.1|3542326_3542458_-	hypothetical protein	NA	A0A1W6JP25	Morganella_phage	75.7	2.8e-06
AVK38750.1|3542538_3542988_+	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	45.6	1.5e-22
AVK38751.1|3543217_3543895_-	phage antitermination Q family protein	NA	A0A1W6JP37	Morganella_phage	96.4	8.4e-126
AVK38752.1|3543925_3544942_-	hypothetical protein	NA	A0A1W6JP62	Morganella_phage	89.3	2.3e-180
AVK38753.1|3544941_3545733_-	kilA-N domain protein	NA	A0A1W6JP13	Morganella_phage	84.4	4.3e-121
AVK38754.1|3545775_3546003_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38755.1|3546031_3546163_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38756.1|3546170_3547049_-	helix-turn-helix domain protein	NA	A0A1W6JP36	Morganella_phage	85.6	3.6e-129
AVK38757.1|3547051_3547246_-	hypothetical protein	NA	A0A1W6JP38	Morganella_phage	82.8	1.5e-24
AVK38758.1|3547238_3547364_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38759.1|3547502_3547967_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.7e-35
AVK38760.1|3549082_3549295_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	75.7	1.6e-22
AVK38761.1|3549407_3549635_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38762.1|3549784_3550012_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38763.1|3550297_3551425_+|integrase	phage integrase family protein	integrase	O21925	Phage_21	60.1	9.4e-122
AVK38764.1|3551700_3551820_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38765.1|3552322_3553066_-	AAA domain protein	NA	A0A2I7RNF1	Vibrio_phage	36.1	7.0e-33
AVK38766.1|3553110_3553749_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38767.1|3554165_3555419_-	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	94.4	8.0e-21
AVK38768.1|3555559_3556249_+	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AVK38769.1|3556199_3556667_+	phosphatase NudJ	NA	NA	NA	NA	NA
AVK38770.1|3556849_3557953_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
3558916:3558930	attR	GCCGAAGCCGTGCCT	NA	NA	NA	NA
>prophage 10
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3666519	3743614	4139887	transposase,head,integrase,terminase,tail	Escherichia_phage(14.29%)	88	3707721:3707736	3747898:3747913
AVK38898.1|3666519_3666714_+	FI domain protein	NA	A0A2H4JCP8	uncultured_Caudovirales_phage	78.9	6.3e-10
AVK38899.1|3666852_3667074_+|tail	putative phage tail sheath protein	tail	K7PLZ2	Enterobacterial_phage	69.8	2.9e-19
AVK38900.1|3667134_3668343_-|transposase	transposase DDE domain protein	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVK38901.1|3668781_3669582_+	glycosyltransferase sugar-binding region containing DXD motif family protein	NA	A0A1V0SL98	Klosneuvirus	32.0	7.3e-12
AVK38902.1|3669617_3671072_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	38.1	3.6e-17
AVK38903.1|3671077_3671740_-	hypothetical protein	NA	Q6IWQ4	Burkholderia_phage	40.2	4.5e-39
AVK38904.1|3671736_3672924_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.2	2.3e-78
AVK38905.1|3672916_3673261_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38906.1|3673257_3673950_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	43.1	1.0e-33
AVK38907.1|3673963_3674779_-	hypothetical protein	NA	A0A0H4M7L6	Pseudomonas_phage	28.7	9.8e-20
AVK38908.1|3674771_3675065_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.4	1.8e-08
AVK38909.1|3675061_3675592_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38910.1|3675588_3677724_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.1	3.1e-17
AVK38911.1|3677806_3678268_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.3	3.3e-25
AVK38912.1|3678308_3678761_-	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	43.5	1.5e-25
AVK38913.1|3678770_3680258_-	hypothetical protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	1.9e-82
AVK38914.1|3680267_3680783_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38915.1|3680772_3681141_-	hypothetical protein	NA	I7A8K9	Escherichia_phage	34.5	1.5e-15
AVK38916.1|3681140_3681599_-	putative bacteriophage protein	NA	A0A077KC03	Edwardsiella_phage	40.6	7.9e-19
AVK38917.1|3681595_3682024_-	hypothetical protein	NA	Q6IWU8	Burkholderia_phage	30.2	3.8e-07
AVK38918.1|3682033_3682387_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	34.3	1.2e-06
AVK38919.1|3682442_3683510_-	hypothetical protein	NA	A0A2H4P6S2	Pseudomonas_phage	40.2	7.2e-55
AVK38920.1|3683509_3683842_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38921.1|3684005_3685286_-	hypothetical protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	41.0	3.0e-39
AVK38922.1|3685282_3685996_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q6IWU3	Burkholderia_phage	39.1	2.9e-36
AVK38923.1|3686018_3687533_-	hypothetical protein	NA	J7M2P3	Pseudomonas_phage	47.1	5.3e-104
AVK38924.1|3687534_3688935_-|terminase	terminase-like family protein	terminase	A0A2K9V3I6	Faecalibacterium_phage	41.3	3.2e-87
AVK38925.1|3689135_3690152_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.9	1.5e-33
AVK38926.1|3690209_3690395_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.0	2.4e-11
AVK38927.1|3690692_3691220_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	1.6e-18
AVK38928.1|3691216_3691357_-	putative lipoprotein	NA	A0A1W6JP30	Morganella_phage	67.4	4.5e-10
AVK38929.1|3691356_3691833_-	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	93.0	1.4e-82
AVK38930.1|3691825_3692017_-	putative membrane protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AVK38931.1|3693760_3693913_-	DNA methylase family protein	NA	A0A1W6JP25	Morganella_phage	80.0	3.5e-08
AVK38932.1|3694414_3695119_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38933.1|3695130_3695595_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	Q38212	Enterobacteria_phage	92.8	1.9e-73
AVK38934.1|3695777_3696335_-	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVK38935.1|3696498_3696717_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	4.4e-36
AVK38936.1|3696898_3697873_+|transposase	transposase DDE domain group 1 family protein	transposase	NA	NA	NA	NA
AVK38937.1|3697884_3698589_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38938.1|3699379_3699643_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK38939.1|3700337_3701198_-	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AVK38940.1|3701304_3702009_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38941.1|3702042_3702828_-	putative macrolide phosphotransferase K	NA	NA	NA	NA	NA
AVK38942.1|3702804_3702939_+	putative macrolide-2'-phosphotransferase	NA	NA	NA	NA	NA
AVK38943.1|3702935_3704174_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AVK38944.1|3704635_3704758_+	erythromycin resistance repressor domain protein	NA	NA	NA	NA	NA
AVK38945.1|3705268_3706090_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK38946.1|3706210_3706936_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38947.1|3707149_3707989_-	dihydropteroate synthase	NA	NA	NA	NA	NA
3707721:3707736	attL	CGCTGGGTTTCCGGTT	NA	NA	NA	NA
AVK38948.1|3708493_3709273_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVK38949.1|3710334_3711222_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
AVK38950.1|3711255_3711960_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38951.1|3712518_3713331_+	beta-lactamase NDM-1	NA	NA	NA	NA	NA
AVK38952.1|3713547_3713700_+	putative bleMBL	NA	NA	NA	NA	NA
AVK38953.1|3713872_3714343_+	N-(5'phosphoribosyl)anthranilate (PRA) isomerase family protein	NA	NA	NA	NA	NA
AVK38954.1|3714353_3715385_-	disulfide bond corrector DsbC family protein	NA	NA	NA	NA	NA
AVK38955.1|3715697_3717239_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVK38956.1|3717643_3718483_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AVK38957.1|3719029_3719818_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVK38958.1|3720579_3721593_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVK38959.1|3721994_3722699_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38960.1|3722745_3724227_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.8	1.5e-284
AVK38961.1|3725155_3725353_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38962.1|3725399_3726275_-	beta-lactamase CTX-M-1	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVK38963.1|3726427_3726550_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38964.1|3726930_3727635_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK38965.1|3727611_3727779_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK38966.1|3727914_3728226_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	7.0e-35
AVK38967.1|3728238_3728832_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	58.2	7.5e-62
AVK38968.1|3729357_3730422_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38969.1|3730646_3732896_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38970.1|3733011_3733131_-	hypothetical protein	NA	NA	NA	NA	NA
AVK38971.1|3733208_3734579_-	dnaB-like helicase N terminal domain protein	NA	A0A192Y673	Salmonella_phage	45.8	7.2e-100
AVK38972.1|3734581_3735154_-	istB-like ATP binding family protein	NA	K7PLU3	Enterobacteria_phage	51.4	3.5e-48
AVK38973.1|3735146_3735998_-	helix-turn-helix domain protein	NA	Q8W642	Enterobacteria_phage	54.8	5.0e-35
AVK38974.1|3735999_3736224_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	1.1e-21
AVK38975.1|3736241_3736694_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	57.0	1.1e-33
AVK38976.1|3736737_3736986_-	helix-turn-helix family protein	NA	A0A0U2S629	Escherichia_phage	47.2	5.6e-11
AVK38977.1|3737091_3737844_+	helix-turn-helix family protein	NA	A0A0M3LPF9	Mannheimia_phage	33.3	7.1e-25
AVK38978.1|3738201_3738411_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38979.1|3738879_3739212_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38980.1|3739227_3741225_+	putative exonuclease	NA	H9C157	Pectobacterium_phage	39.5	1.5e-125
AVK38981.1|3741221_3741719_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	65.1	1.9e-50
AVK38982.1|3741784_3741952_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38983.1|3741966_3742137_+	hypothetical protein	NA	NA	NA	NA	NA
AVK38984.1|3742370_3742589_+	hypothetical protein	NA	H9C153	Pectobacterium_phage	48.6	1.5e-12
AVK38985.1|3742627_3743614_+|integrase	phage integrase family protein	integrase	K7PLZ2	Enterobacterial_phage	62.7	1.6e-117
3747898:3747913	attR	CGCTGGGTTTCCGGTT	NA	NA	NA	NA
>prophage 11
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3783832	3821477	4139887	plate,holin,lysis,tail	Acinetobacter_phage(44.74%)	54	NA	NA
AVK39032.1|3783832_3784060_+	hot	NA	H9C187	Pectobacterium_phage	58.2	7.4e-18
AVK39033.1|3784056_3784491_-|tail	caudovirales tail fiber assembly family protein	tail	E7EKV7	Edwardsiella_phage	51.4	1.0e-12
AVK39034.1|3784478_3785540_-	hypothetical protein	NA	K4I0L0	Acinetobacter_phage	43.3	2.1e-22
AVK39035.1|3785547_3786180_-	hypothetical protein	NA	K4HYS2	Acinetobacter_phage	47.6	4.4e-44
AVK39036.1|3786179_3787370_-|plate	baseplate J-like family protein	plate	E2GM17	Acinetobacter_phage	45.5	9.4e-88
AVK39037.1|3787721_3788417_-|plate	putative phage P2 baseplate assembly protein GPV	plate	A0A2R3UAK1	Myoviridae_environmental_samples	36.5	1.6e-26
AVK39038.1|3788394_3789282_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	42.6	4.9e-65
AVK39039.1|3789271_3789544_-	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	47.8	3.4e-17
AVK39040.1|3789545_3790442_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	49.5	3.3e-45
AVK39041.1|3790465_3791248_-	hypothetical protein	NA	H6WRU9	Salmonella_phage	42.9	3.0e-42
AVK39042.1|3791314_3792043_-	BRO family, N-terminal domain protein	NA	H6WRU8	Salmonella_phage	65.2	2.5e-35
AVK39043.1|3792822_3793158_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39044.1|3793982_3794462_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39045.1|3794839_3796963_-	putative bacteriophage protein	NA	A0A1W6JPF2	Morganella_phage	62.8	4.0e-198
AVK39046.1|3796986_3797157_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39047.1|3797198_3797609_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	43.0	2.7e-18
AVK39048.1|3797608_3798004_-	putative aB1gp02	NA	A0A1V0DZ74	Acinetobacter_phage	47.7	2.3e-27
AVK39049.1|3798069_3799530_-	hypothetical protein	NA	E2GLU1	Acinetobacter_phage	41.1	2.0e-92
AVK39050.1|3799539_3800025_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39051.1|3800012_3800393_-	hypothetical protein	NA	E2GLU4	Acinetobacter_phage	40.3	8.6e-19
AVK39052.1|3800385_3800817_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	43.1	2.0e-24
AVK39053.1|3800809_3801280_-	hypothetical protein	NA	K4HYQ8	Acinetobacter_phage	45.2	6.9e-18
AVK39054.1|3801288_3801606_-	putative identified by MetaGeneAnnotator	NA	A0A1X9SFA9	Acinetobacter_phage	30.4	1.8e-06
AVK39055.1|3801665_3802661_-	hypothetical protein	NA	I2GUD7	Acinetobacter_phage	51.1	1.1e-81
AVK39056.1|3802670_3803153_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	48.1	3.4e-20
AVK39057.1|3803164_3804349_-	hypothetical protein	NA	K4I393	Acinetobacter_phage	54.0	1.2e-66
AVK39058.1|3804632_3805334_-	phage Mu F like family protein	NA	A0A068CBK2	Acinetobacter_phage	46.1	6.8e-54
AVK39059.1|3805395_3806928_-	hypothetical protein	NA	A0A192RWX3	Acinetobacter_phage	50.8	1.6e-116
AVK39060.1|3806927_3808130_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	68.1	2.8e-156
AVK39061.1|3808257_3808785_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	70.3	9.3e-48
AVK39062.1|3809173_3809716_-	kilA-N domain protein	NA	A0A1V0E5P7	Salmonella_phage	60.4	2.3e-49
AVK39063.1|3810222_3810375_+	KTSC domain protein	NA	NA	NA	NA	NA
AVK39064.1|3810404_3810854_-|lysis	bacteriophage lysis family protein	lysis	A0A1P8DTG0	Proteus_phage	54.4	5.9e-35
AVK39065.1|3810855_3811338_-	hypothetical protein	NA	A0A1U9ZAE8	Proteus_phage	70.5	1.0e-61
AVK39066.1|3811330_3811579_-|holin	putative phage holin	holin	NA	NA	NA	NA
AVK39067.1|3812363_3812480_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39068.1|3812996_3813449_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39069.1|3813580_3813781_-	bacterial regulatory, Fis family protein	NA	NA	NA	NA	NA
AVK39070.1|3813884_3814016_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39071.1|3814132_3814312_-	hypothetical protein	NA	A0A220NQY2	Salmonella_phage	69.5	1.4e-16
AVK39072.1|3814614_3814887_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	46.1	7.0e-15
AVK39073.1|3814904_3815297_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39074.1|3815293_3815491_-	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	89.2	1.2e-29
AVK39075.1|3815939_3816197_-	hypothetical protein	NA	T1S9K2	Salmonella_phage	36.7	4.4e-11
AVK39076.1|3816200_3816404_-	restriction alleviation, Lar family protein	NA	NA	NA	NA	NA
AVK39077.1|3816405_3816624_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39078.1|3816623_3816998_-	ASCH domain protein	NA	A0A1S6L2Y8	Erwinia_phage	51.2	1.6e-30
AVK39079.1|3817184_3817394_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39080.1|3817418_3818795_-	dnaB-like helicase N terminal domain protein	NA	E5AGF0	Erwinia_phage	59.6	2.1e-160
AVK39081.1|3818794_3819823_-	phage replication protein O, N-terminal domain	NA	E5AGE9	Erwinia_phage	49.9	6.4e-77
AVK39082.1|3819872_3820043_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39083.1|3820069_3820222_-	putative phage regulatory protein	NA	A0A1W6JNY4	Morganella_phage	88.0	8.4e-18
AVK39084.1|3820202_3820328_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39085.1|3821216_3821477_+	repressor protein C2	NA	A0A1P8DTH0	Proteus_phage	87.2	6.4e-42
>prophage 12
CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3829071	3891791	4139887	transposase,integrase,tRNA	Escherichia_phage(48.0%)	62	3861324:3861383	3889883:3890650
AVK39099.1|3829071_3830139_+|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	52.9	2.6e-113
AVK39100.1|3831079_3831223_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39101.1|3831539_3832910_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
AVK39102.1|3833044_3834313_+	tryptophan-specific transport protein	NA	NA	NA	NA	NA
AVK39103.1|3834340_3834550_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39104.1|3834776_3835784_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39105.1|3835986_3837255_-	nucleoside transporter, NupC family protein	NA	NA	NA	NA	NA
AVK39106.1|3837385_3838093_+	purine nucleoside phosphorylase	NA	NA	NA	NA	NA
AVK39107.1|3838164_3838674_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39108.1|3838910_3839042_-	putative membrane protein	NA	NA	NA	NA	NA
AVK39109.1|3839010_3839496_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39110.1|3839548_3840709_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AVK39111.1|3840992_3841853_-	esterase family protein	NA	NA	NA	NA	NA
AVK39112.1|3842670_3844710_-	tonB dependent receptor family protein	NA	A0A0P0I887	Acinetobacter_phage	32.3	3.4e-13
AVK39113.1|3845002_3846007_-	bacterial regulatory, lacI family protein	NA	NA	NA	NA	NA
AVK39114.1|3846105_3846438_+|tRNA	putative tRNA binding domain protein	tRNA	NA	NA	NA	NA
AVK39115.1|3846490_3847561_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AVK39116.1|3847572_3848727_-	galactokinase	NA	NA	NA	NA	NA
AVK39117.1|3848740_3849790_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AVK39118.1|3849866_3850883_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.2	5.2e-87
AVK39119.1|3851124_3852114_+	bacterial regulatory, lacI family protein	NA	NA	NA	NA	NA
AVK39120.1|3852379_3855442_+	evolved beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.8	5.3e-159
AVK39121.1|3855438_3855888_+	hypothetical protein	NA	NA	NA	NA	NA
AVK39122.1|3856016_3857225_+|transposase	transposase DDE domain protein	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVK39123.1|3857738_3858332_+	transposon Tn10 TetC protein	NA	NA	NA	NA	NA
AVK39124.1|3858444_3859650_-	tetracycline resistance protein, class B	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
3861324:3861383	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AVK39125.1|3861426_3861654_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	98.7	1.1e-37
AVK39126.1|3861698_3862076_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
AVK39127.1|3862182_3862617_-	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVK39128.1|3863363_3863786_+	merC mercury resistance family protein	NA	NA	NA	NA	NA
AVK39129.1|3864128_3865532_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	7.3e-39
AVK39130.1|3865705_3865912_+	putative merD protein	NA	NA	NA	NA	NA
AVK39131.1|3865958_3866423_-	diguanylate phosphodiesterase domain protein	NA	NA	NA	NA	NA
AVK39132.1|3866393_3866849_+	EAL domain protein	NA	NA	NA	NA	NA
AVK39133.1|3866923_3868192_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AVK39134.1|3868238_3868943_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39135.1|3869574_3870405_-	beta-lactamase OXA-1	NA	NA	NA	NA	NA
AVK39136.1|3871233_3871938_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39137.1|3872158_3872863_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39138.1|3872839_3873040_+|transposase	putative tn3 transposase DDE domain protein	transposase	NA	NA	NA	NA
AVK39139.1|3873449_3874310_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVK39140.1|3874492_3874870_-	resolvase, N terminal domain protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.4e-53
AVK39141.1|3874894_3875599_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39142.1|3875788_3876604_-	phosphotransferase enzyme family protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AVK39143.1|3876754_3877459_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39144.1|3877519_3878356_-	aminoglycoside/hydroxyurea antibiotic resistance kinase family protein	NA	NA	NA	NA	NA
AVK39145.1|3878355_3879114_-	phosphotransferase enzyme family protein	NA	Q75ZG1	Hepacivirus	34.4	6.7e-23
AVK39146.1|3879218_3879923_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AVK39147.1|3880340_3881189_-	replication C family protein	NA	NA	NA	NA	NA
AVK39148.1|3881178_3881886_-	regulatory protein RepA	NA	NA	NA	NA	NA
AVK39149.1|3881947_3882652_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK39150.1|3882628_3883396_+|transposase	transposase Tn3 family domain protein	transposase	NA	NA	NA	NA
AVK39151.1|3883611_3883962_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39152.1|3884389_3884512_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39153.1|3884825_3885386_+	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVK39154.1|3885613_3888355_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVK39155.1|3888445_3888562_-	hypothetical protein	NA	NA	NA	NA	NA
AVK39156.1|3888619_3888799_+	putative ybjA protein	NA	NA	NA	NA	NA
AVK39157.1|3888999_3889659_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AVK39158.1|3889985_3890213_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	98.7	1.1e-37
AVK39159.1|3890257_3890635_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
AVK39160.1|3890645_3891791_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	3.3e-223
3889883:3890650	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
