The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	596085	629517	5211570	holin,integrase,tRNA,transposase	Shigella_phage(25.0%)	35	621534:621547	626856:626869
AVJ71711.1|596085_598941_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AVJ71205.1|598940_599384_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVJ68626.1|599737_601249_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVJ68685.1|601473_601602_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ73523.1|601608_602616_+	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AVJ71900.1|602615_603698_+	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AVJ70519.1|603858_605361_-	AAA-like domain protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
AVJ69069.1|605438_606437_-	periplasmic binding and sugar binding domain of LacI family protein	NA	NA	NA	NA	NA
AVJ72589.1|606503_607823_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
AVJ72723.1|607885_608650_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AVJ69670.1|608673_609705_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AVJ72739.1|609921_610485_+	carbohydrate kinase, thermoresistant glucokinase family protein	NA	NA	NA	NA	NA
AVJ71069.1|610488_611508_-	zinc-binding dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AVJ72924.1|612048_613239_+|integrase	phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AVJ70174.1|613639_613882_-	putative pstB	NA	NA	NA	NA	NA
AVJ73146.1|614005_614341_-	sulfatase family protein	NA	NA	NA	NA	NA
AVJ71188.1|614394_614742_-	putative lipoprotein	NA	NA	NA	NA	NA
AVJ73024.1|615894_616038_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69827.1|616065_617394_-|transposase	insertion element 4 transposase N-terminal family protein	transposase	NA	NA	NA	NA
AVJ73495.1|617705_617852_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72547.1|618020_619238_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AVJ69487.1|619249_620368_+	oxidoreductase family, C-terminal alpha/beta domain protein	NA	NA	NA	NA	NA
AVJ71257.1|620410_620536_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72335.1|620588_620819_-	putative yjhD protein	NA	NA	NA	NA	NA
AVJ71225.1|620823_621072_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ69206.1|621159_621432_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	97.7	1.0e-37
AVJ70623.1|621505_622327_+	DDE domain protein	NA	Q716C2	Shigella_phage	99.3	3.2e-164
621534:621547	attL	GATACTGGAAAAAC	NA	NA	NA	NA
AVJ72422.1|622737_624741_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AVJ70665.1|624888_625707_-	HTH-like domain protein	NA	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
AVJ72562.1|625742_626045_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVJ71448.1|626270_626657_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	97.1	6.2e-57
AVJ73487.1|626978_627236_+	hypothetical protein	NA	NA	NA	NA	NA
626856:626869	attR	GATACTGGAAAAAC	NA	NA	NA	NA
AVJ68780.1|627792_628404_-	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.6e-05
AVJ69137.1|628387_628528_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72336.1|628560_629517_-	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
>prophage 2
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	635931	685436	5211570	integrase,transposase	Escherichia_phage(33.33%)	56	644097:644111	688388:688402
AVJ69866.1|635931_636117_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	85.2	7.3e-24
AVJ73434.1|636117_636327_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
AVJ69878.1|637087_637345_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AVJ71436.1|637507_637621_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69976.1|638095_639454_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AVJ70759.1|639692_641078_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	5.0e-258
AVJ71889.1|641127_641475_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AVJ71250.1|641899_642028_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69119.1|642206_642641_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70320.1|643289_643859_-	hypothetical protein	NA	NA	NA	NA	NA
644097:644111	attL	CGCGATTACTCATAA	NA	NA	NA	NA
AVJ71509.1|645382_645589_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVJ70421.1|645683_646286_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69802.1|646607_648092_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72976.1|648286_648403_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68874.1|648526_648643_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72791.1|648873_648996_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69219.1|649322_650195_+	miro-like family protein	NA	NA	NA	NA	NA
AVJ71163.1|650567_653687_+	antigen 43	NA	NA	NA	NA	NA
AVJ73288.1|653757_653916_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ73522.1|654070_654889_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
AVJ68622.1|655230_655413_+	intergenic-region protein	NA	NA	NA	NA	NA
AVJ70221.1|655468_655702_+	intergenic-region protein	NA	NA	NA	NA	NA
AVJ73256.1|655717_656194_+	DNA repair RadC family protein	NA	NA	NA	NA	NA
AVJ71473.1|656256_656478_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AVJ70285.1|656477_656591_+	putative intergenic-region protein	NA	NA	NA	NA	NA
AVJ69515.1|656760_657009_+	yagB/YeeU/YfjZ family protein	NA	NA	NA	NA	NA
AVJ71406.1|657935_659195_+	5-methylthioribose kinase	NA	NA	NA	NA	NA
AVJ71059.1|659204_660320_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AVJ71134.1|660350_660992_+	L-fuculose phosphate aldolase	NA	NA	NA	NA	NA
AVJ68629.1|661131_662100_+	sugar transport family protein	NA	NA	NA	NA	NA
AVJ71421.1|662140_663127_-	helix-turn-helix family protein	NA	NA	NA	NA	NA
AVJ73071.1|663164_663287_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69728.1|663473_664823_-	H+ symporter family protein	NA	NA	NA	NA	NA
AVJ72002.1|664929_666897_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70713.1|666907_667813_-	putative 2-keto-3-deoxy-galactonate aldolase YagE	NA	NA	NA	NA	NA
AVJ70012.1|667817_668606_-	bacterial transcriptional regulator family protein	NA	NA	NA	NA	NA
AVJ70716.1|668645_668792_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71277.1|668908_669691_-	deoR-like helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVJ72121.1|669707_670340_-	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
AVJ70670.1|670351_670783_-	phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 family protein	NA	NA	NA	NA	NA
AVJ70024.1|670913_671720_-	putative sgc region protein SgcQ	NA	NA	NA	NA	NA
AVJ69764.1|671732_673046_-	PTS system, galactitol-specific IIC component family protein	NA	NA	NA	NA	NA
AVJ71389.1|673057_673303_-	PTS system, Lactose/Cellobiose specific IIB subunit	NA	NA	NA	NA	NA
AVJ70584.1|673332_674454_-	M42 glutamyl aminopeptidase family protein	NA	NA	NA	NA	NA
AVJ68760.1|675239_675986_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69945.1|676041_676587_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AVJ72827.1|676598_676856_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69753.1|677346_677478_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70217.1|677641_677851_+	superfamily I DNA helicase	NA	NA	NA	NA	NA
AVJ68873.1|678372_678834_+	phospholipase D family protein	NA	NA	NA	NA	NA
AVJ69186.1|679416_680397_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
AVJ72070.1|680461_681568_-	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AVJ70757.1|681587_682136_-	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AVJ73508.1|682969_683107_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68688.1|683759_684362_+|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AVJ70930.1|684839_685436_+|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
688388:688402	attR	TTATGAGTAATCGCG	NA	NA	NA	NA
>prophage 3
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	1215742	1270795	5211570	integrase,tRNA,protease,transposase	Bacillus_phage(28.57%)	53	1213805:1213819	1219757:1219771
1213805:1213819	attL	GCATCAAAACGCTGG	NA	NA	NA	NA
AVJ69327.1|1215742_1216345_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	56.8	9.9e-62
AVJ72932.1|1216344_1216629_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVJ69278.1|1216782_1218051_-	protein AraJ	NA	NA	NA	NA	NA
AVJ69142.1|1218092_1221236_-	exonuclease SbcC family protein	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
1219757:1219771	attR	CCAGCGTTTTGATGC	NA	NA	NA	NA
AVJ70671.1|1221232_1222435_-	exonuclease SbcCD, D subunit	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVJ71809.1|1222624_1223314_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVJ69500.1|1223371_1224667_+	phosphate regulon sensor kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
AVJ72007.1|1225073_1226393_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AVJ70128.1|1226587_1227046_+|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
AVJ70335.1|1227179_1228553_+	proline-specific permease ProY	NA	NA	NA	NA	NA
AVJ70554.1|1228708_1230526_+	alpha amylase, N-terminal ig-like domain protein	NA	NA	NA	NA	NA
AVJ72695.1|1230711_1232169_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68830.1|1232189_1232771_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71286.1|1232989_1234060_+|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AVJ72713.1|1234115_1235243_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AVJ72113.1|1235265_1235598_+	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVJ68777.1|1235658_1237473_+	protein-export membrane protein SecD	NA	NA	NA	NA	NA
AVJ70809.1|1237483_1238455_+	protein-export membrane protein SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVJ70610.1|1238649_1239108_+|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
AVJ72498.1|1239294_1239642_+	HNH endonuclease family protein	NA	NA	NA	NA	NA
AVJ69905.1|1239679_1240564_-	nucleoside-specific channel-forming protein tsx	NA	NA	NA	NA	NA
AVJ73459.1|1240861_1241149_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71577.1|1241472_1241745_-|transposase	transposase IS200 like family protein	transposase	A0A1S5RHE3	Helicobacter_phage	65.6	1.9e-28
AVJ68740.1|1241827_1242925_+|transposase	transposase, IS605 OrfB family	transposase	A0A1W6JP07	Morganella_phage	96.2	4.0e-194
AVJ70298.1|1242960_1243149_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72522.1|1243425_1243749_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVJ69523.1|1243770_1244856_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.3	1.3e-51
AVJ69423.1|1244944_1245415_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVJ70525.1|1245434_1245854_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AVJ71849.1|1245931_1246909_+	thiamine-monophosphate kinase	NA	NA	NA	NA	NA
AVJ69832.1|1246886_1247402_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AVJ69485.1|1247578_1249150_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
AVJ71520.1|1249380_1250355_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
AVJ71058.1|1250409_1252272_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AVJ71224.1|1252296_1253196_-	farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AVJ72176.1|1253195_1253438_-	exodeoxyribonuclease VII, small subunit	NA	NA	NA	NA	NA
AVJ68803.1|1253643_1255092_+|tRNA	tRNA sulfurtransferase ThiI	tRNA	NA	NA	NA	NA
AVJ72179.1|1255145_1255736_-	DJ-1 family protein	NA	NA	NA	NA	NA
AVJ69381.1|1255698_1256610_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVJ72570.1|1256777_1257269_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71141.1|1257396_1258689_-	inner membrane transport protein YajR	NA	NA	NA	NA	NA
AVJ71984.1|1258909_1259797_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AVJ68644.1|1259811_1260087_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AVJ71523.1|1260140_1260656_-	cytochrome o ubiquinol oxidase, subunit III	NA	NA	NA	NA	NA
AVJ70313.1|1260744_1262685_-	cytochrome o ubiquinol oxidase, subunit I	NA	NA	NA	NA	NA
AVJ69068.1|1262757_1263645_-	ubiquinol oxidase, subunit II	NA	NA	NA	NA	NA
AVJ72505.1|1264164_1265640_-	ampG-like permease family protein	NA	NA	NA	NA	NA
AVJ72674.1|1265683_1266262_-	prokaryotic membrane lipolipid attachment site family protein	NA	NA	NA	NA	NA
AVJ69889.1|1266569_1266884_+	protein BolA	NA	NA	NA	NA	NA
AVJ73537.1|1266892_1267081_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71132.1|1267227_1268526_+	trigger factor	NA	NA	NA	NA	NA
AVJ71907.1|1268771_1269395_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AVJ71166.1|1269520_1270795_+|protease	ATP-dependent Clp protease, ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
>prophage 4
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2000745	2078340	5211570	head,transposase,lysis,portal,capsid,terminase,integrase,tail,tRNA	Enterobacteria_phage(36.36%)	92	2001873:2001888	2045188:2045203
AVJ71929.1|2000745_2001204_+|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
AVJ70103.1|2001325_2002285_-	putative L,D-transpeptidase YcfS	NA	NA	NA	NA	NA
2001873:2001888	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
AVJ69474.1|2002431_2005878_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AVJ70762.1|2006005_2007079_-	inner membrane protein YcfT	NA	NA	NA	NA	NA
AVJ72964.1|2007339_2008539_+	liporeleasing system, transmembrane, LolC/E family protein	NA	NA	NA	NA	NA
AVJ69457.1|2008531_2009233_+	liporeleasing system, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
AVJ70943.1|2009232_2010477_+	liporeleasing system, transmembrane protein LolE	NA	NA	NA	NA	NA
AVJ73572.1|2010505_2011417_+	glucokinase family protein	NA	NA	NA	NA	NA
AVJ72909.1|2011432_2012254_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AVJ71864.1|2012390_2013176_-	inner membrane protein YcfZ	NA	NA	NA	NA	NA
AVJ73500.1|2013172_2013634_-	inner membrane protein YmfA	NA	NA	NA	NA	NA
AVJ71991.1|2013691_2014738_-	putative lipo family protein	NA	NA	NA	NA	NA
AVJ68858.1|2014734_2015529_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AVJ72635.1|2015695_2016715_-|integrase	phage integrase family protein	integrase	Q77Z04	Phage_21	43.6	3.1e-79
AVJ70891.1|2016782_2017052_-	excisionase-like family protein	NA	NA	NA	NA	NA
AVJ68680.1|2017113_2019570_-	enterobacterial exodeoxyribonuclease VIII family protein	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
AVJ73403.1|2019647_2019851_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70806.1|2020046_2020901_-	phage regulatory, Rha family protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AVJ70864.1|2021203_2021341_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72896.1|2021431_2021806_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72230.1|2021817_2022024_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70122.1|2022176_2022584_-	helix-turn-helix domain protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AVJ69420.1|2022660_2022888_+	putative transcriptional repressor of cell division inhibition protein	NA	NA	NA	NA	NA
AVJ70090.1|2022931_2023423_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71484.1|2023394_2024435_+	putative primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
AVJ70832.1|2024466_2024889_+	putative phage replication protein P	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
AVJ69362.1|2024922_2025693_+	HTH domain protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AVJ73183.1|2025708_2026101_+	hypothetical protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
AVJ68679.1|2026097_2026394_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AVJ71123.1|2026390_2026852_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AVJ70683.1|2026829_2027186_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AVJ70880.1|2027530_2027689_+	putative ycgB protein	NA	A0A0A7NRY2	Enterobacteria_phage	89.6	3.0e-18
AVJ72718.1|2027690_2028056_+	HNH endonuclease family protein	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AVJ71726.1|2028052_2029039_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AVJ71539.1|2029213_2029339_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ68681.1|2029791_2029908_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69678.1|2029969_2030221_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68870.1|2030567_2031626_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AVJ69197.1|2031626_2031995_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AVJ69140.1|2031987_2032677_+	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AVJ71305.1|2032853_2033087_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	3.7e-33
AVJ70553.1|2033062_2033176_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ73105.1|2033456_2033642_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.7	6.4e-20
AVJ72742.1|2033917_2034067_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72038.1|2034052_2034241_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	96.8	1.9e-27
AVJ69790.1|2034237_2034399_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AVJ70196.1|2034548_2034764_+|lysis	lysis S family protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AVJ73043.1|2034768_2035659_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	70.6	3.6e-108
AVJ71321.1|2035695_2036229_+	phage lysozyme family protein	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
AVJ72777.1|2036388_2036526_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
AVJ69232.1|2036527_2036995_+|lysis	bacteriophage lysis family protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
AVJ71683.1|2037608_2037953_+	phage DNA packaging Nu1 family protein	NA	NA	NA	NA	NA
AVJ71194.1|2038005_2039853_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.6	7.3e-257
AVJ70674.1|2039836_2040043_+|head,tail	phage head-to-tail joining family protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AVJ69496.1|2040039_2041632_+|portal	phage portal protein, lambda family	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AVJ71526.1|2041621_2043070_+	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
AVJ70173.1|2043106_2043454_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AVJ71728.1|2043511_2044540_+|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
AVJ69468.1|2044591_2044966_+	DNA packaging FI family protein	NA	NA	NA	NA	NA
AVJ72746.1|2044958_2045312_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
2045188:2045203	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
AVJ72832.1|2045327_2045861_+|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
AVJ70197.1|2045857_2046253_+|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVJ69534.1|2046260_2047010_+|tail	phage tail family protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
AVJ68846.1|2047028_2047460_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
AVJ72702.1|2047510_2047900_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.4	2.5e-37
AVJ73515.1|2047880_2050442_+|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AVJ73074.1|2050438_2050768_+|tail	phage minor tail family protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
AVJ70393.1|2050767_2051466_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
AVJ69875.1|2051476_2052220_+	nlpC/P60 family protein	NA	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AVJ72330.1|2052216_2052798_+|tail	bacteriophage lambda tail assembly I family protein	tail	H6WZM5	Escherichia_phage	96.9	4.0e-92
AVJ70093.1|2053141_2056834_+	hypothetical protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
AVJ72766.1|2056901_2057501_+	outer membrane beta-barrel domain protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AVJ70842.1|2058149_2058887_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ73456.1|2058938_2059085_-	hypothetical protein	NA	Q8W769	Escherichia_phage	79.2	1.1e-06
AVJ71817.1|2059914_2060679_+|tail	phage tail fiber repeat family protein	tail	K7PHC9	Enterobacteria_phage	64.7	1.2e-40
AVJ71615.1|2060678_2061263_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AVJ73014.1|2062042_2062309_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AVJ70994.1|2062540_2063374_-	binding-protein-dependent transport system inner membrane component family protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.5e-11
AVJ73206.1|2063387_2064524_-	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVJ70912.1|2064502_2064718_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71754.1|2064773_2066000_+	peptidase T	NA	NA	NA	NA	NA
AVJ70188.1|2066048_2067170_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AVJ68738.1|2067245_2068706_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AVJ69167.1|2068705_2069377_-	transcriptional regulatory protein PhoP	NA	NA	NA	NA	NA
AVJ69217.1|2069546_2070917_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AVJ72642.1|2070920_2071562_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
AVJ71600.1|2071597_2072704_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
AVJ69334.1|2072757_2073219_-	phosphatase NudJ	NA	NA	NA	NA	NA
AVJ69469.1|2073228_2073762_-	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AVJ72938.1|2074117_2074240_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72573.1|2075566_2076817_+	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	98.1	6.5e-23
AVJ69331.1|2077881_2078340_+|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
>prophage 5
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2295307	2353499	5211570	transposase,holin,lysis,terminase,integrase,tail,tRNA,coat	Escherichia_phage(49.02%)	67	2286203:2286218	2329187:2329202
2286203:2286218	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
AVJ72369.1|2295307_2296240_-	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	39.5	2.3e-17
AVJ72963.1|2296498_2297002_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.8	3.1e-85
AVJ70587.1|2297571_2298555_+	zinc transport protein ZntB	NA	NA	NA	NA	NA
AVJ70935.1|2298517_2298658_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ70161.1|2299032_2300406_+	ATP-independent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVJ72195.1|2300534_2301470_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVJ70639.1|2301521_2302127_-|integrase	phage integrase family protein	integrase	A0A0U2JGI6	Escherichia_phage	99.5	7.8e-115
AVJ70443.1|2302758_2302974_-	putative excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVJ71013.1|2303073_2303334_-	double-strand break reduction domain protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.6e-27
AVJ70098.1|2303504_2304314_-	protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AVJ73031.1|2304306_2306907_-	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AVJ71366.1|2307008_2307284_-	putative phage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AVJ69379.1|2307528_2307750_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AVJ73090.1|2308191_2308680_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
AVJ69418.1|2308842_2309022_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69501.1|2309264_2309684_-	helix-turn-helix family protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AVJ72019.1|2309763_2310018_+	putative 8.4 kDa cro protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AVJ70620.1|2310014_2310437_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AVJ71622.1|2310514_2311303_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AVJ69811.1|2311309_2312056_+	istB-like ATP binding family protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
AVJ70758.1|2312078_2312840_+	feoC like transcriptional regulator family protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
AVJ69372.1|2312855_2313278_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
AVJ68878.1|2313439_2313943_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
AVJ70916.1|2314063_2314837_-	kilA-N domain protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
AVJ70573.1|2315567_2315777_-	tellurite resistance protein B	NA	NA	NA	NA	NA
AVJ71537.1|2316776_2317376_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AVJ73272.1|2317375_2317666_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AVJ69579.1|2317662_2318205_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AVJ72955.1|2318181_2318298_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70303.1|2318861_2318996_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71806.1|2319343_2319685_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
AVJ70578.1|2319688_2320165_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
AVJ71952.1|2320161_2320626_+|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	93.4	4.0e-71
AVJ70023.1|2320796_2322221_+	trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AVJ69690.1|2322358_2323150_+	parB-like nuclease domain protein	NA	R4TG31	Halovirus	40.2	2.8e-48
AVJ71917.1|2323142_2324075_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
AVJ68635.1|2324052_2324262_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68670.1|2324265_2325360_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
AVJ73102.1|2325334_2326642_+|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	59.4	3.6e-149
AVJ73430.1|2326644_2328051_+	hypothetical protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AVJ70282.1|2328034_2329147_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
AVJ71688.1|2329251_2330016_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2329187:2329202	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
AVJ71343.1|2330114_2331254_+|coat	P22 coat family protein	coat	G8C7P7	Escherichia_phage	75.0	9.7e-159
AVJ72482.1|2331296_2331473_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
AVJ73126.1|2331476_2331872_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68757.1|2331871_2332255_+	putative glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AVJ69033.1|2332255_2332636_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.5e-18
AVJ72786.1|2332632_2333025_+	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AVJ72831.1|2333051_2334014_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
AVJ73068.1|2334074_2334524_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71504.1|2334691_2334832_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ70206.1|2334995_2338229_+|tail	phage tail tape measure protein, lambda family	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
AVJ68957.1|2338263_2338560_+|tail	phage minor tail family protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
AVJ68843.1|2338559_2339258_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
AVJ69183.1|2339263_2340007_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
AVJ70598.1|2340003_2340546_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A291AWV5	Escherichia_phage	83.0	1.1e-75
AVJ70963.1|2340606_2344086_+	fibronectin type III family protein	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AVJ70981.1|2344153_2344753_+	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AVJ68912.1|2345182_2345623_-	putative membrane protein	NA	NA	NA	NA	NA
AVJ70351.1|2345771_2347217_+|tail	putative tail fiber domain protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	2.3e-133
AVJ72918.1|2347213_2347495_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AVJ68847.1|2347618_2348209_+|tail	putative phage tail fiber protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.7e-58
AVJ71009.1|2348219_2348513_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72489.1|2348740_2349331_-	putative DNA-invertase from lambdoid prophage Rac	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVJ69427.1|2349647_2349764_-	putative dNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	78.9	2.2e-10
AVJ71903.1|2350666_2351950_+	H+ symporter family protein	NA	NA	NA	NA	NA
AVJ68834.1|2352038_2353499_+	mannitol dehydrogenase Rossmann domain protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 6
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2502100	2612529	5211570	head,transposase,lysis,portal,capsid,terminase,integrase,tail	Enterobacteria_phage(39.62%)	113	2557317:2557332	2606531:2606546
AVJ72638.1|2502100_2502559_-|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
AVJ69539.1|2502736_2503405_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70845.1|2503707_2504301_-	tellurite resistance protein TehB	NA	NA	NA	NA	NA
AVJ73275.1|2504297_2505290_-	tellurite resistance protein TehA	NA	NA	NA	NA	NA
AVJ73299.1|2505413_2506394_+	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AVJ69834.1|2506385_2506925_-	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
AVJ72577.1|2506987_2507212_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71073.1|2507351_2508971_-	glucans biosynthesis protein D	NA	NA	NA	NA	NA
AVJ70083.1|2509231_2510524_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72046.1|2510791_2511715_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVJ73110.1|2511752_2513393_-	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
AVJ70502.1|2514012_2514165_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	69.8	6.6e-07
AVJ71171.1|2514430_2514961_-	prokaryotic cytochrome b561 family protein	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
AVJ70097.1|2515149_2516151_+	glyceraldehyde-3-phosphate dehydrogenase, type I	NA	NA	NA	NA	NA
AVJ73293.1|2516192_2517608_-	lactaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVJ69778.1|2517828_2518629_-	protein YdcF	NA	NA	NA	NA	NA
AVJ70072.1|2518744_2518858_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72863.1|2519241_2519685_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71289.1|2519677_2519839_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71185.1|2520300_2524203_-	ATP-dependent helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AVJ73494.1|2524403_2525009_+	NADPH-dependent FMN reductase family protein	NA	NA	NA	NA	NA
AVJ73296.1|2525062_2526331_-	protein-tyrosine phosphatase family protein	NA	NA	NA	NA	NA
AVJ69505.1|2526368_2527955_-	methyltransferase domain protein	NA	NA	NA	NA	NA
AVJ73295.1|2528141_2528609_-	cytidylyltransferase family protein	NA	NA	NA	NA	NA
AVJ70524.1|2528816_2529038_-	putative membrane protein	NA	NA	NA	NA	NA
AVJ69569.1|2529037_2529643_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AVJ72303.1|2529813_2531379_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72685.1|2532183_2533044_-	putative oxidoreductase YdbC	NA	NA	NA	NA	NA
AVJ71743.1|2533251_2538210_-	autotransporter beta-domain protein	NA	NA	NA	NA	NA
AVJ71316.1|2539629_2539749_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69611.1|2539733_2540000_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72930.1|2540064_2540250_-	ynbE-like lipofamily protein	NA	NA	NA	NA	NA
AVJ70270.1|2540246_2542886_-	dicarboxylate transport family protein	NA	NA	NA	NA	NA
AVJ69150.1|2543093_2544083_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AVJ72517.1|2544193_2544616_+	heat shock protein HslJ	NA	NA	NA	NA	NA
AVJ73252.1|2544612_2544738_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70987.1|2544965_2545082_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69887.1|2545152_2548677_+	ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AVJ68677.1|2549043_2550177_+	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AVJ72118.1|2550317_2550752_+	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	52.8	3.0e-28
AVJ72104.1|2551459_2552251_+	periplasmic solute binding family protein	NA	NA	NA	NA	NA
AVJ72177.1|2552250_2553078_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AVJ70457.1|2553080_2553932_+	ABC 3 transport family protein	NA	NA	NA	NA	NA
AVJ69454.1|2553928_2554786_+	ABC 3 transport family protein	NA	NA	NA	NA	NA
AVJ69335.1|2555258_2556053_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68785.1|2556598_2556892_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70384.1|2556934_2557699_-	chaperone of endosialidase family protein	NA	A0A0E3M4A9	Enterobacteria_phage	76.3	1.5e-102
2557317:2557332	attL	GCATGACATGCACCAT	NA	NA	NA	NA
AVJ72228.1|2557984_2558266_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AVJ71429.1|2558265_2559687_-|tail	putative tail fiber domain protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.1e-167
AVJ71936.1|2559835_2560276_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ71908.1|2560761_2561220_-|transposase	transposase IS200 like family protein	transposase	NA	NA	NA	NA
AVJ69851.1|2561416_2562016_-	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AVJ68827.1|2562083_2565563_-	fibronectin type III family protein	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AVJ71814.1|2565623_2566166_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A291AWV5	Escherichia_phage	83.0	1.1e-75
AVJ71788.1|2566162_2566906_-	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AVJ70966.1|2566911_2567610_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AVJ70511.1|2567609_2567939_-|tail	phage minor tail family protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AVJ71887.1|2567935_2570497_-|tail	phage tail tape measure protein, lambda family	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AVJ73368.1|2570489_2570924_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVJ68776.1|2570905_2571328_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVJ71629.1|2571343_2572057_-|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.0e-126
AVJ73037.1|2572091_2572487_-|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AVJ69919.1|2572483_2572723_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.6e-37
AVJ69359.1|2572802_2573063_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	5.6e-30
AVJ72436.1|2573074_2573428_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AVJ72170.1|2573439_2573838_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AVJ72923.1|2573879_2574899_-|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.3e-191
AVJ69663.1|2574959_2575292_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AVJ71552.1|2575301_2576621_-	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AVJ71626.1|2576601_2578203_-|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AVJ72541.1|2578199_2578406_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVJ71282.1|2578402_2580328_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AVJ70722.1|2580302_2580848_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AVJ71843.1|2581296_2581470_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	76.7	1.9e-10
AVJ70517.1|2582089_2582266_-	gnsA/GnsB family protein	NA	NA	NA	NA	NA
AVJ70838.1|2582936_2583137_-	cold shock-like protein CspG	NA	A0A1W6JNX5	Morganella_phage	74.2	3.7e-21
AVJ73117.1|2583511_2583994_-	hypothetical protein	NA	A0A291LBG9	Klebsiella_phage	29.9	2.8e-06
AVJ68849.1|2584005_2584539_-	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVJ71244.1|2584535_2584847_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVJ72411.1|2584851_2585067_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVJ71746.1|2585820_2586036_-	cold shock protein CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVJ71671.1|2586348_2586549_+	cold-shock DNA-binding domain protein	NA	NA	NA	NA	NA
AVJ71208.1|2586783_2586939_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ73257.1|2586970_2587723_-	antitermination family protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVJ69716.1|2587736_2588690_-	hypothetical protein	NA	Q8SBE5	Shigella_phage	58.4	3.3e-104
AVJ69321.1|2589132_2589384_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72053.1|2589445_2589562_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70678.1|2590114_2590354_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVJ69103.1|2590886_2591219_+	flxA-like family protein	NA	NA	NA	NA	NA
AVJ72618.1|2591655_2592969_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AVJ70988.1|2593452_2594481_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71475.1|2595300_2595867_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72795.1|2596168_2596441_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	92.2	5.7e-41
AVJ72174.1|2596607_2597573_-	putative ybl78	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
AVJ72625.1|2597553_2598075_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72150.1|2598639_2598774_+	putative transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	52.3	2.9e-06
AVJ72192.1|2598888_2599098_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	5.4e-07
AVJ69271.1|2599117_2599675_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72840.1|2599895_2600051_-	putative ybl82 protein	NA	NA	NA	NA	NA
AVJ71870.1|2600022_2600136_-	putative ybl82 protein	NA	NA	NA	NA	NA
AVJ70925.1|2600161_2600350_+	dicB family protein	NA	NA	NA	NA	NA
AVJ69585.1|2600346_2600538_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ70263.1|2600631_2603103_+	putative exonuclease VIII	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AVJ72352.1|2603175_2603427_+	hypothetical protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVJ70085.1|2603461_2604742_+|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
AVJ73574.1|2604929_2605949_-	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVJ72527.1|2605960_2607175_-	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
2606531:2606546	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
AVJ69859.1|2607380_2607707_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AVJ70215.1|2607841_2608183_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ73182.1|2608217_2608778_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AVJ70729.1|2608780_2609404_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ71402.1|2609598_2609904_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71441.1|2610102_2612529_+	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 7
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2862239	2953375	5211570	head,lysis,portal,protease,capsid,terminase,integrase,tail,tRNA	Enterobacteria_phage(44.78%)	110	2939222:2939237	2958886:2958901
AVJ72041.1|2862239_2863079_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVJ70594.1|2863312_2865361_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	3.0e-86
AVJ72743.1|2865380_2866079_-	proP effector	NA	NA	NA	NA	NA
AVJ73022.1|2866175_2866673_-	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AVJ68720.1|2866802_2868086_+	inner membrane protein YebS	NA	NA	NA	NA	NA
AVJ71632.1|2868054_2870688_+	mce related family protein	NA	NA	NA	NA	NA
AVJ71104.1|2870812_2872207_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AVJ70954.1|2872324_2872561_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72855.1|2872665_2872857_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69421.1|2872857_2873514_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.7	2.8e-57
AVJ69499.1|2873909_2874248_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70142.1|2874263_2875136_-	inner membrane protein YebZ	NA	NA	NA	NA	NA
AVJ69597.1|2875139_2875514_-	protein YobA	NA	NA	NA	NA	NA
AVJ71584.1|2875652_2875883_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVJ70989.1|2875984_2876641_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVJ70789.1|2876664_2877327_+	exodeoxyribonuclease 10	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AVJ70597.1|2877323_2879384_-|protease	protease 2	protease	NA	NA	NA	NA
AVJ69622.1|2879592_2880252_-	inner membrane protein YebE	NA	NA	NA	NA	NA
AVJ72276.1|2880578_2880935_-	protein YebF	NA	NA	NA	NA	NA
AVJ72081.1|2881001_2881292_-	yebG family protein	NA	NA	NA	NA	NA
AVJ72078.1|2881425_2882604_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AVJ72028.1|2882658_2883300_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AVJ70561.1|2883336_2885148_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AVJ72703.1|2885382_2886858_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AVJ69357.1|2887023_2887173_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68765.1|2887195_2888065_+	SIS domain protein	NA	NA	NA	NA	NA
AVJ70019.1|2888192_2889635_+	pyruvate kinase	NA	NA	NA	NA	NA
AVJ73202.1|2889766_2890738_-	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
AVJ71926.1|2890856_2892179_-	opacity-associated A LysM-like domain protein	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AVJ70547.1|2892194_2893127_-	high-affinity zinc uptake system protein ZnuA	NA	NA	NA	NA	NA
AVJ72561.1|2893205_2893961_+	zinc import ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVJ71242.1|2893957_2894743_+	high-affinity zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
AVJ69850.1|2894892_2895903_-	holliday junction DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVJ68607.1|2895911_2896523_-	holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AVJ72579.1|2896484_2896631_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69143.1|2896797_2897400_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ70092.1|2897401_2897923_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AVJ72124.1|2897957_2898698_-	DNA-binding regulatory, YebC/PmpR family protein	NA	NA	NA	NA	NA
AVJ73385.1|2898726_2899110_-	dihydroneopterin triphosphate pyrophosphatase	NA	NA	NA	NA	NA
AVJ71836.1|2899296_2901030_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVJ71955.1|2901378_2901945_+	isochorismatase family protein	NA	NA	NA	NA	NA
AVJ72683.1|2902026_2902143_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69853.1|2902299_2902548_+	dinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AVJ71998.1|2902663_2903248_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AVJ69656.1|2903247_2904012_-|tail	phage tail fiber repeat family protein	tail	K7PHC9	Enterobacteria_phage	64.7	1.2e-40
AVJ68704.1|2904905_2905046_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70442.1|2905039_2905777_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69510.1|2906425_2907025_-	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
AVJ71709.1|2907092_2910566_-	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
AVJ70959.1|2910909_2911491_-|tail	bacteriophage lambda tail assembly I family protein	tail	Q9EYE5	Enterobacteria_phage	91.1	4.0e-92
AVJ71771.1|2911487_2912231_-	nlpC/P60 family protein	NA	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
AVJ70479.1|2912241_2912880_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	96.2	4.2e-119
AVJ72260.1|2912939_2913269_-|tail	phage minor tail family protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AVJ72229.1|2913265_2915839_-|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
AVJ73527.1|2915819_2916209_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.7	1.1e-37
AVJ70112.1|2916259_2916691_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	4.8e-42
AVJ72687.1|2916704_2917457_-|tail	phage tail family protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AVJ71914.1|2917464_2917860_-|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVJ69586.1|2917856_2918432_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
AVJ69760.1|2918447_2918801_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
AVJ72037.1|2918812_2919199_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.2	1.2e-52
AVJ68807.1|2919240_2920260_-|capsid	phage major capsid E family protein	capsid	A0A2I6TCE5	Escherichia_phage	98.2	4.3e-190
AVJ72397.1|2920322_2920655_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AVJ69438.1|2920664_2921984_-|protease	clp protease family protein	protease	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
AVJ70707.1|2921964_2923566_-|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
AVJ72430.1|2923562_2923769_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVJ70774.1|2923765_2925691_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
AVJ69506.1|2925665_2926211_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
AVJ70978.1|2926652_2927120_-|lysis	bacteriophage lysis family protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
AVJ73271.1|2927121_2927259_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
AVJ73370.1|2927418_2927952_-	phage lysozyme family protein	NA	Q6H9V6	Enterobacteria_phage	96.0	7.4e-101
AVJ73443.1|2928002_2928347_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
AVJ71354.1|2928351_2928567_-|lysis	lysis S family protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
AVJ71695.1|2928717_2930571_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	91.1	0.0e+00
AVJ71957.1|2931359_2932409_-	DNA methylase family protein	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
AVJ72975.1|2932436_2932583_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69902.1|2932558_2932756_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AVJ71838.1|2932918_2933716_-	putative transmembrane protein	NA	A0A0M4R2T6	Salmonella_phage	32.3	3.4e-25
AVJ72634.1|2933722_2933950_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72025.1|2934222_2934912_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	47.2	2.7e-55
AVJ72077.1|2934908_2935232_-	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	63.8	5.2e-33
AVJ70749.1|2935280_2936198_-	hypothetical protein	NA	U5P0K4	Shigella_phage	93.8	3.3e-173
AVJ69856.1|2936322_2936580_-	putative bacteriophage protein	NA	Q8W639	Enterobacteria_phage	68.8	4.7e-21
AVJ71280.1|2936576_2937977_-	dnaB-like helicase N terminal domain protein	NA	Q8W640	Enterobacteria_phage	91.8	3.2e-244
AVJ72939.1|2937973_2938591_-	istB-like ATP binding family protein	NA	Q8W641	Enterobacteria_phage	97.1	9.7e-113
AVJ68619.1|2938883_2939840_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	1.7e-55
2939222:2939237	attL	ATTCCGGTGAATATTC	NA	NA	NA	NA
AVJ70614.1|2940162_2940333_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69869.1|2940383_2940578_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ72852.1|2940574_2941426_-	phage regulatory, Rha family protein	NA	A0A1C9IHV9	Salmonella_phage	66.5	3.1e-93
AVJ73259.1|2941534_2942242_-	phage regulatory Rha family protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
AVJ69472.1|2942577_2943234_+	repressor protein C2	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
AVJ70896.1|2943337_2943838_+	helix-turn-helix domain protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
AVJ69925.1|2944128_2944335_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
AVJ70356.1|2944529_2944718_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.8e-09
AVJ70556.1|2944780_2945305_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	68.1	3.7e-65
AVJ71486.1|2945824_2946139_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
AVJ70860.1|2946125_2946308_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
AVJ72268.1|2946304_2946646_+	hypothetical protein	NA	A0A076G839	Escherichia_phage	77.9	4.5e-27
AVJ71855.1|2946806_2947292_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
AVJ70367.1|2947416_2947809_+	putative upf89.0 protein	NA	G9L6B3	Escherichia_phage	98.5	2.5e-74
AVJ71127.1|2947805_2947991_+	putative upf89.5 protein	NA	Q1MVF7	Enterobacteria_phage	88.7	3.5e-18
AVJ70960.1|2948098_2948332_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
AVJ70570.1|2948470_2948659_+	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	82.3	1.3e-20
AVJ71144.1|2948662_2948809_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.4e-22
AVJ71268.1|2948948_2949065_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ69615.1|2949109_2950423_+|integrase	phage integrase family protein	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
AVJ73185.1|2950449_2951175_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	96.9	5.4e-70
AVJ68743.1|2951227_2951623_+	inner membrane protein YecN	NA	NA	NA	NA	NA
AVJ72864.1|2951663_2952407_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	30.0	4.6e-24
AVJ69704.1|2952403_2953375_+|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
2958886:2958901	attR	ATTCCGGTGAATATTC	NA	NA	NA	NA
>prophage 8
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3146770	3154288	5211570		Escherichia_phage(42.86%)	7	NA	NA
AVJ70059.1|3146770_3147319_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AVJ72983.1|3147323_3148202_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AVJ70470.1|3148259_3149159_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AVJ72117.1|3149158_3150244_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AVJ72921.1|3150615_3151509_-	regulatory protein GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVJ72865.1|3151740_3152736_-	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AVJ72996.1|3152893_3154288_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 9
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3201693	3254559	5211570	plate,head,transposase,lysis,holin,portal,capsid,terminase,integrase,tail	Escherichia_phage(35.29%)	66	3205982:3206008	3238880:3238906
AVJ70075.1|3201693_3203097_+	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
AVJ69734.1|3203093_3203816_+	transcriptional regulatory, C terminal family protein	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVJ73175.1|3203995_3204328_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ71263.1|3204475_3205837_+	peptidase U32 family protein	NA	Q6DW11	Phage_TP	99.2	1.6e-216
3205982:3206008	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AVJ70919.1|3206409_3207573_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.0e-203
AVJ73152.1|3207572_3208052_-	phage P2 GpU family protein	NA	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
AVJ70360.1|3208066_3209668_-|tail	phage tail tape measure protein, TP901 family, core region	tail	M1T2S3	Escherichia_phage	93.4	1.4e-243
AVJ73474.1|3209782_3210514_-	hypothetical protein	NA	A0A0F7LCI6	Escherichia_phage	99.6	1.3e-119
AVJ70763.1|3210658_3210934_-	mu-like prophage FluMu gp41 family protein	NA	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AVJ69788.1|3210990_3211509_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AVJ72591.1|3211521_3212712_-|tail	major tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
AVJ71826.1|3212971_3213157_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	96.7	1.0e-25
AVJ69021.1|3214869_3215397_-|tail	caudovirales tail fiber assembly family protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.2e-90
AVJ73219.1|3215400_3217719_-|tail	phage tail-collar fiber family protein	tail	U5N099	Enterobacteria_phage	68.1	6.3e-213
AVJ73243.1|3217729_3218260_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
AVJ70310.1|3218252_3219161_-|plate	baseplate J-like family protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AVJ68866.1|3219165_3219513_-	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AVJ72590.1|3219509_3220145_-|plate	baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
AVJ69892.1|3220228_3221014_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69602.1|3221085_3221538_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.7e-74
AVJ72073.1|3221530_3221998_-|tail	P2 phage tail completion R family protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
AVJ73203.1|3221960_3222119_-	putative protein lysB	NA	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
AVJ70904.1|3222105_3222531_-|lysis	phage lysis regulatory, LysB family protein	lysis	Q858W0	Yersinia_virus	97.2	1.0e-65
AVJ69709.1|3222518_3222944_-	putative protein lysA	NA	Q858W1	Yersinia_virus	89.4	1.5e-59
AVJ73214.1|3222958_3223456_-	phage lysozyme family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AVJ72182.1|3223455_3223737_-|holin	phage holin 2 family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVJ70557.1|3223740_3223860_-	phage Tail Protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	97.4	5.7e-14
AVJ71150.1|3223943_3224453_-|head	phage head completion family protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AVJ73028.1|3224552_3225251_-|terminase	phage small terminase subunit	terminase	Q858W5	Yersinia_virus	98.7	1.9e-117
AVJ72388.1|3225299_3226373_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
AVJ71158.1|3226431_3227286_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
AVJ69664.1|3227459_3229232_+|terminase	ATPase subunit of terminase family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AVJ68808.1|3229231_3230266_+|portal	phage portal protein, PBSX family	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AVJ71879.1|3230304_3230466_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.9e-18
AVJ70734.1|3230583_3231231_-	putative prophage protein	NA	NA	NA	NA	NA
AVJ70484.1|3231323_3232055_-	putative orf97	NA	A0A218M4H5	Erwinia_phage	78.6	1.0e-108
AVJ69262.1|3232284_3232437_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	95.9	4.0e-20
AVJ70040.1|3232490_3232943_-	hypothetical protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
AVJ69016.1|3232942_3235228_-	bacteriophage replication protein A	NA	Q7Y4B8	Escherichia_virus	98.3	0.0e+00
AVJ69743.1|3235217_3235493_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AVJ69314.1|3235489_3235714_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AVJ73162.1|3235716_3236016_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	3.5e-44
AVJ71021.1|3236015_3236240_-	hypothetical protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
AVJ70327.1|3236303_3236804_-	putative replication gene B protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AVJ72696.1|3236800_3236971_-	putative orf78	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
AVJ71679.1|3236981_3237236_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	3.5e-45
AVJ71823.1|3237786_3238800_+|integrase	phage integrase family protein	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
AVJ73006.1|3239076_3239394_-	hypothetical protein	NA	NA	NA	NA	NA
3238880:3238906	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AVJ68682.1|3239808_3240708_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AVJ70466.1|3240789_3241524_-	deoR-like helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVJ70230.1|3241668_3242709_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AVJ71800.1|3242756_3243014_-	PTS system, galactitol-specific IIC component domain protein	NA	NA	NA	NA	NA
AVJ69538.1|3243086_3244295_+|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AVJ69530.1|3244304_3244430_-	bacterial regulatory helix-turn-helix, lysR family protein	NA	NA	NA	NA	NA
AVJ73094.1|3244660_3245809_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AVJ69492.1|3246021_3246147_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ70799.1|3246622_3247009_+	ACT domain protein	NA	NA	NA	NA	NA
AVJ68724.1|3247157_3247703_+	putative transcriptional regulator of tet operon	NA	NA	NA	NA	NA
AVJ70055.1|3247680_3248304_-	tetracycline repressor protein class B from transposon Tn10	NA	NA	NA	NA	NA
AVJ71837.1|3248409_3249591_+	tetracycline resistance protein, class B	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	1.7e-09
AVJ69304.1|3249703_3250297_-	transposon Tn10 TetC protein	NA	NA	NA	NA	NA
AVJ70172.1|3250384_3250801_+	transposon Tn10 TetD protein	NA	NA	NA	NA	NA
AVJ72313.1|3251327_3251690_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AVJ71572.1|3251686_3252037_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVJ70277.1|3252067_3253681_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AVJ71333.1|3253707_3254559_-|transposase	transposase DDE domain protein	transposase	A4KWT9	Enterobacteria_phage	100.0	9.8e-164
>prophage 10
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3289223	3298666	5211570		Enterobacteria_phage(85.71%)	9	NA	NA
AVJ72082.1|3289223_3290360_+	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
AVJ72640.1|3290356_3292357_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AVJ69786.1|3292481_3292943_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVJ69833.1|3292984_3293455_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVJ72185.1|3293501_3294221_-	response regulator	NA	NA	NA	NA	NA
AVJ71230.1|3294217_3295903_-	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AVJ72740.1|3296124_3296856_+	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AVJ70740.1|3297003_3297726_-	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AVJ68588.1|3297739_3298666_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 11
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3701897	3747116	5211570	head,protease,terminase,integrase,tail	Escherichia_phage(54.9%)	57	3703736:3703752	3744002:3744018
AVJ69904.1|3701897_3702038_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	95.7	1.1e-16
AVJ71413.1|3702115_3702259_+	hypothetical protein	NA	G9L6F2	Escherichia_phage	100.0	1.3e-17
AVJ72790.1|3702320_3702467_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72681.1|3702572_3703088_+	glycine zipper 2TM domain protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AVJ71621.1|3703103_3703643_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
3703736:3703752	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AVJ71435.1|3703839_3704337_-	hypothetical protein	NA	A0A193GYU6	Enterobacter_phage	66.5	6.7e-48
AVJ69453.1|3704333_3704963_-	chitinase class I family protein	NA	G9L6E8	Escherichia_phage	96.7	2.9e-112
AVJ70660.1|3704952_3705261_-	hypothetical protein	NA	G9L6E7	Escherichia_phage	100.0	1.3e-49
AVJ70039.1|3705247_3705607_-	putative membrane protein	NA	G9L6E6	Escherichia_phage	96.6	3.1e-55
AVJ71446.1|3705827_3708434_-|tail	putative tailspike protein	tail	G9L6E4	Escherichia_phage	65.2	2.7e-79
AVJ71661.1|3708722_3708887_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	100.0	3.2e-23
AVJ69588.1|3709024_3709156_+	ash family protein	NA	NA	NA	NA	NA
AVJ72856.1|3709579_3709894_+	putative anti-repressor protein	NA	G9L6E2	Escherichia_phage	99.0	4.8e-52
AVJ72943.1|3710336_3710849_+	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AVJ70652.1|3710930_3711092_+	putative transmembrane anchored domain protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AVJ70208.1|3711123_3711360_-	putative membrane protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	1.1e-40
AVJ69343.1|3711615_3714090_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
AVJ70264.1|3714095_3715898_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
AVJ70143.1|3715894_3718345_-	putative prophage MuMc02, structural protein P5	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.3	0.0e+00
AVJ72225.1|3718407_3718953_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	93.9	1.8e-86
AVJ70688.1|3718952_3719417_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
AVJ69020.1|3719416_3721816_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
AVJ72502.1|3721887_3722493_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
AVJ72278.1|3722492_3722816_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AVJ69576.1|3722866_3723034_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	9.5e-23
AVJ72920.1|3723212_3723650_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	1.4e-70
AVJ69761.1|3723701_3724688_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	5.6e-187
AVJ72207.1|3724702_3725398_-|protease	putative endoprotease	protease	G9L6C4	Escherichia_phage	100.0	6.0e-95
AVJ70365.1|3725400_3725697_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AVJ72769.1|3725693_3727373_-|head,tail	bacteriophage head to tail connecting family protein	head,tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
AVJ70874.1|3727387_3727570_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	93.3	1.5e-05
AVJ69563.1|3728345_3729047_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ72485.1|3729046_3729235_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ69391.1|3729258_3730728_-|terminase	putative terminase B large subunit	terminase	G9L6B8	Escherichia_phage	97.8	6.8e-290
AVJ69408.1|3730724_3731435_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
AVJ69700.1|3731475_3731814_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	3.5e-56
AVJ70318.1|3731806_3731929_-	putative membrane protein	NA	A0A1B0V7K1	Salmonella_phage	52.8	7.7e-06
AVJ70250.1|3731928_3732588_-	hypothetical protein	NA	S4TSR6	Salmonella_phage	61.9	1.4e-53
AVJ69205.1|3732598_3733354_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
AVJ72506.1|3733355_3734252_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	88.9	2.9e-158
AVJ73297.1|3734248_3734725_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	68.8	9.4e-31
AVJ72673.1|3734786_3735047_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.6	1.4e-44
AVJ69910.1|3735248_3736034_-	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
AVJ69556.1|3736030_3736846_-	helix-turn-helix domain protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
AVJ72853.1|3736861_3737062_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
AVJ69872.1|3737212_3737443_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AVJ70738.1|3737597_3738182_+	helix-turn-helix family protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AVJ71278.1|3738335_3738488_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
AVJ69782.1|3738490_3738790_+	hypothetical protein	NA	G9L6A4	Escherichia_phage	99.0	5.8e-47
AVJ70132.1|3738786_3739608_+	hypothetical protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	1.5e-161
AVJ71049.1|3739688_3740546_+	recT family protein	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.3	2.7e-161
AVJ72050.1|3740595_3740844_+	prophage CP4-57 regulatory family protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AVJ69231.1|3741245_3741896_+	MT-A70 family protein	NA	G9L699	Escherichia_phage	96.3	5.2e-125
AVJ70397.1|3741892_3742552_+	serine/threonine-protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
AVJ70521.1|3742554_3743811_-|integrase	phage integrase family protein	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	4.4e-237
AVJ69309.1|3744003_3745581_-	GMP synthase	NA	NA	NA	NA	NA
3744002:3744018	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AVJ68756.1|3745649_3747116_-	inosine-5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 12
CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3964065	3971205	5211570		Escherichia_phage(83.33%)	6	NA	NA
AVJ69315.1|3964065_3966627_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AVJ70166.1|3966732_3967389_+	serine/threonine-protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AVJ72813.1|3967439_3968171_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.2	2.1e-66
AVJ73425.1|3968402_3969311_+	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AVJ71460.1|3969307_3970570_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVJ69692.1|3970608_3971205_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	74.6	2.3e-79
>prophage 1
CP027130	Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence	170292	2755	85441	170292	transposase,protease,integrase	Escherichia_phage(36.11%)	99	6648:6707	52888:53708
AVJ68405.1|2755_3274_-|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	6.5e-94
AVJ68321.1|3431_4094_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	9.7e-119
AVJ68425.1|4210_5233_-	helix-turn-helix family protein	NA	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AVJ68473.1|5246_6005_-|transposase	helix-turn-helix domain of transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	9.1e-129
AVJ68326.1|6006_6264_-|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	97.4	2.3e-31
AVJ68292.1|6312_6606_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.9e-51
6648:6707	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AVJ68394.1|6711_7416_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVJ68338.1|7540_7948_+	resolvase, N terminal domain protein	NA	A0A219YA40	Aeromonas_phage	36.3	6.8e-14
AVJ68333.1|8132_8690_+	osmC-like family protein	NA	NA	NA	NA	NA
AVJ68305.1|8831_9413_+	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AVJ68301.1|9417_9756_+	alkylhydroperoxidase AhpD family core domain protein	NA	NA	NA	NA	NA
AVJ68313.1|9785_10115_-	thioredoxin-like domain protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AVJ68391.1|10328_11435_+	flavin oxidoreductase / NADH oxidase family protein	NA	NA	NA	NA	NA
AVJ68431.1|11500_12202_+	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AVJ68387.1|12267_13041_+	KR domain protein	NA	NA	NA	NA	NA
AVJ68379.1|13226_14450_-	aminotransferase class I and II family protein	NA	NA	NA	NA	NA
AVJ68300.1|14580_15453_-	eamA-like transporter family protein	NA	NA	NA	NA	NA
AVJ68451.1|15694_16447_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVJ68327.1|16886_17891_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVJ68372.1|18311_19055_-	histidine phosphatase super family protein	NA	NA	NA	NA	NA
AVJ68373.1|19176_19662_-	winged helix-turn-helix DNA-binding family protein	NA	NA	NA	NA	NA
AVJ68410.1|19686_20157_-	thioredoxin-like family protein	NA	NA	NA	NA	NA
AVJ68422.1|20158_20854_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AVJ68424.1|20858_21971_-	macB-like periplasmic core domain protein	NA	NA	NA	NA	NA
AVJ68416.1|21978_23262_-	macB-like periplasmic core domain protein	NA	NA	NA	NA	NA
AVJ68419.1|23264_24644_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68470.1|24747_25269_-	Fe2+ transport family protein	NA	NA	NA	NA	NA
AVJ68323.1|25315_27232_-	iron permease FTR1 family protein	NA	NA	NA	NA	NA
AVJ68367.1|27432_27552_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68462.1|27548_28310_-	ubiquinone oxidoreductase, Na(+)-translocating, C subunit	NA	NA	NA	NA	NA
AVJ68320.1|28302_28431_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68335.1|28546_29053_-	thioredoxin-like family protein	NA	NA	NA	NA	NA
AVJ68331.1|29042_29201_-	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AVJ68382.1|29350_29482_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	97.0	3.2e-10
AVJ68459.1|29857_30361_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	96.4	4.5e-92
AVJ68463.1|30411_31539_+|transposase	transposase DDE domain protein	transposase	Q9E8P4	Bluetongue_virus	99.7	3.1e-218
AVJ68378.1|31548_31965_-	transposon Tn10 TetD protein	NA	NA	NA	NA	NA
AVJ68435.1|32052_32646_+	transposon Tn10 TetC protein	NA	NA	NA	NA	NA
AVJ68461.1|32758_33940_-	tetracycline resistance protein, class B	NA	NA	NA	NA	NA
AVJ68294.1|34045_34669_+	tetracycline repressor protein class B from transposon Tn10	NA	NA	NA	NA	NA
AVJ68475.1|34646_35192_-	putative transcriptional regulator of tet operon	NA	NA	NA	NA	NA
AVJ68364.1|35340_35727_-	ACT domain protein	NA	NA	NA	NA	NA
AVJ68324.1|35979_36483_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AVJ68409.1|36710_36875_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68351.1|36865_37570_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVJ68421.1|37603_37747_-|transposase	transposase domain protein	transposase	NA	NA	NA	NA
AVJ68389.1|38623_39100_-	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AVJ68466.1|39207_40446_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AVJ68296.1|40442_41348_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AVJ68369.1|41469_42174_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVJ68481.1|42198_42333_+	insertion sequence IS4321 domain protein	NA	NA	NA	NA	NA
AVJ68377.1|42914_43754_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVJ68371.1|44300_45089_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVJ68299.1|45850_46864_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVJ68468.1|46850_47369_-	putative cytosine-specific DNA methylase	NA	NA	NA	NA	NA
AVJ68330.1|47393_48098_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVJ68332.1|48172_49120_+|transposase	transposase DDE domain group 1 family protein	transposase	A0A1B0VDR3	Salmonella_phage	100.0	9.9e-40
AVJ68302.1|49100_49223_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68380.1|49375_50251_+	beta-lactamase CTX-M-1	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVJ68383.1|50297_50570_-	cupin fold metallo, WbuC family protein	NA	NA	NA	NA	NA
AVJ68359.1|51423_52905_+|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.8	1.5e-284
AVJ68390.1|52951_53656_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVJ68285.1|54446_54650_-|transposase	putative transposase	transposase	NA	NA	NA	NA
52888:53708	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AVJ68298.1|55404_56265_-	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AVJ68303.1|56371_57076_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVJ68304.1|57707_58538_-	beta-lactamase OXA-1	NA	NA	NA	NA	NA
AVJ68480.1|59366_60071_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVJ68329.1|60061_60676_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	98.2	1.1e-89
AVJ68420.1|60672_61278_-	resolvase, N terminal domain protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AVJ68288.1|61372_64270_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AVJ68465.1|64406_64739_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AVJ68366.1|64740_64959_-	antitoxin PemI	NA	NA	NA	NA	NA
AVJ68474.1|65090_65744_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AVJ68314.1|65740_65863_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68411.1|66682_67540_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVJ68454.1|68503_69526_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVJ68437.1|69997_70351_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ68381.1|70763_71264_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68429.1|71568_72072_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AVJ68317.1|72186_72543_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	89.5	5.7e-33
AVJ68291.1|72539_72890_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVJ68401.1|72920_73142_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68342.1|73249_73435_+|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	70.7	2.9e-20
AVJ68386.1|73498_73978_-	arginine repressor, C-terminal domain protein	NA	NA	NA	NA	NA
AVJ68388.1|74058_75462_-	C4-dicarboxylate anaerobic carrier family protein	NA	NA	NA	NA	NA
AVJ68356.1|75509_76514_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AVJ68347.1|76598_77462_-	amino acid kinase family protein	NA	NA	NA	NA	NA
AVJ68433.1|77520_78741_-	arginine deiminase	NA	NA	NA	NA	NA
AVJ68478.1|79401_79548_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68452.1|79582_79828_+	pre-toxin domain with VENN motif family protein	NA	NA	NA	NA	NA
AVJ68385.1|79830_79950_+	putative adhesin/hemagglutinin/hemolysin domain protein	NA	NA	NA	NA	NA
AVJ68286.1|80055_80508_-	incFII RepA family protein	NA	NA	NA	NA	NA
AVJ68289.1|80962_81202_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68350.1|81744_81924_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68346.1|82075_82303_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	97.3	5.4e-37
AVJ68352.1|82681_84253_-|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AVJ68436.1|84359_84539_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68471.1|84619_84925_-|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	44.6	3.9e-14
AVJ68446.1|85273_85441_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	100.0	7.8e-09
>prophage 2
CP027130	Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence	170292	159284	166010	170292	transposase,integrase	Cedratvirus(16.67%)	7	149341:149355	166465:166479
149341:149355	attL	GATTGTGTCATATGC	NA	NA	NA	NA
AVJ68482.1|159284_160112_-	ABC transporter family protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AVJ68442.1|160111_160903_-	periplasmic solute binding family protein	NA	NA	NA	NA	NA
AVJ68393.1|161575_162079_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
AVJ68374.1|162258_162495_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	57.9	3.1e-19
AVJ68404.1|162905_163238_-	homeo-like domain protein	NA	U5N3F9	Enterobacteria_phage	98.0	2.8e-50
AVJ68361.1|164007_164985_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AVJ68345.1|165269_166010_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
166465:166479	attR	GCATATGACACAATC	NA	NA	NA	NA
>prophage 1
CP027133	Escherichia coli strain AR_0372 plasmid unnamed4	97167	737	96780	97167	transposase,terminase,tail	Escherichia_phage(58.14%)	94	NA	NA
AVJ68489.1|737_3725_+	putative ddrB	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
AVJ68490.1|3714_4023_+	putative odaA	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
AVJ68491.1|4805_6161_-	dGTPase family protein	NA	NA	NA	NA	NA
AVJ68492.1|6409_6898_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	79.0	1.3e-64
AVJ68493.1|7067_7625_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AVJ68494.1|8048_8507_+|transposase	transposase IS200 like family protein	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
AVJ68495.1|8621_9536_-	putative proB	NA	Q71TR6	Escherichia_phage	96.4	3.9e-158
AVJ68496.1|9753_10884_+|transposase	transposase, IS605 OrfB family	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
AVJ68497.1|10916_12638_-	putative proA	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
AVJ68498.1|12824_19481_+	SNF2 family N-terminal domain protein	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
AVJ68499.1|19514_19955_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AVJ68500.1|20062_20200_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	4.7e-20
AVJ68501.1|20236_21241_-	putative RelA/SpoT domain protein	NA	A0A1B0VBT5	Salmonella_phage	74.8	2.9e-138
AVJ68502.1|21466_22057_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.4	4.8e-101
AVJ68503.1|22297_22858_-	recombination enhancement function protein	NA	Q5QBN4	Enterobacteria_phage	98.9	1.5e-99
AVJ68504.1|23466_24417_-	recombinase cre	NA	Q71TG5	Escherichia_phage	100.0	4.1e-179
AVJ68505.1|24505_24727_-	putative cre-associated protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AVJ68506.1|25643_26495_+	repressor protein C1	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AVJ68507.1|26527_27646_-	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	88.7	3.7e-179
AVJ68508.1|28203_29688_-|terminase	putative large terminase protein	terminase	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
AVJ68509.1|29687_30881_-	helix-turn-helix domain protein	NA	A0A077SL59	Escherichia_phage	99.0	9.8e-178
AVJ68510.1|30966_31419_-	putative late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AVJ68511.1|31507_32551_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	99.4	1.7e-205
AVJ68512.1|32578_32758_-	putative pdcA	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AVJ68513.1|32762_33143_-	toxin doc	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AVJ68514.1|33142_33364_-	antitoxin phd	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AVJ68515.1|33546_35103_+	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.4e-104
AVJ68516.1|35099_36356_+	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
AVJ68517.1|36477_39594_+	type I site-specific deoxyribonuclease, HsdR family protein	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
AVJ68518.1|39673_39844_-	putative membrane domain protein	NA	A0A1B0VBV0	Salmonella_phage	92.9	9.7e-15
AVJ68519.1|39859_40045_-	putative morphogenetic protein	NA	Q71T77	Escherichia_phage	98.4	1.0e-25
AVJ68520.1|40438_41701_-	putative pmgS	NA	Q1MVG4	Enterobacteria_phage	99.8	2.7e-234
AVJ68521.1|42002_42704_-	putative pmgQ	NA	Q1MVG6	Enterobacteria_phage	99.6	1.3e-142
AVJ68522.1|42700_43378_-	serine/threonine-protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AVJ68523.1|43374_44001_-	putative pmgP	NA	A0A077SK52	Escherichia_phage	99.5	2.3e-122
AVJ68524.1|44502_44619_-	putative hdmA	NA	A0A077SK20	Escherichia_phage	100.0	4.7e-13
AVJ68525.1|44724_45303_-	VRR-NUC domain protein	NA	A0A077SLK0	Escherichia_phage	96.9	2.0e-104
AVJ68526.1|45305_45551_-	putative pmgL	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AVJ68527.1|45697_46075_+	putative 26 protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AVJ68528.1|46084_47302_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
AVJ68529.1|47305_48034_+	putative upf79.2	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AVJ68530.1|48020_48806_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	7.9e-144
AVJ68531.1|49026_49824_+	putative upf77.7	NA	Q1MVH7	Enterobacteria_phage	100.0	3.4e-150
AVJ68532.1|49816_50449_+	putative upf76.8	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
AVJ68533.1|50495_51494_-	glycosyl transferases group 1 family protein	NA	A0A1B0VCH7	Salmonella_phage	97.6	3.4e-192
AVJ68534.1|51493_52789_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	4.0e-241
AVJ68535.1|52848_53064_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68536.1|53494_53920_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
AVJ68537.1|54431_54548_-	hypothetical protein	NA	A0A1B0VAL9	Salmonella_phage	97.4	1.1e-14
AVJ68538.1|55477_57670_-	DNA adenine methylase family protein	NA	A0A077SL51	Escherichia_phage	98.1	1.8e-23
AVJ68539.1|57738_58644_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AVJ68540.1|58999_59119_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68541.1|59383_60172_+	putative upfB	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
AVJ68542.1|60211_60634_+	putative ppfA	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
AVJ68543.1|60668_60800_+	putative membrane lipoprotein	NA	Q71TL6	Escherichia_phage	100.0	1.2e-17
AVJ68544.1|60809_61202_+	putative upfA	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AVJ68545.1|61537_62422_+	repFIB replication protein A	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AVJ68546.1|62714_63524_+	hypothetical protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AVJ68547.1|63740_64889_+	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	100.0	4.6e-217
AVJ68548.1|64905_65907_+	parB	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AVJ68549.1|66133_67840_+	putative upf57.5	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
AVJ68550.1|67900_69490_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
AVJ68551.1|69583_70315_+	putative upf54.2	NA	A0A1B0V835	Salmonella_phage	99.2	6.8e-97
AVJ68552.1|70427_71159_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68553.1|71198_71453_+	putative upf52.7	NA	Q71TM5	Escherichia_phage	98.8	5.9e-40
AVJ68554.1|71786_72221_+	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.3	3.0e-76
AVJ68555.1|72403_72580_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	78.4	3.3e-10
AVJ68556.1|72699_73545_-	putative replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.2	9.4e-151
AVJ68557.1|73574_74375_-	kilA-N domain protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AVJ68558.1|74539_75061_-	phage antirepressor KilAC domain protein	NA	Q71TC1	Escherichia_phage	99.4	1.4e-88
AVJ68559.1|75194_75377_+	putative membrane protein	NA	NA	NA	NA	NA
AVJ68560.1|75579_75801_-	putative cell division repressor	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AVJ68561.1|76381_76699_+	putative simB	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
AVJ68562.1|76706_77486_+	putative simC	NA	Q71TC6	Escherichia_phage	96.1	9.3e-145
AVJ68563.1|78027_78300_+	putative tubA	NA	Q1MVL0	Enterobacteria_phage	98.9	3.9e-42
AVJ68564.1|78310_78922_+	putative tubB	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
AVJ68565.1|78886_79000_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ68566.1|79014_79818_+	putative pmgB	NA	Q71TC9	Escherichia_phage	98.5	3.8e-157
AVJ68567.1|79771_79888_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ68568.1|79899_83595_+	transglycosylase SLT domain protein	NA	A0A1B0VDM8	Salmonella_phage	85.8	0.0e+00
AVJ68569.1|83594_83951_+	putative pmgA	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AVJ68570.1|83947_85381_+	putative bplA	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
AVJ68571.1|85380_86217_+	putative pep42	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
AVJ68572.1|86559_86730_+|tail	putative tail fiber protein R	tail	Q71TD4	Escherichia_phage	98.2	1.1e-23
AVJ68573.1|86741_89666_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	44.7	3.8e-13
AVJ68574.1|89781_90105_+|tail	putative tail fiber protein	tail	K7PH60	Enterobacterial_phage	61.0	2.6e-32
AVJ68575.1|90115_90574_+	phage Tail Collar domain protein	NA	A0A0F7LCR3	Escherichia_phage	57.4	1.4e-44
AVJ68576.1|90573_91185_+|tail	caudovirales tail fiber assembly family protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
AVJ68577.1|91190_91688_-	phage Tail Collar domain protein	NA	K7P7Q7	Enterobacteria_phage	57.3	2.9e-43
AVJ68578.1|92819_93515_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	93.2	2.2e-12
AVJ68579.1|94180_94882_-|tail	phage tail fiber repeat family protein	tail	A0A1B0V7G4	Salmonella_phage	97.5	1.5e-80
AVJ68580.1|95067_95238_-|tail	putative tail fiber protein R	tail	Q71TD4	Escherichia_phage	98.2	1.1e-23
AVJ68581.1|95622_96180_-	putative pep42	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.9e-99
AVJ68582.1|96405_96780_-	bplA domain protein	NA	Q71TP2	Escherichia_phage	91.2	7.8e-57
>prophage 1
CP027129	Escherichia coli strain AR_0372 plasmid unnamed5	5193	327	5193	5193	tail	Escherichia_phage(44.44%)	9	NA	NA
AVJ68276.1|327_654_+	hypothetical protein	NA	M1SV83	Escherichia_phage	76.6	6.8e-41
AVJ68277.1|711_852_+|tail	caudovirales tail fiber assembly family protein	tail	Q9MCR5	Enterobacteria_phage	85.7	1.7e-09
AVJ68278.1|1447_1924_-	phage Tail Collar domain protein	NA	A0A0F7LCR3	Escherichia_phage	59.4	2.4e-47
AVJ68279.1|2334_2568_+	helix-turn-helix domain of resolvase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	88.1	2.9e-25
AVJ68280.1|3105_3267_+	putative lydC domain protein	NA	A0A1B0VBS6	Salmonella_phage	68.8	1.0e-10
AVJ68281.1|3554_3671_+	putative lydA	NA	Q37876	Escherichia_phage	100.0	8.0e-13
AVJ68282.1|3667_4111_+	putative lydB	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AVJ68283.1|4097_4700_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
AVJ68284.1|4701_5193_+	darA domain protein	NA	Q1MVM7	Enterobacteria_phage	100.0	1.5e-87
