The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	313400	332830	7240677	holin	Acanthamoeba_polyphaga_mimivirus(25.0%)	19	NA	NA
AVK21285.1|313400_314339_+|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
AVK19530.1|314411_315296_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16220.1|315347_316313_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
AVK16664.1|316363_316843_+	hypothetical protein	NA	NA	NA	NA	NA
AVK22376.1|316878_317814_+	hypothetical protein	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	33.3	8.6e-20
AVK17096.1|317787_318855_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22326.1|318962_319856_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVK21535.1|320124_320373_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21729.1|320418_321522_-	amidotransferase family protein	NA	NA	NA	NA	NA
AVK20272.1|321941_323318_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVK17150.1|323357_323525_+	hypothetical protein	NA	NA	NA	NA	NA
AVK22163.1|323781_324720_+|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
AVK19817.1|324761_325601_+|holin	choline ABC transporter, permease protein	holin	NA	NA	NA	NA
AVK21322.1|325604_326783_+|holin	choline ABC transporter, ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.9e-24
AVK22828.1|326999_328604_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.5	6.0e-21
AVK18879.1|328804_328921_-	putative transcriptional regulator BetI	NA	NA	NA	NA	NA
AVK16647.1|328882_329476_+	transcriptional repressor BetI	NA	NA	NA	NA	NA
AVK16812.1|329536_331009_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVK16302.1|331144_332830_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-56
>prophage 2
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	568759	653190	7240677	terminase,protease,integrase,tail,plate,portal,lysis,head,capsid	Pseudomonas_virus(68.0%)	92	620348:620393	634545:634590
AVK22520.1|568759_569305_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.0	2.5e-51
AVK22194.1|569304_570186_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.6	2.7e-100
AVK20101.1|570182_571091_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AVK15922.1|571087_572146_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	1.0e-85
AVK17923.1|572167_572419_+	hypothetical protein	NA	NA	NA	NA	NA
AVK17882.1|572544_573687_-	putative site-specific recombinase	NA	V9IQN0	Stenotrophomonas_phage	40.4	6.3e-73
AVK22249.1|573895_574084_-	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.9e-05
AVK22213.1|574094_575327_-	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.3	3.6e-175
AVK19214.1|575323_577102_-	C-5 cytosine-specific DNA methylase family protein	NA	Q9ZXI4	Pseudomonas_virus	94.7	5.4e-289
AVK21717.1|577094_577271_-	putative orf40	NA	Q9ZXI5	Pseudomonas_virus	93.1	3.4e-23
AVK19030.1|577405_577612_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	Q9ZXI6	Pseudomonas_virus	95.6	1.8e-31
AVK19185.1|577623_577977_-	putative orf38	NA	Q9ZXI7	Pseudomonas_virus	95.7	1.4e-60
AVK17911.1|578036_578309_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20793.1|578353_581065_-	toprim-like family protein	NA	Q9ZXI8	Pseudomonas_virus	99.1	0.0e+00
AVK18766.1|581070_581304_-	putative orf36	NA	Q9ZXI9	Pseudomonas_virus	98.7	3.8e-38
AVK20151.1|581375_581726_-	putative orf35	NA	NA	NA	NA	NA
AVK20871.1|581722_581929_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	97.1	1.4e-31
AVK22145.1|582012_582483_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	92.9	1.6e-75
AVK17910.1|582512_582725_-	phage-associated protein, BcepMu gp16 family	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	1.1e-07
AVK22599.1|583301_583418_+	putative orf31	NA	Q9ZXJ4	Pseudomonas_virus	88.9	7.0e-09
AVK18663.1|583614_583821_+	putative orf30	NA	Q9ZXJ5	Pseudomonas_virus	79.4	2.3e-26
AVK17060.1|584159_584951_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	36.7	4.4e-33
AVK20900.1|585733_585850_+	hypothetical protein	NA	NA	NA	NA	NA
AVK22123.1|585846_586845_-	DNA (cytosine-5-)-methyltransferase family protein	NA	Q7Y4B5	Escherichia_virus	63.4	2.8e-117
AVK17300.1|587008_588283_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.6	2.1e-234
AVK17817.1|588279_588720_-	phage P2 GpU family protein	NA	Q9ZXJ9	Pseudomonas_virus	99.3	4.0e-76
AVK15996.1|588725_591440_-|tail	phage tail tape measure protein, TP901 family, core region	tail	Q9ZXK0	Pseudomonas_virus	98.7	0.0e+00
AVK18951.1|591429_591549_-	phage P2 GpE family protein	NA	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
AVK18636.1|591557_591887_-	mu-like prophage FluMu gp41 family protein	NA	Q9ZXK2	Pseudomonas_virus	99.1	5.6e-51
AVK16790.1|591941_592457_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	98.8	1.9e-93
AVK16715.1|592513_593689_-|tail	phage tail sheath family protein	tail	Q9ZXK4	Pseudomonas_virus	99.5	9.2e-221
AVK18108.1|593789_594224_-|tail	caudovirales tail fiber assembly family protein	tail	A0A291LAV4	Bordetella_phage	49.6	1.7e-26
AVK20528.1|594233_596051_-|tail	phage tail-collar fiber family protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	74.0	1.5e-65
AVK19652.1|596047_596665_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.8	1.6e-86
AVK20730.1|596661_597579_-|plate	baseplate J-like family protein	plate	Q9ZXK8	Pseudomonas_virus	87.5	1.9e-144
AVK17865.1|597575_597920_-	lysozyme family protein	NA	Q9ZXK9	Pseudomonas_virus	95.6	2.3e-55
AVK19820.1|597916_598489_-|plate	phage baseplate assembly V family protein	plate	Q9ZXL0	Pseudomonas_virus	90.5	7.9e-93
AVK16329.1|598558_599017_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	4.1e-68
AVK17419.1|599009_599546_-|tail	P2 phage tail completion R family protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
AVK17470.1|599623_600085_-|lysis	phage lysis regulatory, LysB family protein	lysis	Q9ZXL5	Pseudomonas_virus	94.1	9.9e-70
AVK17118.1|600081_600210_-	hypothetical protein	NA	NA	NA	NA	NA
AVK21133.1|600320_601127_-	putative Peptidoglycan domain protein	NA	Q9ZXL6	Pseudomonas_virus	97.3	2.4e-143
AVK21688.1|601123_601396_-	hypothetical protein	NA	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
AVK17325.1|601397_601751_-	putative membrane protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
AVK15939.1|601775_601988_-	phage Tail Protein X family protein	NA	Q9ZXL9	Pseudomonas_virus	91.2	5.4e-31
AVK19542.1|601987_602449_-|head	phage head completion family protein	head	Q9ZXM1	Pseudomonas_virus	98.7	6.2e-80
AVK18962.1|602552_603254_-|terminase	phage small terminase subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.3	1.1e-123
AVK21863.1|603259_604276_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
AVK19584.1|604311_605133_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	Q9ZXM4	Pseudomonas_virus	98.9	1.2e-129
AVK17880.1|605288_607049_+|terminase	ATPase subunit of terminase family protein	terminase	Q9ZXM5	Pseudomonas_virus	94.9	0.0e+00
AVK19934.1|607048_608104_+|portal	phage portal protein, PBSX family	portal	Q9ZXM6	Pseudomonas_virus	96.8	3.4e-198
AVK21746.1|609092_610622_-	H+ antiporter-2 family protein	NA	NA	NA	NA	NA
AVK21703.1|610632_611817_-	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AVK22135.1|611831_613271_-	efflux transporter, outer membrane factor (OMF) lipo, NodT family protein	NA	NA	NA	NA	NA
AVK18624.1|613313_613784_-	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AVK19591.1|614182_615403_-	methyltransferase domain protein	NA	NA	NA	NA	NA
AVK21972.1|615471_616164_-	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK21606.1|616160_616856_-	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK17768.1|616917_617670_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK21309.1|617684_618458_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
AVK20985.1|618706_619396_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19898.1|619553_620291_+	enoyl-(Acyl carrier) reductase family protein	NA	NA	NA	NA	NA
620348:620393	attL	TGGTGCCCAGGGACGGAATCGAACCGCCGACACGGGGATTTTCAAT	NA	NA	NA	NA
AVK20492.1|620595_621798_-	helix-turn-helix domain protein	NA	B6SBZ6	Clostridium_virus	29.2	7.4e-32
AVK16026.1|621794_622316_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20174.1|622585_622990_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20213.1|624766_624910_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16849.1|625587_627678_+	conjugal transfer/type IV secretion DotA/TraY family protein	NA	NA	NA	NA	NA
AVK20844.1|628283_629330_+|integrase	putative phage integrase	integrase	NA	NA	NA	NA
AVK17893.1|629512_630025_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16878.1|630369_632076_-	AAA domain protein	NA	NA	NA	NA	NA
AVK21588.1|632786_633146_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19080.1|633333_634317_-|integrase	phage integrase family protein	integrase	A0A1L7DQ84	Ralstonia_phage	34.7	2.1e-40
AVK16443.1|634733_635816_-	putative oxidoreductase	NA	NA	NA	NA	NA
634545:634590	attR	TGGTGCCCAGGGACGGAATCGAACCGCCGACACGGGGATTTTCAAT	NA	NA	NA	NA
AVK21324.1|635843_636116_-	bacterial Fe(2+) trafficking family protein	NA	NA	NA	NA	NA
AVK18708.1|636159_637227_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVK18223.1|637223_639476_-	asmA-like C-terminal region family protein	NA	NA	NA	NA	NA
AVK16657.1|639569_640676_-	pyridine nucleotide-disulfide oxidoreductase family protein	NA	NA	NA	NA	NA
AVK16280.1|640672_640909_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20403.1|640945_641344_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AVK20877.1|641504_642098_+	imidazoleglycerol-phosphate dehydratase family protein	NA	NA	NA	NA	NA
AVK18531.1|642112_642736_+	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit	NA	NA	NA	NA	NA
AVK16186.1|642739_643000_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21395.1|643048_643786_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AVK18452.1|643796_644567_+	imidazoleglycerol phosphate synthase, cyclase subunit	NA	NA	NA	NA	NA
AVK21735.1|644738_645485_+	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK19650.1|645575_646328_+	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK22465.1|646477_647233_+	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK17778.1|647273_648734_-	hypothetical protein	NA	NA	NA	NA	NA
AVK21135.1|648823_649597_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVK22200.1|649596_650907_-	C-terminal processing peptidase family protein	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
AVK19936.1|650935_652222_-	peptidase M23 family protein	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
AVK16595.1|652371_653190_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
>prophage 3
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	1197235	1203937	7240677	integrase,capsid	Pseudomonas_phage(85.71%)	8	1189544:1189559	1205141:1205156
1189544:1189559	attL	GAGGAAGAAGGCGCGG	NA	NA	NA	NA
AVK17297.1|1197235_1197670_+	DNA-Binding protein G5P	NA	Q56VP5	Pseudomonas_phage	86.1	8.7e-60
AVK19662.1|1197809_1198043_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16216.1|1198064_1198304_+|capsid	capsid protein G8P	capsid	Q56VP2	Pseudomonas_phage	92.4	3.6e-31
AVK18246.1|1198677_1199763_+	putative attachment protein G3P	NA	Q56VP1	Pseudomonas_phage	64.8	1.2e-49
AVK21815.1|1199767_1200124_+	hypothetical protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
AVK22256.1|1200127_1201411_+	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	99.3	2.7e-234
AVK17834.1|1201640_1202933_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
AVK21248.1|1202929_1203937_+|integrase	phage integrase family protein	integrase	F1BUS9	Erwinia_phage	47.1	6.3e-77
1205141:1205156	attR	CCGCGCCTTCTTCCTC	NA	NA	NA	NA
>prophage 4
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	1808664	1816510	7240677	integrase,capsid	Pseudomonas_phage(88.89%)	10	1810509:1810523	1818458:1818472
AVK19286.1|1808664_1809309_+	hypothetical protein	NA	E3SMD8	Cyanophage	64.4	4.3e-63
AVK21126.1|1809824_1810259_+	DNA-Binding protein G5P	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
AVK21983.1|1810440_1810632_+	hypothetical protein	NA	NA	NA	NA	NA
1810509:1810523	attL	CATCCTGGTCAACGG	NA	NA	NA	NA
AVK19280.1|1810653_1810893_+|capsid	capsid protein G8P	capsid	Q56VP2	Pseudomonas_phage	92.4	3.6e-31
AVK18601.1|1811266_1812358_+	putative attachment protein G3P	NA	Q56VP1	Pseudomonas_phage	63.9	7.6e-44
AVK20093.1|1812362_1812719_+	hypothetical protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
AVK20692.1|1812722_1814006_+	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	96.5	1.1e-227
AVK16768.1|1814235_1815528_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.7	1.0e-244
AVK17986.1|1815527_1815971_+	hypothetical protein	NA	Q56VN7	Pseudomonas_phage	51.5	9.6e-30
AVK18256.1|1815976_1816510_+|integrase	phage integrase family protein	integrase	Q56VN7	Pseudomonas_phage	52.6	8.0e-47
1818458:1818472	attR	CCGTTGACCAGGATG	NA	NA	NA	NA
>prophage 5
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	1917469	1950797	7240677	transposase,integrase,tRNA	Pseudomonas_phage(16.67%)	31	1910220:1910236	1956282:1956298
1910220:1910236	attL	GCCGCGCCGACCGTGAT	NA	NA	NA	NA
AVK18793.1|1917469_1917586_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK17185.1|1917643_1917976_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	80.0	1.5e-48
AVK21889.1|1917975_1918251_+	hypothetical protein	NA	Q56VN7	Pseudomonas_phage	60.4	1.4e-23
AVK22927.1|1918425_1918980_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	51.1	1.9e-43
AVK20128.1|1919067_1919376_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	47.5	3.6e-15
AVK21824.1|1919408_1920230_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	54.9	3.2e-79
AVK21301.1|1920873_1920999_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16029.1|1921000_1921162_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18701.1|1921167_1921578_-	plasmid pRiA4b ORF-3-like family protein	NA	NA	NA	NA	NA
AVK18971.1|1921592_1922360_-	WYL domain protein	NA	NA	NA	NA	NA
AVK19556.1|1922758_1923268_+|tRNA	tRNA_anti-like family protein	tRNA	NA	NA	NA	NA
AVK17554.1|1923499_1925410_+	hsdM N-terminal domain protein	NA	A0A220A2U5	Liberibacter_phage	31.8	6.2e-49
AVK16612.1|1925399_1926749_+	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
AVK18590.1|1926820_1929016_+	hypothetical protein	NA	NA	NA	NA	NA
AVK22691.1|1929028_1929766_+	ompA family protein	NA	NA	NA	NA	NA
AVK17198.1|1929766_1931443_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21019.1|1931442_1934694_+	DEAD/DEAH box helicase family protein	NA	A0A160DHD3	Gordonia_phage	26.7	4.4e-31
AVK16195.1|1934703_1937805_+	type I site-specific deoxyribonuclease, HsdR family protein	NA	A0A220A398	Liberibacter_phage	26.2	1.4e-66
AVK17429.1|1938125_1938263_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19709.1|1938578_1939604_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
AVK22501.1|1940008_1940362_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19669.1|1940643_1940841_+	putative helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVK19430.1|1941192_1941402_-	putative membrane protein	NA	NA	NA	NA	NA
AVK16689.1|1941415_1941913_-	DNA repair RadC family protein	NA	NA	NA	NA	NA
AVK18867.1|1941884_1942835_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19608.1|1942925_1943915_-	putative phage-type endonuclease domain protein	NA	A6XMH8	Bacillus_virus	39.3	1.9e-49
AVK16338.1|1944005_1944953_-	phage/plasmid-like TIGR03299 family protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.2	2.7e-61
AVK22298.1|1945068_1945341_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20845.1|1945776_1946586_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21792.1|1946585_1949186_+	DEAD/DEAH box helicase family protein	NA	A7J6T1	Paramecium_bursaria_Chlorella_virus	27.2	1.7e-12
AVK20799.1|1949540_1950797_-|integrase	phage integrase family protein	integrase	A0A1V0E8G8	Vibrio_phage	47.1	4.1e-110
1956282:1956298	attR	GCCGCGCCGACCGTGAT	NA	NA	NA	NA
>prophage 6
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	2294579	2330559	7240677	transposase,integrase	Shigella_phage(27.27%)	35	2317905:2317964	2340175:2342413
AVK19296.1|2294579_2295320_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	57.6	4.3e-75
AVK17295.1|2295406_2295883_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16426.1|2296349_2296844_-	BRO family, N-terminal domain protein	NA	NA	NA	NA	NA
AVK22525.1|2297436_2297970_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22365.1|2298329_2299577_-	ribonucleotide reductase, small chain family protein	NA	K4K678	Caulobacter_phage	29.0	7.6e-32
AVK19467.1|2299631_2299934_+	hypothetical protein	NA	NA	NA	NA	NA
AVK19230.1|2300817_2301990_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18074.1|2301993_2303658_+	thiF family protein	NA	NA	NA	NA	NA
AVK21469.1|2304362_2304515_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18001.1|2304647_2305919_+|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AVK20889.1|2307010_2307157_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19015.1|2307315_2310282_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVK20187.1|2310284_2310845_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVK16884.1|2310970_2311321_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19009.1|2311523_2312537_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AVK22308.1|2313876_2314704_+	beta-lactamase OXA-2	NA	NA	NA	NA	NA
AVK16048.1|2314752_2315532_+	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVK21156.1|2316036_2316876_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AVK18792.1|2317486_2317627_-	hypothetical protein	NA	NA	NA	NA	NA
2317905:2317964	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
AVK21734.1|2318045_2319725_+|transposase	mu transposase, C-terminal family protein	transposase	NA	NA	NA	NA
AVK21291.1|2319727_2320636_+	bacterial TniB family protein	NA	NA	NA	NA	NA
AVK16519.1|2320632_2321850_+	tniQ family protein	NA	NA	NA	NA	NA
AVK20627.1|2321911_2322535_+	resolvase, N terminal domain protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
AVK17353.1|2322750_2323614_-	beta-lactamase GES-1	NA	A0A1B0VBP7	Salmonella_phage	39.0	4.3e-42
AVK20026.1|2323793_2324807_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVK21549.1|2324984_2325104_+	hypothetical protein	NA	NA	NA	NA	NA
AVK17504.1|2325155_2325407_+	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVK17494.1|2325403_2325790_+	hypothetical protein	NA	NA	NA	NA	NA
AVK15935.1|2325805_2325979_+	hypothetical protein	NA	NA	NA	NA	NA
AVK15973.1|2326637_2326964_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21031.1|2326960_2327461_+	putative membrane protein	NA	NA	NA	NA	NA
AVK18815.1|2327457_2327829_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18106.1|2327822_2328380_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AVK21118.1|2328422_2328716_+	resolvase, N terminal domain protein	NA	E5FFF9	Burkholderia_phage	37.9	5.6e-10
AVK16697.1|2329545_2330559_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2340175:2342413	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGTTTGGTCACGGGCATCATCCGGGAGCCTGGCGACAAAGGATTGGTCGATTTTCAATGTGGTGATGGGGCAGCATTTCAGATGTTGCAGGCAGGAATAGCCGGTGCCGAAGTCGTCGGCGGCGAAGCGCACGCCGATGGCGCGCAAGGCGTCGAAACTGGCGAACAGGGCTGGATTGCCGAATGCGACCGATTCGGTCAGTTCGATCTCCAGAAGCTCGGCGGGCAGGGCCATATCGGCCAGCACCCGCTTTACCTCGTCGTCGAACGTTGGCCCAACCTGGCTGGCGGACACATTGATGGCAAGACGGAACGGTTGCCATGCCGGTCCTTGCCACTTGTGCATCTGGCGACAGGCCTCGCCCAGCACCCACGCGCCTATTTCCGGCATCAGGCCGAACGACTCGGCCAGCGGCAGGAACTGGCCGGGCGGCAACAGGCCAAGCCTCGGATGCCGCCAGCGCATCAACGCTTCCGCGCCAGCGATCCGGTGATCGCGCAGATCGACCAGCGGCTGGTAATGCAGGTCAAGCTGTCCGCGCGCCGCCGCCTGCGCCAACTCGGCCGCCGTCCATCCGGCGGGCTGCGAACTCGTCATGATCCGCCCCGGAAGGCGCGCAGCAGCCGCGTTACGGCCAGAACGAACAAGCCGGTCAGCGCGAGCGCGGCAACACCCCAATGCTCGCCAAGGAAGGCACCGGCGGTCGTCCCGGCCAGCACGGCGGCGAGAATCGGCAGATGGCAGGGGCAGGTCAACACGGCCAGCGCACCCCACAGGTAGCCGGAAACGGGTTGGCGCGTCTCGGGCGGCAGTTTGTCAGGGGCGTTCACGGCAATGCCTCCTCGTGCGCCCGCTCGGCTGGCATGGAGGCCAGTTGCGCGTCCAGATGGGCCAACGCCGCGCGCCGCCGCTCGACCAACTGGCGCAGCACGGCAAGCTGCGCTGCGGCTTGTGCGCCGTCCGCTGCGTCGAGCGCACGGCACAGCCGCGCCAGGGCATCCAGGCCGATACCCGCCTCGAAGGCCGCGCGCACGAAGCACAGCCGTTGCAAGGCCGCATCGTCGAACACGCCTTAGCCGCCCGTGGTGCAGGCCACCGGCCGTAACAAGCCGCGCACCAGGTAGTCGCGCACGATATGTACGCTCACCCCAGCGTTATGGGCCAGTTGCGATACCGTGTAGGCGCTCATCGCACACCTCCTTGTCCTCACCCGGCGCAGCAGGAAAGCTGCTTCACATCCTTGTTGAAGGTCTGCGCCGCGAGCTTCAACCCTTCGACCATCGTCAGGTAGGGGAACAACTGGTCGGCCAGTTCCTGCACCGTCATCCGGTTGCGAATCGCCAGTGCGGCCGTCTGGATCAGTTCGCCCGCTTCCGGGGCCACTGCCTGCACGCCGATCAGTCGTCCGCTGCCTTCTTCAACCACCAGTTTGATGAAGCCGCGCGTGTCGAAGTTGGCGAGCGCGCGCGGCACGTTGTCCAGCGTTAGCGTGCGACTATCAGTTTTGATGCCGTCATGGTGCGCTTCCGCCTCGCTGTAGCCTACGGTCGCCACTTGCGGGTCGGTGAACACCACGGCCGGCATCGCGGTCAGGTTCAGGGCCGCGTCACCGCCGGTCATGTTGATCGCGGCGCGAGTGCCGGCCGCTGCCGCCACATAGACGAACTGCGGCTGGTCGGTGCAGTCGCCTGCGGCGTAGATGTGTTCCACGCTTGTACGCATGCCGGGGTCGATGACGATAGCGCCTTGCGGGGTGAGCGTGACGCCCGTCGCATCCAGTGCCAGCTTGCGTGTGTTGGGCGCGCGGCCGGTGGCGACCAGCAGCTTGTCGGCGCGCAGTTCGCCGTGCGCCGTGGTGAGCACGAATTCGCCGTCCCCTTCACCATTGATATACGCGACCTGGCTGGCCTGGGTGTGTTCCCTCACCTCGATGCCCTCCATGCGGAATGCGGCCGTGACGGCTTCGCCTATAGCTGGGTCTTCGCGGAAGAACAGCGTGCTGCGAGCCAGGATCGTCACCTTCGCTCCGAGTCGGGCGAACGCCTGCGCCAGCTCCAGCGCCACCACTGATGAGCCAATCACGGCCAGGCGCTTAGGAATCGTCTCGCTGACCAGCGCTTCAGTGGAAGTCCAGT	NA	NA	NA	NA
>prophage 7
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	3654484	3691799	7240677	coat	Ralstonia_phage(100.0%)	50	NA	NA
AVK17421.1|3654484_3654682_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
AVK18010.1|3654907_3655216_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18783.1|3655478_3655715_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18617.1|3655702_3655891_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19909.1|3656132_3657386_-	putative replication-associated protein G2P	NA	NA	NA	NA	NA
AVK21021.1|3657504_3657795_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK21481.1|3658317_3658737_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18810.1|3658886_3660074_-	zonular occludens toxin family protein	NA	A0A0K2QQ20	Ralstonia_phage	28.3	1.9e-27
AVK20228.1|3660076_3660337_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18700.1|3660392_3661883_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20687.1|3661997_3662195_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
AVK19507.1|3662420_3662729_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20467.1|3662991_3663228_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22681.1|3663215_3663404_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19469.1|3663645_3664899_-	putative replication-associated protein G2P	NA	NA	NA	NA	NA
AVK18049.1|3665017_3665308_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK21321.1|3665830_3666250_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18640.1|3666399_3667587_-	zonular occludens toxin family protein	NA	A0A0K2QQ20	Ralstonia_phage	28.3	1.9e-27
AVK18841.1|3667589_3667850_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16642.1|3667905_3669396_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19442.1|3669510_3669708_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
AVK16525.1|3669933_3670242_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22228.1|3670504_3670741_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22229.1|3670728_3670917_-	hypothetical protein	NA	NA	NA	NA	NA
AVK21888.1|3671158_3672301_-	putative replication-associated protein G2P	NA	NA	NA	NA	NA
AVK17034.1|3672492_3672837_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK16551.1|3673356_3673776_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21164.1|3673925_3675113_-	zonular occludens toxin family protein	NA	A0A0K2QQ20	Ralstonia_phage	28.3	1.9e-27
AVK22585.1|3675115_3675376_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19945.1|3675431_3676922_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16150.1|3677036_3677234_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
AVK16126.1|3677459_3677768_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16352.1|3678030_3678267_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19814.1|3678254_3678443_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19422.1|3678684_3679827_-	putative replication-associated protein G2P	NA	NA	NA	NA	NA
AVK20602.1|3680018_3680363_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK22762.1|3680882_3681302_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18365.1|3681451_3682639_-	zonular occludens toxin family protein	NA	A0A0K2QQ20	Ralstonia_phage	28.3	1.9e-27
AVK17701.1|3682641_3682902_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19176.1|3682957_3684448_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19641.1|3684562_3684760_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
AVK19502.1|3684985_3685294_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18139.1|3685556_3685805_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19517.1|3685877_3687041_-	phage X family protein	NA	NA	NA	NA	NA
AVK22074.1|3687151_3687346_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18416.1|3687921_3688341_+	hypothetical protein	NA	NA	NA	NA	NA
AVK17478.1|3688490_3689678_-	zonular occludens toxin family protein	NA	A0A0K2QQ20	Ralstonia_phage	28.3	1.9e-27
AVK19008.1|3689680_3689941_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16512.1|3689996_3691487_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18043.1|3691601_3691799_-|coat	bacteriophage coat B family protein	coat	NA	NA	NA	NA
>prophage 8
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4309657	4362578	7240677	tail,coat,terminase,integrase	Pseudomonas_phage(81.03%)	60	4309338:4309397	4358661:4358752
4309338:4309397	attL	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGG	NA	NA	NA	NA
AVK22397.1|4309657_4310170_+	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	89.9	1.2e-89
AVK19512.1|4310207_4310894_+	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	89.9	8.8e-123
AVK17004.1|4310875_4311139_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	94.3	2.9e-42
AVK17832.1|4311174_4311438_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	91.9	5.3e-36
AVK16637.1|4311434_4311788_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	81.9	2.7e-43
AVK18431.1|4311799_4312429_-	chitinase class I family protein	NA	J7I4M6	Pseudomonas_phage	94.7	9.3e-111
AVK19444.1|4312495_4314553_-	structural 2 domain protein	NA	A0A127KNR5	Pseudomonas_phage	91.8	0.0e+00
AVK16330.1|4314613_4317271_-|tail	phage tail family protein	tail	A0A127KNI3	Pseudomonas_phage	83.4	0.0e+00
AVK18598.1|4317720_4318083_-	hypothetical protein	NA	H2BD93	Pseudomonas_phage	97.5	1.7e-61
AVK20531.1|4318195_4318663_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.1	9.3e-92
AVK21403.1|4318659_4321158_-	tape measure domain protein	NA	J7HXG0	Pseudomonas_phage	98.1	0.0e+00
AVK18985.1|4321157_4321643_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.1	2.5e-87
AVK21961.1|4321771_4322767_-|tail	phage major tail 2 family protein	tail	J7HX84	Pseudomonas_phage	93.1	1.8e-156
AVK16291.1|4322781_4323156_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
AVK20650.1|4323558_4323897_-	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	8.0e-61
AVK19061.1|4323893_4324295_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.0	2.3e-70
AVK20700.1|4324368_4324833_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	77.0	2.7e-51
AVK22433.1|4324843_4325938_-|coat	putative coat protein	coat	A0A125RNM3	Pseudomonas_phage	98.9	7.0e-207
AVK19236.1|4325953_4326403_-	putative glycoprotein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.6e-77
AVK17502.1|4326406_4327684_-|coat	putative phage coat protein	coat	A0A125RNM1	Pseudomonas_phage	99.3	2.4e-214
AVK16798.1|4327687_4328539_-	phage Mu F like family protein	NA	A0A125RNM0	Pseudomonas_phage	99.6	2.0e-156
AVK21922.1|4328573_4329881_-	hypothetical protein	NA	J7I414	Pseudomonas_phage	99.8	1.8e-257
AVK19858.1|4329911_4330190_+	hypothetical protein	NA	J7HXH2	Pseudomonas_phage	87.8	3.4e-09
AVK20826.1|4330143_4331397_-|terminase	phage terminase large subunit	terminase	J7I4J3	Pseudomonas_phage	99.8	2.9e-249
AVK22581.1|4331380_4331923_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	98.3	5.0e-97
AVK16880.1|4331931_4332078_-	hypothetical protein	NA	H2BD74	Pseudomonas_phage	97.9	3.7e-15
AVK16097.1|4332208_4332598_-	putative membrane protein	NA	H2BD73	Pseudomonas_phage	97.7	2.4e-61
AVK18113.1|4332712_4333522_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	98.5	1.1e-153
AVK20947.1|4333610_4333961_-	endodeoxyribonuclease RusA family protein	NA	J7I4J7	Pseudomonas_phage	97.4	1.1e-57
AVK21992.1|4334046_4335462_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.4	2.6e-262
AVK21490.1|4335454_4336303_-	hypothetical protein	NA	H2BD69	Pseudomonas_phage	97.8	1.1e-74
AVK16016.1|4336816_4336960_-	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	97.9	7.9e-18
AVK19215.1|4336985_4337276_-	hypothetical protein	NA	A0A127KNT4	Pseudomonas_phage	95.8	2.2e-43
AVK18993.1|4337278_4337851_-	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	4.6e-101
AVK21330.1|4337933_4338446_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	97.1	9.0e-88
AVK19446.1|4339468_4339657_+	repressor CI domain protein	NA	H2BDH4	Pseudomonas_virus	41.9	3.6e-10
AVK21560.1|4340831_4342118_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	92.9	6.6e-55
AVK20383.1|4342594_4342966_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	80.5	8.3e-51
AVK21111.1|4343483_4343636_+	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	96.8	9.9e-11
AVK20956.1|4343649_4343841_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	98.4	5.6e-27
AVK19757.1|4343837_4344047_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18949.1|4344057_4344966_+	putative phage-type endonuclease domain protein	NA	Q858E0	Salmonella_phage	71.6	2.1e-124
AVK20313.1|4344978_4345869_+	protein RecT	NA	Q858E1	Salmonella_phage	73.2	9.1e-104
AVK19364.1|4345875_4346076_+	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
AVK16185.1|4346088_4346853_+	putative dNA segregation ATPase FtsK/SpoIIIE	NA	J7I0T4	Pseudomonas_phage	67.8	6.0e-104
AVK16651.1|4346856_4347444_+	HNH endonuclease family protein	NA	A0A2I7RT07	Vibrio_phage	39.9	6.8e-23
AVK22820.1|4347443_4349186_+	recF/RecN/SMC N terminal domain protein	NA	J7HXJ7	Pseudomonas_phage	92.7	2.3e-284
AVK19282.1|4349235_4349949_+	exonuclease family protein	NA	A0A059VJT9	Pseudomonas_phage	47.3	7.2e-51
AVK20540.1|4350561_4352247_+	C-5 cytosine-specific DNA methylase family protein	NA	L7TH64	Pseudomonas_virus	98.2	4.0e-310
AVK21342.1|4352303_4352738_+	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	94.4	3.8e-63
AVK18067.1|4353124_4353751_+	putative upf86.8	NA	Q5QF30	Pseudomonas_virus	58.8	8.7e-61
AVK22138.1|4353747_4354308_+	hypothetical protein	NA	H2BD41	Pseudomonas_phage	93.7	3.8e-100
AVK18156.1|4354304_4354670_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	97.3	3.0e-61
AVK21110.1|4354666_4355173_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	95.8	1.2e-87
AVK17612.1|4355270_4356551_+	hypothetical protein	NA	A0A127KN88	Pseudomonas_phage	51.6	4.1e-49
AVK16533.1|4356550_4357030_+	hypothetical protein	NA	I6NVL3	Burkholderia_virus	55.3	3.6e-22
AVK19244.1|4357022_4357145_+	putative membrane protein	NA	A0A2K8HK84	Pseudomonas_phage	97.5	1.1e-12
AVK19606.1|4357580_4358606_+|integrase	phage integrase family protein	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.1	7.5e-110
AVK21456.1|4359068_4359602_-	proQ/FINO family protein	NA	NA	NA	NA	NA
4358661:4358752	attR	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGGAATCGAACCGGCGTTCACGGATTTGCAATCCG	NA	NA	NA	NA
AVK17287.1|4359692_4362578_-	his Kinase A domain protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.9e-33
>prophage 9
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4478985	4485879	7240677	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
AVK19645.1|4478985_4479654_+	inhibitor of apoptosis-promoting Bax1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
AVK22375.1|4479764_4480160_+	dsrE/DsrF-like family protein	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
AVK22515.1|4480156_4480516_+	sulfur relay protein TusC/DsrF	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
AVK21041.1|4480515_4480821_+	sulfur relay protein TusB/DsrH	NA	NA	NA	NA	NA
AVK17803.1|4480817_4481153_+	sulfur relay, TusE/DsrC/DsvC family protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
AVK22364.1|4481149_4482133_+	glycosyl transferase family, a/b domain protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
AVK17179.1|4482220_4483195_+	glutathione S-transferase, C-terminal domain protein	NA	NA	NA	NA	NA
AVK20995.1|4483199_4484597_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVK19799.1|4484598_4485879_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 10
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4739332	4748228	7240677	transposase	Pseudomonas_phage(100.0%)	8	NA	NA
AVK22612.1|4739332_4739596_-	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
AVK17405.1|4739631_4739880_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	90.2	1.0e-33
AVK17912.1|4739891_4740017_-	hypothetical protein	NA	Q9MC89	Pseudomonas_phage	82.9	1.5e-09
AVK21183.1|4739999_4740218_+	hypothetical protein	NA	NA	NA	NA	NA
AVK20659.1|4740256_4740886_-	chitinase class I family protein	NA	A0A125RNP1	Pseudomonas_phage	95.7	5.4e-111
AVK18976.1|4741515_4742055_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	81.1	1.1e-48
AVK20970.1|4742757_4744029_-|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AVK19607.1|4744661_4748228_-	hypothetical protein	NA	A0A0S2SYC5	Pseudomonas_phage	87.5	0.0e+00
>prophage 11
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	5621838	5667662	7240677	terminase,protease,integrase,portal,head,holin,capsid	Pseudomonas_phage(80.77%)	64	5617280:5617298	5676356:5676374
5617280:5617298	attL	GCCGCCGGTATCGACGGCC	NA	NA	NA	NA
AVK21975.1|5621838_5622096_-	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	97.3	1.8e-33
AVK20654.1|5622092_5622395_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	88.0	2.2e-41
AVK16005.1|5622950_5623232_-	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
AVK19434.1|5623231_5623792_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	97.3	1.0e-97
AVK18199.1|5623794_5623986_-	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	98.4	3.5e-29
AVK21810.1|5623978_5624566_-	putative suh protein	NA	A0A1B0Z051	Pseudomonas_phage	91.8	5.3e-100
AVK17005.1|5624587_5626081_-	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	99.0	1.8e-285
AVK17650.1|5626067_5626490_-	hypothetical protein	NA	A0A1B0YZV1	Pseudomonas_phage	97.1	1.0e-68
AVK22596.1|5626502_5626652_-	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	100.0	6.1e-21
AVK19357.1|5627044_5627455_-	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	94.1	4.7e-55
AVK19161.1|5627457_5629161_-	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	96.3	0.0e+00
AVK18544.1|5629162_5629564_-	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	99.2	4.1e-72
AVK20257.1|5629675_5631817_-	tape measure domain protein	NA	A0A0U3TH20	Pseudomonas_phage	99.4	0.0e+00
AVK22068.1|5631806_5631956_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16203.1|5632000_5632366_-	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	97.5	1.2e-57
AVK21645.1|5632421_5633207_-	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	96.2	7.4e-142
AVK17288.1|5633230_5633521_-	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	96.9	1.4e-45
AVK18335.1|5633680_5634274_-	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	3.7e-101
AVK22199.1|5634270_5634822_-	hypothetical protein	NA	NA	NA	NA	NA
AVK21325.1|5635165_5635345_-	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	71.2	1.2e-15
AVK22738.1|5635348_5635480_-	hypothetical protein	NA	NA	NA	NA	NA
AVK19516.1|5635613_5636870_-|capsid	phage major capsid protein, HK97 family	capsid	Q6JIM7	Burkholderia_virus	49.5	8.3e-95
AVK20854.1|5636881_5637565_-|head,protease	phage prohead protease, HK97 family	head,protease	Q6JIM8	Burkholderia_virus	65.5	7.3e-69
AVK18120.1|5637579_5638698_-|portal	phage portal protein, HK97 family	portal	Q6JIM9	Burkholderia_virus	55.0	3.4e-116
AVK19386.1|5638906_5639071_-	putative membrane protein	NA	NA	NA	NA	NA
AVK21669.1|5639073_5640834_-	phage Terminase family protein	NA	A0A0U4B0M7	Pseudomonas_phage	95.2	0.0e+00
AVK20255.1|5640826_5641093_-|terminase	phage terminase, small subunit	terminase	NA	NA	NA	NA
AVK18347.1|5641366_5641516_-	HNH endonuclease family protein	NA	A0A0U4B0J6	Pseudomonas_phage	98.0	8.5e-23
AVK21893.1|5641877_5642288_-	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.1e-51
AVK20648.1|5642326_5642944_-	chitinase class I family protein	NA	A0A0U4JP23	Pseudomonas_phage	91.2	5.7e-105
AVK17431.1|5642940_5643270_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	99.1	1.2e-56
AVK17846.1|5644189_5644864_-	hypothetical protein	NA	A0A1B0YZZ3	Pseudomonas_phage	98.7	1.3e-118
AVK21915.1|5645194_5645353_-	bacteriophage Lambda NinG family protein	NA	A0A0U4KL68	Pseudomonas_phage	96.2	2.7e-19
AVK17187.1|5645772_5645979_-	putative ninG protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	4.5e-30
AVK21799.1|5645975_5646440_-	replication P family protein	NA	A0A0U4ISJ0	Pseudomonas_phage	98.1	6.9e-79
AVK17535.1|5646655_5646880_-	hypothetical protein	NA	A0A0U4IBP5	Pseudomonas_phage	95.9	2.1e-33
AVK21762.1|5648013_5648769_+	peptidase S24-like family protein	NA	L7TH81	Pseudomonas_virus	73.6	6.4e-74
AVK18265.1|5648881_5649175_+	putative aDP-ribosyl-[dinitrogen reductase] hydrolase	NA	NA	NA	NA	NA
AVK19796.1|5649276_5649531_+	hypothetical protein	NA	NA	NA	NA	NA
AVK17801.1|5649583_5649838_-	hypothetical protein	NA	A0A127KNY9	Pseudomonas_phage	69.5	4.8e-26
AVK18488.1|5650610_5650793_+	hypothetical protein	NA	W6MYA9	Pseudomonas_phage	100.0	7.2e-32
AVK21048.1|5651066_5651777_+	hypothetical protein	NA	A0A088FRV0	Escherichia_phage	47.8	1.5e-53
AVK17313.1|5651790_5652636_+	korB domain protein	NA	A0A1B0YZX8	Pseudomonas_phage	89.6	5.4e-138
AVK20363.1|5652840_5653227_+	bacterial regulatory, luxR family protein	NA	A0A1B0YZX7	Pseudomonas_phage	98.4	4.0e-64
AVK18327.1|5653237_5653486_+	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	90.2	5.5e-35
AVK22096.1|5653482_5653686_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18073.1|5653699_5654374_+	DNA polymerase III beta subunit, central domain protein	NA	NA	NA	NA	NA
AVK18009.1|5654373_5654676_+	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	96.0	1.1e-40
AVK17631.1|5654742_5655120_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21771.1|5655116_5656541_+	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A2I7QRH3	Vibrio_phage	48.9	3.0e-109
AVK17454.1|5656537_5657074_+	hypothetical protein	NA	A0A0U4IBL4	Pseudomonas_phage	96.0	2.6e-98
AVK21345.1|5657131_5657482_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	89.7	1.3e-58
AVK20086.1|5657525_5657813_+	hypothetical protein	NA	H2BD39	Pseudomonas_phage	95.1	4.3e-39
AVK18944.1|5657776_5657983_+	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	87.0	4.2e-28
AVK16331.1|5658123_5659548_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	50.9	1.3e-48
AVK20254.1|5659540_5659924_+	hypothetical protein	NA	A0A2H5BQE7	Pseudomonas_phage	96.8	9.6e-10
AVK22184.1|5660039_5660255_+	lar family protein	NA	A0A1B0YZX4	Pseudomonas_phage	93.3	1.3e-16
AVK16265.1|5660526_5660817_+	hypothetical protein	NA	A0A0U4JNZ9	Pseudomonas_phage	91.7	2.6e-44
AVK18961.1|5660829_5660952_+	putative membrane protein	NA	NA	NA	NA	NA
AVK17143.1|5661393_5662377_+|integrase	phage integrase family protein	integrase	A0A1B0Z061	Pseudomonas_phage	98.2	3.4e-184
AVK16271.1|5662585_5663476_+	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	28.1	4.8e-20
AVK16549.1|5663480_5664563_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
AVK21757.1|5664669_5665449_+	hypothetical protein	NA	NA	NA	NA	NA
AVK16950.1|5666435_5667662_+	GDP-mannose 6-dehydrogenase	NA	A0A218MKK1	uncultured_virus	25.3	3.3e-27
5676356:5676374	attR	GGCCGTCGATACCGGCGGC	NA	NA	NA	NA
>prophage 12
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	6517075	6563761	7240677	tail,plate,holin,tRNA	Pseudomonas_phage(36.36%)	54	NA	NA
AVK20296.1|6517075_6518275_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AVK20172.1|6518463_6519903_+	opacity-associated A LysM-like domain protein	NA	O03937	Lactobacillus_phage	44.1	3.3e-18
AVK21494.1|6519905_6520997_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AVK19919.1|6521050_6521401_-	iron-sulfur cluster assembly accessory family protein	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
AVK17661.1|6521478_6521892_-	polymer-forming cytoskeletal family protein	NA	NA	NA	NA	NA
AVK18492.1|6521901_6522621_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22156.1|6522620_6523655_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AVK16708.1|6523945_6524368_+	hypothetical protein	NA	NA	NA	NA	NA
AVK19765.1|6524384_6525353_+	nitronate monooxygenase family protein	NA	NA	NA	NA	NA
AVK16019.1|6525474_6526557_+	hypothetical protein	NA	NA	NA	NA	NA
AVK17155.1|6526617_6527418_+	KR domain protein	NA	NA	NA	NA	NA
AVK17156.1|6527457_6528939_-	ATPase associated with various cellular activities family protein	NA	U5XJW0	Phormidium_phage	33.8	5.1e-67
AVK16466.1|6529017_6529356_+	HIT domain protein	NA	NA	NA	NA	NA
AVK17007.1|6529455_6530103_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AVK16263.1|6530157_6530952_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVK21195.1|6531271_6531694_-	osmC-like family protein	NA	NA	NA	NA	NA
AVK22490.1|6531965_6532610_+	cyclic AMP receptor-like protein	NA	NA	NA	NA	NA
AVK20365.1|6532671_6533502_-	indole-3-glycerol phosphate synthase family protein	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.6e-70
AVK17952.1|6533504_6534554_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
AVK21723.1|6534555_6535161_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
AVK17623.1|6535377_6535542_+	hypothetical protein	NA	NA	NA	NA	NA
AVK20465.1|6535566_6535794_-	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
AVK16252.1|6536101_6537202_-	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.6e-116
AVK16408.1|6538187_6541841_-	hypothetical protein	NA	A0A0S2SYC5	Pseudomonas_phage	57.3	0.0e+00
AVK21814.1|6541899_6542502_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
AVK21100.1|6542556_6543327_-	nlpC/P60 family protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
AVK16907.1|6543329_6544025_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
AVK16365.1|6544032_6544374_-|tail	phage minor tail family protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
AVK17035.1|6544366_6546205_-|tail	phage tail tape measure protein, lambda family	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
AVK22008.1|6546251_6546506_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
AVK16118.1|6546535_6546883_-	hypothetical protein	NA	NA	NA	NA	NA
AVK18643.1|6546894_6547389_-	structural protein 3	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
AVK20508.1|6547704_6547845_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	69.8	1.6e-07
AVK21775.1|6547958_6548321_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	5.5e-15
AVK21772.1|6548317_6548947_-	chitinase class I family protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
AVK20945.1|6548979_6549969_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	6.3e-106
AVK22529.1|6550026_6550200_-	phage Tail Protein X family protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.9	6.0e-12
AVK18003.1|6550207_6551080_-	phage P2 GpU family protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
AVK21265.1|6551089_6553327_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22459.1|6553496_6553841_-	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AVK17812.1|6553855_6554359_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
AVK19987.1|6554371_6555532_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
AVK18087.1|6555574_6556015_-|tail	putative tail fiber assembly	tail	NA	NA	NA	NA
AVK17777.1|6556023_6558132_-|tail	phage tail-collar fiber family protein	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
AVK19459.1|6558133_6558607_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	68.0	1.2e-59
AVK21223.1|6558659_6559547_-|plate	baseplate J-like family protein	plate	S4TNY7	Salmonella_phage	59.8	5.3e-88
AVK16091.1|6559543_6559768_-	lysozyme family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	54.1	1.5e-15
AVK18112.1|6560022_6560580_-|plate	phage baseplate assembly V family protein	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.9	1.7e-44
AVK19658.1|6560576_6561092_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
AVK18288.1|6561113_6561467_-|holin	putative holin	holin	B5TK61	Pseudomonas_phage	53.3	3.0e-26
AVK20960.1|6561925_6562285_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16710.1|6562332_6562533_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
AVK20841.1|6562582_6562717_+	hypothetical protein	NA	NA	NA	NA	NA
AVK21179.1|6562990_6563761_+	repressor protein CI	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
>prophage 13
CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	7008133	7044766	7240677	transposase,integrase	Shigella_phage(33.33%)	31	7015307:7015324	7047770:7047787
AVK22100.1|7008133_7009294_-|integrase	phage integrase family protein	integrase	A0A1W6JTA0	Pseudomonas_phage	30.7	1.4e-35
AVK20815.1|7009286_7009520_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AVK18876.1|7009667_7009880_+	cro/C1-type HTH DNA-binding domain protein	NA	NA	NA	NA	NA
AVK16892.1|7009898_7013012_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK16553.1|7013008_7015492_-	hypothetical protein	NA	NA	NA	NA	NA
7015307:7015324	attL	CGCTACGTCCATGGCATC	NA	NA	NA	NA
AVK19749.1|7015891_7017001_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	57.1	2.1e-113
AVK16933.1|7017887_7018703_+|transposase	putative transposase	transposase	A0A218MNE7	uncultured_virus	51.2	2.3e-77
AVK19343.1|7018737_7020180_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AVK19179.1|7020185_7020953_-	sugar-specific transcriptional regulator TrmB family protein	NA	NA	NA	NA	NA
AVK16022.1|7021137_7022247_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AVK17761.1|7022322_7024308_+	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AVK20124.1|7024304_7025090_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	25.9	2.4e-15
AVK17052.1|7025086_7025830_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.8e-12
AVK19013.1|7025826_7026957_+	ring hydroxylating alpha subunit family protein	NA	NA	NA	NA	NA
AVK21201.1|7027920_7029534_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AVK19099.1|7029593_7030373_-	winged helix-turn helix family protein	NA	NA	NA	NA	NA
AVK22780.1|7030349_7030571_+	hypothetical protein	NA	NA	NA	NA	NA
AVK19682.1|7030804_7030939_+	hypothetical protein	NA	NA	NA	NA	NA
AVK18320.1|7031004_7031157_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20439.1|7031612_7031876_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20722.1|7031994_7032177_-	putative membrane protein	NA	NA	NA	NA	NA
AVK19989.1|7033572_7034730_-	hypothetical protein	NA	NA	NA	NA	NA
AVK16930.1|7034713_7038019_-	exonuclease SbcCD, C subunit	NA	NA	NA	NA	NA
AVK16207.1|7038015_7038765_-	hypothetical protein	NA	NA	NA	NA	NA
AVK20809.1|7038767_7040120_-	hypothetical protein	NA	NA	NA	NA	NA
AVK21725.1|7040918_7041233_-	hypothetical protein	NA	NA	NA	NA	NA
AVK22693.1|7041406_7041778_-	hypothetical protein	NA	NA	NA	NA	NA
AVK17311.1|7042148_7042457_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	47.5	3.6e-15
AVK19312.1|7042465_7043068_+	DDE domain protein	NA	Q716C2	Shigella_phage	53.3	5.8e-46
AVK21594.1|7043033_7044431_-	homeo-like domain protein	NA	W5R8L2	Staphylococcus_phage	32.6	7.7e-41
AVK22608.1|7044454_7044766_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	56.7	2.2e-25
7047770:7047787	attR	CGCTACGTCCATGGCATC	NA	NA	NA	NA
