The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	151707	163361	5194420	capsid,integrase	Enterobacteria_phage(70.0%)	14	139841:139855	162898:162912
139841:139855	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
AVK34233.1|151707_154041_-	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AVK34647.1|154052_154373_-	putative dNA replication protein	NA	NA	NA	NA	NA
AVK30892.1|154369_154549_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34321.1|154593_154788_-	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	3.2e-22
AVK31805.1|155147_155414_-	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVK34166.1|155518_155656_+	hypothetical protein	NA	NA	NA	NA	NA
AVK33926.1|155955_156693_+|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AVK33096.1|156689_156935_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AVK32338.1|156952_157519_+	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AVK33330.1|158087_158513_-	hypothetical protein	NA	NA	NA	NA	NA
AVK32467.1|158512_159445_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	Q8JL10	Natrialba_phage	25.3	1.5e-08
AVK33948.1|159450_160641_-|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AVK31968.1|160993_162247_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AVK34342.1|162257_163361_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
162898:162912	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	814167	851503	5194420	head,plate,integrase,capsid,tail,lysis,portal,terminase	Salmonella_phage(87.5%)	49	814075:814093	851575:851593
814075:814093	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AVK33978.1|814167_815148_-|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
AVK29971.1|815638_817123_+	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVK31160.1|817221_818166_-	hypothetical protein	NA	NA	NA	NA	NA
AVK33737.1|818177_819113_-	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.8e-30
AVK34015.1|819276_819429_-	hypothetical protein	NA	NA	NA	NA	NA
AVK33557.1|819455_819965_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVK31771.1|819972_820173_+	protein fil	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AVK33472.1|820247_820364_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34901.1|820337_820478_+	putative fels-2 prophage protein	NA	E5G6L5	Salmonella_phage	100.0	3.5e-18
AVK30653.1|820545_820779_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AVK32862.1|820778_821006_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AVK34186.1|821002_821860_+	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AVK34031.1|821856_824271_+	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AVK33148.1|824424_824613_+	putative levan regulatory protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVK33515.1|824623_824857_+	dinI-like family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVK33613.1|825460_825649_+	putative fels-2 prophage protein	NA	NA	NA	NA	NA
AVK34288.1|825924_827667_+	AIPR family protein	NA	NA	NA	NA	NA
AVK32559.1|827728_828754_-|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVK31722.1|828753_830520_-	sigma-70, region 4 family protein	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AVK30530.1|830662_831496_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AVK31631.1|831512_832571_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVK33750.1|832574_833225_+|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AVK30166.1|833320_833785_+|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AVK33922.1|833784_833988_+	phage Tail Protein X family protein	NA	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVK33061.1|833991_834207_+	putative membrane protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AVK32593.1|834187_834697_+	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AVK30780.1|834701_835085_+	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AVK31562.1|835081_835510_+|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVK29990.1|835496_835643_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
AVK33440.1|835605_836037_+|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AVK31998.1|836071_836476_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	72.0	4.3e-45
AVK32606.1|836472_836982_-	hypothetical protein	NA	NA	NA	NA	NA
AVK30931.1|836980_837145_+	hypothetical protein	NA	NA	NA	NA	NA
AVK32052.1|837259_837832_+|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AVK32579.1|837846_838191_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	3.7e-45
AVK31669.1|838177_839086_+|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AVK34082.1|839078_839678_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AVK34734.1|839667_842631_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AVK31236.1|842634_843366_+	concanavalin A-like lectin/glucanases superfamily protein	NA	NA	NA	NA	NA
AVK33693.1|843404_843566_+	hypothetical protein	NA	NA	NA	NA	NA
AVK31664.1|843595_844672_+|tail	phage tail-collar fiber family protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AVK31659.1|844810_845983_+|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AVK30916.1|845992_846508_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVK33189.1|846560_846860_+	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	79.0	3.7e-33
AVK34743.1|846874_846994_+	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVK32930.1|846986_849614_+|tail	phage tail tape measure protein, TP901 family, core region	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AVK30390.1|849610_850096_+	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AVK32443.1|850092_851193_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AVK31823.1|851347_851503_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	65.3	3.8e-10
851575:851593	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	885919	895383	5194420	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
AVK31194.1|885919_887035_+	macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVK31204.1|887031_888972_+	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVK32057.1|889048_889270_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVK32501.1|889595_889913_+|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVK30759.1|889943_892223_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVK30258.1|892343_892562_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVK32885.1|892915_893617_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVK32833.1|893661_895383_-	thiol reductant ABC exporter, CydC subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	1544304	1555191	5194420		Escherichia_phage(87.5%)	9	NA	NA
AVK33247.1|1544304_1544898_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	100.0	9.6e-110
AVK33936.1|1544917_1546183_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AVK32479.1|1546194_1547097_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AVK30739.1|1547357_1548119_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVK31297.1|1548139_1549000_-	beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVK32561.1|1549318_1549558_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.5	6.3e-36
AVK33008.1|1549644_1550733_+	recF/RecN/SMC N terminal domain protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AVK31750.1|1550763_1552029_-	lactose permease	NA	NA	NA	NA	NA
AVK30080.1|1552083_1555191_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	2554473	2561359	5194420		Bacillus_phage(33.33%)	7	NA	NA
AVK30104.1|2554473_2555952_+	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
AVK33947.1|2555948_2556671_+	transcriptional regulatory, C terminal family protein	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AVK34585.1|2556989_2558351_+	peptidase U32 family protein	NA	Q6DW11	Phage_TP	94.5	2.5e-206
AVK31780.1|2558596_2559490_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVK32733.1|2559490_2559622_-	hypothetical protein	NA	NA	NA	NA	NA
AVK30747.1|2559732_2560506_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
AVK30180.1|2560516_2561359_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	27.5	5.5e-10
>prophage 6
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	3735619	3780004	5194420	head,capsid,tail,protease,portal,terminase	uncultured_Caudovirales_phage(66.67%)	49	NA	NA
AVK33624.1|3735619_3736987_+|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AVK30724.1|3737074_3738133_+	periplasmic serine peptidase DegS	NA	NA	NA	NA	NA
AVK30349.1|3738269_3739208_-	malate dehydrogenase, NAD-dependent	NA	NA	NA	NA	NA
AVK31938.1|3739622_3740093_+	arginine repressor	NA	NA	NA	NA	NA
AVK33193.1|3740468_3740732_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34747.1|3740980_3741097_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34822.1|3741147_3741423_-	hypothetical protein	NA	NA	NA	NA	NA
AVK31957.1|3741502_3743470_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AVK33080.1|3743475_3744366_-	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AVK30314.1|3744415_3744619_-	hypothetical protein	NA	NA	NA	NA	NA
AVK33387.1|3744750_3745680_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVK32266.1|3745715_3747161_-	modulator of DNA gyrase family protein	NA	NA	NA	NA	NA
AVK34366.1|3747249_3751014_-	asmA-like C-terminal region family protein	NA	NA	NA	NA	NA
AVK33760.1|3751084_3752554_-	ribonuclease, Rne/Rng family domain protein	NA	NA	NA	NA	NA
AVK30586.1|3752556_3753138_-	septum formation protein Maf	NA	NA	NA	NA	NA
AVK34108.1|3753145_3753634_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVK32505.1|3753633_3754626_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVK31086.1|3754696_3755740_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AVK33617.1|3756045_3757986_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVK34773.1|3758065_3758257_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34670.1|3758485_3759487_+	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AVK34066.1|3759486_3760095_+	ferric reductase like transmembrane component family protein	NA	NA	NA	NA	NA
AVK31499.1|3760318_3760771_+	3-dehydroquinate dehydratase, type II	NA	NA	NA	NA	NA
AVK33542.1|3760793_3761261_+	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AVK34240.1|3761271_3762621_+	acetyl-CoA carboxylase, biotin carboxylase subunit	NA	NA	NA	NA	NA
AVK34264.1|3762731_3762974_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34004.1|3762963_3764415_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AVK30954.1|3764426_3765308_+	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVK30369.1|3765785_3766631_+	TIM-barrel, nifR3 family protein	NA	NA	NA	NA	NA
AVK33974.1|3766655_3766952_+	bacterial regulatory, Fis family protein	NA	NA	NA	NA	NA
AVK30738.1|3767105_3767297_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34079.1|3767299_3768961_-	phage Terminase family protein	NA	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AVK32357.1|3768944_3769301_-|terminase	phage terminase, small subunit, P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AVK33882.1|3769431_3769584_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
AVK31040.1|3769576_3769969_-	HNH endonuclease family protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	90.0	1.4e-64
AVK32206.1|3770019_3770136_-	putative hNH endonuclease	NA	A0A2H4JD08	uncultured_Caudovirales_phage	89.5	1.4e-12
AVK33028.1|3770315_3770471_-|head,tail	phage head-tail joining family protein	head,tail	A0A1P8DTK6	Proteus_phage	54.0	7.2e-09
AVK31660.1|3770647_3771889_-|portal	phage portal protein, HK97 family	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AVK30590.1|3771890_3772451_-|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AVK33982.1|3772502_3773669_-|capsid	phage major capsid protein, HK97 family	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AVK31213.1|3773932_3774445_+	hypothetical protein	NA	NA	NA	NA	NA
AVK30710.1|3774493_3774829_-	hypothetical protein	NA	NA	NA	NA	NA
AVK33229.1|3775171_3777301_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AVK34197.1|3777306_3777672_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29970.1|3777668_3778025_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.4	2.3e-50
AVK33709.1|3778033_3778348_-	hypothetical protein	NA	NA	NA	NA	NA
AVK30236.1|3778340_3778529_-	hypothetical protein	NA	NA	NA	NA	NA
AVK32936.1|3778521_3778701_-	hypothetical protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AVK32121.1|3779242_3780004_-	phage antirepressor KilAC domain protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.1e-40
>prophage 7
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	4671831	4676918	5194420	transposase	Escherichia_phage(33.33%)	8	NA	NA
AVK32532.1|4671831_4672788_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
AVK33140.1|4672797_4673169_+	plasmid stability family protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AVK30824.1|4673334_4674120_-	DDE domain protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AVK31946.1|4674176_4674698_-|transposase	transposase family protein	transposase	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AVK33479.1|4674866_4675172_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVK33375.1|4675171_4676089_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AVK31403.1|4676164_4676278_+	hypothetical protein	NA	NA	NA	NA	NA
AVK30122.1|4676234_4676918_-	integral membrane, YjbE family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 8
CP027160	Klebsiella pneumoniae strain AR_0361 chromosome, complete genome	5194420	4872056	4879738	5194420	integrase,capsid,transposase	Enterobacteria_phage(85.71%)	12	4865658:4865672	4886607:4886621
4865658:4865672	attL	AGCGCCAGCGCCATC	NA	NA	NA	NA
AVK33745.1|4872056_4872623_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVK31479.1|4872640_4872886_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVK34838.1|4872882_4873620_-|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AVK31693.1|4874180_4874447_+	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AVK31944.1|4874797_4874992_+	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	7.2e-22
AVK33724.1|4874988_4875216_+	hypothetical protein	NA	NA	NA	NA	NA
AVK31380.1|4875263_4875533_+	DNA replication protein, phage-associated	NA	NA	NA	NA	NA
AVK31754.1|4875547_4877881_+	zinc-binding domain of primase-helicase family protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AVK33924.1|4877913_4878030_+	hypothetical protein	NA	NA	NA	NA	NA
AVK31699.1|4878626_4878893_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVK34687.1|4878970_4879126_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34349.1|4879258_4879738_+|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	29.7	1.6e-06
4886607:4886621	attR	GATGGCGCTGGCGCT	NA	NA	NA	NA
>prophage 1
CP027161	Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence	207543	15391	56398	207543	holin,transposase,integrase	Macacine_betaherpesvirus(14.29%)	37	22433:22449	53494:53510
AVK34946.1|15391_16471_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AVK34917.1|17078_17255_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35098.1|17401_18130_-	psiA family protein	NA	NA	NA	NA	NA
AVK35105.1|18126_18558_-	plasmid SOS inhibition family protein	NA	NA	NA	NA	NA
AVK34971.1|18624_20577_-	parB-like nuclease domain protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	8.6e-22
AVK34999.1|20730_20979_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34989.1|21027_21483_-	single-stranded DNA-binding family protein	NA	A0A0A0P1Q9	Enterobacteria_phage	71.4	2.5e-33
AVK35018.1|22345_22909_-	methyltransferase small domain protein	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
22433:22449	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
AVK34985.1|22956_24312_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34929.1|24685_24913_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35019.1|24876_25014_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34932.1|25694_25997_-	putative membrane protein	NA	NA	NA	NA	NA
AVK35000.1|26046_26301_-	hot	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
AVK35094.1|26537_26963_-	antirestriction family protein	NA	NA	NA	NA	NA
AVK35088.1|27947_29432_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVK34968.1|30017_30263_+	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	50.6	1.8e-14
AVK35046.1|30262_31534_+	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AVK35031.1|31672_31828_+	antitoxin, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AVK35095.1|31850_32708_-|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	80.9	1.0e-128
AVK35023.1|32704_32989_-|transposase	putative transposase family protein	transposase	A0A1W6JP07	Morganella_phage	86.8	1.0e-40
AVK35096.1|33523_34486_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35055.1|34485_35457_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AVK35037.1|35456_36575_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	98.4	1.7e-216
AVK35044.1|37644_38385_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	56.0	1.4e-60
AVK35083.1|39101_39842_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AVK34957.1|40976_41933_+	diguanylate cyclase domain protein	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AVK34967.1|42335_43259_+|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AVK35063.1|45408_46245_+	EAL domain protein	NA	NA	NA	NA	NA
AVK35100.1|47227_48505_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34935.1|48567_50571_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AVK34993.1|50716_51220_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	1.6e-84
AVK35036.1|51604_52486_-	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	63.2	1.2e-100
AVK34981.1|52443_52812_-|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	75.4	1.3e-43
AVK34974.1|53009_53387_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.3e-62
AVK35071.1|53540_53945_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
53494:53510	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
AVK35048.1|54240_54672_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVK34953.1|54922_56398_-	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
>prophage 2
CP027161	Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence	207543	75994	115079	207543	integrase,transposase	Escherichia_phage(33.33%)	45	70412:70428	110977:110993
70412:70428	attL	TGGCCGCTGGGCGTATC	NA	NA	NA	NA
AVK35040.1|75994_76309_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVK35106.1|76799_77615_-|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	A9YX10	Burkholderia_phage	25.9	1.7e-11
AVK35053.1|77730_78186_+	major intrinsic family protein	NA	NA	NA	NA	NA
AVK34991.1|78235_78733_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AVK34960.1|79064_79391_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK35009.1|79642_80101_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	79.5	6.6e-66
AVK34980.1|80139_80655_+	RNA polymerase sigma factor, sigma-70 family protein	NA	NA	NA	NA	NA
AVK34939.1|80730_81093_+	arsenical resistance operon trans-acting repressor ArsD family protein	NA	NA	NA	NA	NA
AVK34988.1|81117_82452_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVK34978.1|82481_82868_+	anion-transporting ATPase family protein	NA	NA	NA	NA	NA
AVK34987.1|82989_83526_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AVK35072.1|83558_83984_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AVK34931.1|83996_85286_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AVK35008.1|85333_87085_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVK34964.1|87102_87465_-	arsenical resistance operon trans-acting repressor ArsD	NA	NA	NA	NA	NA
AVK35012.1|87514_87865_-	bacterial regulatory, arsR family protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AVK35027.1|88222_88492_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34990.1|88536_89055_+	putative ydeA	NA	NA	NA	NA	NA
AVK35043.1|89085_89580_+	hypothetical protein	NA	NA	NA	NA	NA
AVK35004.1|90025_90229_+	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AVK35042.1|90610_90865_+	putative yaeB	NA	NA	NA	NA	NA
AVK34973.1|91976_93335_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AVK34983.1|93835_94447_-|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	45.9	4.0e-42
AVK34927.1|94557_94863_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK34998.1|95177_96140_-	peptidase M48 family protein	NA	NA	NA	NA	NA
AVK34992.1|96126_96561_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AVK35103.1|97113_97311_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34958.1|97310_100106_-	AAA domain protein	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AVK35101.1|100220_100790_-	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVK35061.1|100808_100946_+	hypothetical protein	NA	NA	NA	NA	NA
AVK35011.1|102078_102207_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34965.1|102330_102834_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.2	1.8e-88
AVK34994.1|103092_104073_+	hypothetical protein	NA	Q38213	Escherichia_phage	99.1	8.9e-185
AVK35025.1|104538_105174_-	hypothetical protein	NA	Q38213	Escherichia_phage	52.8	1.2e-33
AVK35054.1|105281_106151_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVK34969.1|106144_107155_-	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AVK34979.1|107163_107991_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AVK35092.1|107999_108809_-	phosphate/phosphite/phosphonate ABC transporter, periplasmic binding family protein	NA	NA	NA	NA	NA
AVK35093.1|108859_109420_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.4	1.6e-13
AVK35045.1|110028_110349_+	hypothetical protein	NA	Q38213	Escherichia_phage	52.9	3.2e-27
AVK34976.1|110542_111247_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
110977:110993	attR	GATACGCCCAGCGGCCA	NA	NA	NA	NA
AVK34919.1|111397_112213_+	phosphotransferase enzyme family protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AVK34923.1|112402_113008_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.5	6.4e-117
AVK34934.1|113118_114384_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	67.1	5.4e-142
AVK34959.1|114374_115079_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 3
CP027161	Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence	207543	118417	180028	207543	integrase,bacteriocin,transposase	Escherichia_phage(21.74%)	49	145027:145044	183163:183180
AVK35078.1|118417_119182_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVK34928.1|119408_119714_-	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AVK34947.1|119724_120930_-	chromate transporter, chromate ion transporter family protein	NA	NA	NA	NA	NA
AVK35081.1|121416_122256_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVK35032.1|122760_123552_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AVK35007.1|124601_125615_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVK34977.1|125967_126168_+	hypothetical protein	NA	NA	NA	NA	NA
AVK35010.1|126293_126854_+	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVK34945.1|126856_129823_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVK35024.1|129889_130267_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AVK35022.1|130467_131127_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AVK34922.1|131599_132103_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AVK34961.1|132334_133723_+	4Fe-4S single cluster domain protein	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
AVK35039.1|133715_134828_+	4Fe-4S single cluster domain protein	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AVK34975.1|136390_136738_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AVK35070.1|136787_137762_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.8	2.7e-149
AVK34944.1|137806_138325_+|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.1	1.7e-86
AVK34930.1|138392_138740_+|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.3	2.6e-62
AVK35033.1|140560_142294_-	nickel import ATP-binding protein NikE	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AVK35047.1|142301_143231_-	acetamidase/Formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.4e-11
AVK35049.1|143293_144898_-	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AVK35073.1|144910_145831_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
145027:145044	attL	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
AVK34984.1|145830_146679_-	N-terminal TM domain of oligopeptide transport permease C family protein	NA	NA	NA	NA	NA
AVK35086.1|146675_147269_-	response regulator	NA	NA	NA	NA	NA
AVK35058.1|147265_148393_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AVK35069.1|148677_148845_-|integrase	putative integrase catalytic region	integrase	NA	NA	NA	NA
AVK35090.1|149103_149472_+	putative tnpA	NA	U5N3F9	Enterobacteria_phage	89.9	2.4e-58
AVK34954.1|149947_150469_+	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AVK35017.1|150465_151419_+	fecR family protein	NA	NA	NA	NA	NA
AVK35021.1|151504_153829_+	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AVK35015.1|153873_154776_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AVK34926.1|154772_155771_+	ABC 3 transport family protein	NA	NA	NA	NA	NA
AVK34972.1|155767_156724_+	fe(3+) dicitrate transport system permease protein FecD	NA	NA	NA	NA	NA
AVK34936.1|156724_157492_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AVK34995.1|157590_157884_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AVK35013.1|157931_158051_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34925.1|158835_159846_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AVK34970.1|159868_160084_-	hypothetical protein	NA	NA	NA	NA	NA
AVK34950.1|160306_161389_+	periplasmic binding and sugar binding domain of LacI family protein	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AVK34996.1|161516_164585_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AVK35001.1|164666_165890_+	lactose permease	NA	NA	NA	NA	NA
AVK35060.1|166026_166638_+|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	99.4	3.5e-99
AVK35059.1|166741_166951_+|transposase	transposase family protein	transposase	Q9MCT5	Escherichia_phage	98.6	4.1e-31
AVK35068.1|167595_169905_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AVK34966.1|169908_171225_+	hypothetical protein	NA	NA	NA	NA	NA
AVK34963.1|171221_173417_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
AVK35076.1|174863_175721_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVK35066.1|176606_177086_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
AVK35082.1|177706_180028_-|bacteriocin	DNase/tRNase domain of colicin-like bacteriocin family protein	bacteriocin	NA	NA	NA	NA
183163:183180	attR	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
>prophage 1
CP027158	Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence	113639	2	8788	113639		Enterobacteria_phage(33.33%)	6	NA	NA
AVK29869.1|2_434_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AVK29870.1|433_1705_+	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AVK29815.1|2105_3002_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AVK29789.1|3386_4529_+	plasmid partition protein A	NA	Q1MVJ3	Enterobacteria_phage	90.0	7.6e-196
AVK29797.1|4525_5500_+	parB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AVK29805.1|6760_8788_+	hsdM N-terminal domain protein	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
CP027158	Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence	113639	13363	48926	113639	holin,integrase,transposase	Escherichia_phage(33.33%)	36	6570:6584	56344:56358
6570:6584	attL	GTCAGACTCTTCAGG	NA	NA	NA	NA
AVK29866.1|13363_14632_+|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
AVK29775.1|16438_17221_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AVK29756.1|17220_17553_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29834.1|17559_17958_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29771.1|17983_18229_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29861.1|18340_18613_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29793.1|18694_18946_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29776.1|19135_19570_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29798.1|19553_19784_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
AVK29831.1|19795_20197_+	PIN domain protein	NA	NA	NA	NA	NA
AVK29766.1|20291_20981_+	AAA domain protein	NA	NA	NA	NA	NA
AVK29792.1|21334_21712_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	93.6	1.9e-63
AVK29800.1|21873_22296_+	merC mercury resistance family protein	NA	NA	NA	NA	NA
AVK29770.1|22392_24042_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.5e-39
AVK29845.1|24059_24422_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AVK29783.1|24418_24655_+	merE family protein	NA	NA	NA	NA	NA
AVK29868.1|24651_25359_+	EAL domain protein	NA	NA	NA	NA	NA
AVK29796.1|25826_26702_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AVK29822.1|26748_27159_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.9e-72
AVK29816.1|27269_28130_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVK29802.1|29873_30578_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK29808.1|30650_33548_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AVK29855.1|33636_34257_+	resolvase, N terminal domain protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AVK29841.1|34646_34766_+	putative membrane protein	NA	NA	NA	NA	NA
AVK29762.1|35055_35190_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29767.1|35422_35782_-	hypothetical protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AVK29826.1|35953_36175_-|transposase	putative transposase	transposase	A0A1V0E8E1	Vibrio_phage	64.3	2.4e-13
AVK29787.1|36285_37470_+	DDE_Tnp_1-associated family protein	NA	NA	NA	NA	NA
AVK29779.1|37746_39066_+	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AVK29780.1|39315_40197_-	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVK29807.1|40484_41264_-	phoH-like family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AVK29790.1|41260_42286_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AVK29804.1|42392_45422_-	hypothetical protein	NA	NA	NA	NA	NA
AVK29760.1|45531_47247_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK29812.1|48429_48738_+|holin	choline kinase N terminus family domain protein	holin	NA	NA	NA	NA
AVK29835.1|48764_48926_+|transposase	putative transposase	transposase	NA	NA	NA	NA
56344:56358	attR	GTCAGACTCTTCAGG	NA	NA	NA	NA
>prophage 1
CP027162	Klebsiella pneumoniae strain AR_0361 plasmid unnamed3	42420	6028	25717	42420	transposase,integrase	Escherichia_phage(28.57%)	19	5737:5796	29882:30110
5737:5796	attL	CGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAG	NA	NA	NA	NA
AVK35114.1|6028_6733_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVK35115.1|7988_8816_+	initiator Replication family protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AVK35116.1|8992_9262_-	LWamide neuropeptides domain protein	NA	NA	NA	NA	NA
AVK35117.1|9676_10882_+	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AVK35118.1|10881_11856_+	parB	NA	Q38420	Escherichia_phage	54.1	5.0e-87
AVK35119.1|11937_13209_-	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
AVK35120.1|13208_13640_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AVK35121.1|14048_15533_+	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVK35122.1|15878_16382_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	89.8	2.6e-84
AVK35123.1|16510_16717_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35124.1|16742_17744_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35125.1|18147_19071_+|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AVK35126.1|19210_19345_-	putative stbA	NA	NA	NA	NA	NA
AVK35127.1|20178_20448_+|transposase	transposase DDE domain protein	transposase	A0A1B0VFY5	Salmonella_phage	98.7	1.5e-38
AVK35128.1|20444_23411_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AVK35129.1|23414_23975_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AVK35130.1|23963_24131_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
AVK35131.1|24150_24351_-	hypothetical protein	NA	NA	NA	NA	NA
AVK35132.1|24703_25717_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
29882:30110	attR	CGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAAC	NA	NA	NA	NA
>prophage 1
CP027164	Klebsiella pneumoniae strain AR_0361 plasmid unnamed4	5446	54	5446	5446	transposase	Escherichia_phage(83.33%)	6	NA	NA
AVK35149.1|54_915_+	beta-lactamase SHV-2	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVK35150.1|935_1697_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVK35151.1|1958_2861_+	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVK35152.1|2872_3505_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.9	8.5e-96
AVK35153.1|3501_4083_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.2	8.3e-82
AVK35154.1|4069_5446_-|transposase	tn3 transposase DDE domain protein	transposase	A0A125RQ78	Bacillus_phage	30.7	7.3e-44
