The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	7	20287	4332232		Bacillus_phage(95.24%)	30	NA	NA
AVI45271.1|7_259_+	Ribonucleoside-diphosphate reductase	NA	A0A1P8CX40	Bacillus_phage	86.4	3.3e-35
AVI45272.1|410_635_+	Ribonucleoside-diphosphate reductase	NA	A0A1P8CX40	Bacillus_phage	93.3	8.3e-30
AVI45273.1|2673_2925_+	Ribonucleoside-diphosphate reductase	NA	A0A1P8CX40	Bacillus_phage	83.6	1.6e-29
AVI45274.1|3058_3472_+	Ribonucleoside-diphosphate reductase	NA	A0A076G6W6	Bacillus_phage	91.0	1.3e-36
AVI45275.1|3882_4056_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45276.1|4601_5024_+	Ribonucleoside-diphosphate reductase	NA	R4JMU8	Bacillus_phage	75.0	9.1e-54
AVI45277.1|5013_5733_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.3	1.1e-80
AVI45278.1|5770_6025_+	SPBc2 prophage-derived thioredoxin-like protein YosR	NA	A0A1P8CX24	Bacillus_phage	69.7	9.1e-25
AVI45279.1|6062_6449_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	44.6	1.2e-12
AVI45280.1|6906_7191_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.4	1.1e-39
AVI45281.1|7266_7707_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45282.1|8472_8976_+	Thymidylate synthase	NA	A0A0K2FLX7	Brevibacillus_phage	44.9	7.1e-29
AVI45283.1|9129_9492_+	SPBc2 prophage-derived uncharacterized protein YosX	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
AVI45284.1|9481_9712_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45285.1|9726_10029_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45286.1|10025_10457_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45287.1|10417_11089_+	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	55.6	6.8e-35
AVI45288.1|11192_11396_-	Small, acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	83.3	6.8e-23
AVI45289.1|11493_11838_+	SPBc2 prophage-derived uncharacterized protein YoqB	NA	O64111	Bacillus_phage	60.4	1.4e-31
AVI45290.1|11879_12068_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45291.1|12101_12275_+	SPBc2 prophage-derived uncharacterized membrane protein YotH	NA	O64190	Bacillus_phage	87.7	7.8e-20
AVI45292.1|12271_12712_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45293.1|12753_13203_+	hypothetical protein	NA	A0A172JI41	Bacillus_phage	66.2	6.7e-47
AVI45294.1|13180_13378_+	SPBc2 prophage-derived uncharacterized protein YotK	NA	O64193	Bacillus_phage	50.9	4.3e-06
AVI45295.1|13403_14006_+	SPBc2 prophage-derived uncharacterized protein YotM	NA	A0A1P8CX67	Bacillus_phage	83.5	1.4e-84
AVI45296.1|14002_14149_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45297.1|14230_16201_+	Putative DNA recombinase	NA	A0A0S2SXR4	Bacillus_phage	24.0	4.6e-15
AVI45298.1|16606_17596_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45299.1|17618_18173_+	uncharacterized protein	NA	O64022	Bacillus_phage	66.3	2.4e-70
AVI45300.1|18331_20287_+	Ribonuclease YxiD	NA	O64023	Bacillus_phage	24.1	1.9e-29
>prophage 2
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	23924	33602	4332232		Bacillus_phage(100.0%)	9	NA	NA
AVI45306.1|23924_25031_+	Response regulator aspartate phosphatase	NA	D6R410	Bacillus_phage	28.5	2.5e-34
AVI45307.1|25027_25156_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45308.1|25876_26176_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45309.1|26194_26449_-	hypothetical protein	NA	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
AVI45310.1|26467_26854_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
AVI45311.1|26985_28074_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.7	3.1e-106
AVI45312.1|28229_30134_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	2.3e-51
AVI45313.1|30149_30947_-	SPBc2 prophage-derived uncharacterized protein YomF	NA	O64043	Bacillus_phage	59.0	2.8e-72
AVI45314.1|30962_33602_-	SPBc2 prophage-derived uncharacterized protein YomG	NA	A0A1P8CWQ0	Bacillus_phage	50.3	1.5e-239
>prophage 3
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	49724	70783	4332232		Bacillus_phage(90.91%)	27	NA	NA
AVI45329.1|49724_50726_-	SPBc2 prophage-derived recombinase-like protein YomM	NA	A0A1P8CWP6	Bacillus_phage	86.2	7.4e-171
AVI45330.1|50739_51159_-	SPBc2 prophage-derived uncharacterized protein YomN	NA	A0A1P8CWQ4	Bacillus_phage	57.0	1.3e-39
AVI45331.1|51160_51646_-	SPBc2 prophage-derived uncharacterized protein YomO	NA	A0A1P8CWQ6	Bacillus_phage	32.1	8.1e-14
AVI45332.1|51684_51876_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45333.1|51872_52199_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45334.1|52211_53840_-	SPBc2 prophage-derived uncharacterized protein YomR	NA	A0A1P8CWR7	Bacillus_phage	50.3	1.3e-34
AVI45335.1|53842_54208_-	SPBc2 prophage-derived uncharacterized protein YomS	NA	NA	NA	NA	NA
AVI45336.1|54316_54709_-	Ryncolin-4	NA	D6R3Z0	Bacillus_phage	46.8	2.1e-12
AVI45337.1|54748_55582_-	SPBc2 prophage-derived uncharacterized protein YomU	NA	A0A1P8CWR0	Bacillus_phage	42.5	4.2e-26
AVI45338.1|55613_56324_-	SPBc2 prophage-derived uncharacterized protein YomV	NA	A0A1P8CWQ7	Bacillus_phage	38.6	9.0e-38
AVI45339.1|56320_56851_-	SPBc2 prophage-derived uncharacterized protein YomW	NA	O64060	Bacillus_phage	63.6	6.9e-59
AVI45340.1|56847_57507_-	SPBc2 prophage-derived uncharacterized protein YomX	NA	A0A1P8CWR8	Bacillus_phage	65.7	3.7e-78
AVI45341.1|57493_57724_-	SPBc2 prophage-derived uncharacterized protein YomY	NA	A0A1P8CWS7	Bacillus_phage	52.8	6.3e-09
AVI45342.1|57720_58119_-	SPBc2 prophage-derived uncharacterized protein YomZ	NA	A0A1P8CWR5	Bacillus_phage	62.1	2.2e-41
AVI45343.1|58130_58601_-	SPBc2 prophage-derived uncharacterized protein YonA	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
AVI45344.1|58955_59651_-	SPBc2 prophage-derived uncharacterized protein YonB	NA	A0A1P8CWR9	Bacillus_phage	82.8	1.1e-91
AVI45345.1|59691_60294_-	SPBc2 prophage-derived uncharacterized protein YonC	NA	A0A1P8CWS2	Bacillus_phage	83.0	7.6e-78
AVI45346.1|60317_61757_-	SPBc2 prophage-derived uncharacterized protein YonD	NA	A0A1P8CWR1	Bacillus_phage	65.5	9.3e-175
AVI45347.1|61791_63312_-	SPBc2 prophage-derived uncharacterized protein YonE	NA	O64068	Bacillus_phage	82.8	3.3e-247
AVI45348.1|63329_65099_-	SPBc2 prophage-derived uncharacterized protein YonF	NA	O64069	Bacillus_phage	91.9	0.0e+00
AVI45349.1|65082_66015_-	SPBc2 prophage-derived uncharacterized protein YonG	NA	A0A1P8CWS6	Bacillus_phage	76.4	1.8e-139
AVI45350.1|66295_66925_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45351.1|67284_68478_-	SPBc2 prophage-derived uncharacterized protein YonJ	NA	A0A0N9SK37	Staphylococcus_phage	38.2	8.3e-68
AVI45352.1|68490_68682_-	SPBc2 prophage-derived uncharacterized protein YonK	NA	A0A1P8CWT3	Bacillus_phage	87.3	3.4e-24
AVI45353.1|69200_69716_-	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.7	1.8e-35
AVI45354.1|70337_70487_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45355.1|70507_70783_-	DNA-binding protein HU-1	NA	A0A0H3UZA0	Geobacillus_virus	73.3	1.9e-28
>prophage 4
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	101450	111867	4332232		Bacillus_phage(100.0%)	19	NA	NA
AVI45396.1|101450_102827_+	SPBc2 prophage-derived uncharacterized protein YopQ	NA	O64100	Bacillus_phage	42.4	1.6e-94
AVI45397.1|102830_103832_+	SPBc2 prophage-derived uncharacterized protein YopR	NA	O64101	Bacillus_phage	40.7	2.8e-61
AVI45398.1|104193_104454_+	SPBc2 prophage-derived uncharacterized protein YopT	NA	NA	NA	NA	NA
AVI45399.1|104466_104661_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45400.1|104964_105126_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45401.1|105268_106423_+	Exodeoxyribonuclease V	NA	A0A223LDI7	Bacillus_phage	39.6	8.0e-68
AVI45402.1|106471_106567_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45403.1|106547_106688_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45404.1|106713_107382_+	putative SPBc2 prophage-derived protein YoqJ	NA	A0A1P8CWY2	Bacillus_phage	73.5	3.8e-94
AVI45405.1|107371_107584_+	SPBc2 prophage-derived uncharacterized protein YoqK	NA	NA	NA	NA	NA
AVI45406.1|107602_107731_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45407.1|108114_108312_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45408.1|108358_108703_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45409.1|108729_108903_+	hypothetical protein	NA	A0A1B1P7C0	Bacillus_phage	71.9	2.9e-14
AVI45410.1|108999_109191_+	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	67.7	4.7e-18
AVI45411.1|109411_109624_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45412.1|110479_110728_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45413.1|110737_111550_-	DNA ligase (ATP)	NA	O64130	Bacillus_phage	75.8	7.7e-118
AVI45414.1|111642_111867_+	SPBc2 prophage-derived uncharacterized protein YoqX	NA	O64132	Bacillus_phage	63.4	5.4e-21
>prophage 5
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	115877	151699	4332232		Bacillus_phage(94.59%)	54	NA	NA
AVI45422.1|115877_116210_+	SPBc2 prophage-derived uncharacterized protein YorE	NA	A0A1P8CX10	Bacillus_phage	48.6	1.3e-15
AVI45423.1|116293_117208_+	SPBc2 prophage-derived uncharacterized protein YorF	NA	A0A1P8CX09	Bacillus_phage	66.7	8.7e-110
AVI45424.1|117261_118233_+	SPBc2 prophage-derived uncharacterized protein YorG	NA	A0A1P8CX29	Bacillus_phage	85.0	2.9e-156
AVI45425.1|118279_118750_+	SPBc2 prophage-derived uncharacterized protein YorH	NA	A0A1P8CX08	Bacillus_phage	69.9	3.4e-57
AVI45426.1|118764_120279_+	DNA helicase	NA	A0A1P8CWZ7	Bacillus_phage	81.3	3.7e-238
AVI45427.1|120295_121429_+	SPBc2 prophage-derived uncharacterized protein YorJ	NA	A0A1P8CX05	Bacillus_phage	69.4	1.4e-157
AVI45428.1|121432_123154_+	Putative SPBc2 prophage-derived single-strand DNA-specific exonuclease YorK	NA	A0A1P8CX07	Bacillus_phage	64.2	2.9e-215
AVI45429.1|123169_125734_+	DNA-directed DNA polymerase	NA	A0A1P8CX14	Bacillus_phage	87.9	0.0e+00
AVI45430.1|125917_126688_+	hypothetical protein	NA	R9QM99	Lactococcus_phage	32.8	6.2e-16
AVI45431.1|126737_128111_+	DNA-directed DNA polymerase	NA	A0A1P8CX14	Bacillus_phage	76.2	3.7e-213
AVI45432.1|128121_128838_+	SPBc2 prophage-derived uncharacterized protein YorM	NA	O64147	Bacillus_phage	43.9	1.0e-41
AVI45433.1|128842_129058_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45434.1|129054_129207_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45435.1|129226_129388_+	SPBc2 prophage-derived uncharacterized protein YorQ	NA	A0A1P8CX36	Bacillus_phage	51.0	1.9e-07
AVI45436.1|129381_129969_+	hypothetical protein	NA	A7KV03	Bacillus_phage	38.1	6.3e-29
AVI45437.1|129989_130334_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45438.1|131340_131811_+	SPBc2 prophage-derived uncharacterized protein YosC	NA	O64162	Bacillus_phage	91.7	1.4e-79
AVI45439.1|131844_131970_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45440.1|131989_132352_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45441.1|132366_132498_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45442.1|133255_133447_+	hypothetical protein	NA	S6BUY9	Bacillus_phage	51.6	7.3e-11
AVI45443.1|133687_133822_+	SPBc2 prophage-derived uncharacterized protein YosI	NA	O64168	Bacillus_phage	79.5	1.6e-12
AVI45444.1|133838_134012_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45445.1|134025_134229_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45446.1|134251_134512_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45447.1|134564_134912_+	SPBc2 prophage-derived uncharacterized protein YosL	NA	O64171	Bacillus_phage	41.7	6.8e-15
AVI45448.1|134911_135313_+	SPBc2 prophage-derived protein NrdI	NA	S6ANL8	Bacillus_phage	64.0	2.3e-38
AVI45449.1|135269_135998_+	Ribonucleoside-diphosphate reductase	NA	A0A217ER63	Bacillus_phage	88.7	3.4e-117
AVI45450.1|136418_138779_+	Ribonucleoside-diphosphate reductase	NA	A0A1P8CX40	Bacillus_phage	83.2	0.0e+00
AVI45451.1|138995_139244_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45452.1|139256_139430_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45453.1|139430_140402_+	Ribonucleoside-diphosphate reductase	NA	R4JMU8	Bacillus_phage	79.7	1.3e-143
AVI45454.1|140391_141111_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.3	1.1e-80
AVI45455.1|141148_141403_+	SPBc2 prophage-derived thioredoxin-like protein YosR	NA	A0A1P8CX24	Bacillus_phage	69.7	9.1e-25
AVI45456.1|141440_141827_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	44.6	1.2e-12
AVI45457.1|142284_142572_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	89.5	1.1e-45
AVI45458.1|142643_143084_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45459.1|143214_143502_+	SPBc2 prophage-derived uncharacterized protein YosV	NA	A0A1P8CX63	Bacillus_phage	50.5	1.3e-14
AVI45460.1|143503_144355_+	Thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	1.7e-51
AVI45461.1|144508_144871_+	SPBc2 prophage-derived uncharacterized protein YosX	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
AVI45462.1|144860_145091_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45463.1|145105_145408_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45464.1|145404_146469_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	38.0	8.2e-43
AVI45465.1|146572_146776_-	Small, acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	83.3	6.8e-23
AVI45466.1|146873_147218_+	SPBc2 prophage-derived uncharacterized protein YoqB	NA	O64111	Bacillus_phage	60.4	1.4e-31
AVI45467.1|147259_147448_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45468.1|147481_147655_+	SPBc2 prophage-derived uncharacterized membrane protein YotH	NA	O64190	Bacillus_phage	87.7	7.8e-20
AVI45469.1|147651_148092_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45470.1|148133_148583_+	hypothetical protein	NA	A0A172JI41	Bacillus_phage	66.2	6.7e-47
AVI45471.1|148560_148758_+	SPBc2 prophage-derived uncharacterized protein YotK	NA	O64193	Bacillus_phage	50.9	4.3e-06
AVI45472.1|148783_149386_+	SPBc2 prophage-derived uncharacterized protein YotM	NA	A0A1P8CX67	Bacillus_phage	83.5	1.4e-84
AVI45473.1|149382_149529_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45474.1|149610_151302_+	Putative DNA recombinase	NA	A0A0S2SXR4	Bacillus_phage	24.0	4.0e-15
AVI45475.1|151291_151699_+	Protein cbbX like protein, chloroplastic	NA	G3MAX6	Bacillus_virus	44.1	1.3e-17
>prophage 6
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	607545	619725	4332232		Staphylococcus_phage(55.56%)	15	NA	NA
AVI45950.1|607545_608139_-	Segregation and condensation protein	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
AVI45951.1|608128_608884_-	Segregation and condensation protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
AVI45952.1|609066_609162_+	hypothetical protein	NA	NA	NA	NA	NA
AVI45953.1|609282_609804_+	uncharacterized protein	NA	NA	NA	NA	NA
AVI45954.1|609814_610189_-	Protein RibT	NA	NA	NA	NA	NA
AVI45955.1|610290_610755_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
AVI45956.1|610789_611986_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
AVI45957.1|612007_612655_-	Riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
AVI45958.1|612666_613755_-	Diaminohydroxyphosphoribosylaminopyrimidine deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	5.1e-64
AVI45959.1|614115_614460_-	uncharacterized protein	NA	NA	NA	NA	NA
AVI45960.1|614722_616909_-	2',3'-cyclic-nucleotide 3'-phosphodiesterase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
AVI45961.1|617035_617473_-	Small heat shock protein C2	NA	NA	NA	NA	NA
AVI45962.1|617631_617937_-	hypothetical protein	NA	NA	NA	NA	NA
AVI45963.1|617926_619057_-	Response regulator aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
AVI45964.1|619287_619725_-	Peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 7
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1065114	1074594	4332232	terminase	Bacillus_phage(70.0%)	13	NA	NA
AVI46435.1|1065114_1065330_-	Phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	53.0	4.1e-10
AVI46436.1|1065492_1066629_-|terminase	PBSX phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.7	3.4e-119
AVI46437.1|1066625_1067486_-	hypothetical protein	NA	D2IYW0	Enterococcus_phage	39.3	3.8e-30
AVI46438.1|1067532_1067781_-	hypothetical protein	NA	A8ATN7	Listeria_phage	39.7	3.2e-06
AVI46439.1|1067908_1068835_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	64.1	2.4e-115
AVI46440.1|1068945_1069302_-	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
AVI46441.1|1069332_1069620_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46442.1|1069777_1070239_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46443.1|1070346_1070802_-	hypothetical protein	NA	A0A1P8CWJ1	Bacillus_phage	60.7	1.4e-44
AVI46444.1|1070818_1072738_-	Ribonuclease YxiD	NA	A0A1P8CWI7	Bacillus_phage	23.6	2.0e-15
AVI46445.1|1072932_1074123_+	Response regulator aspartate phosphatase	NA	D6R410	Bacillus_phage	29.0	1.6e-39
AVI46446.1|1074119_1074251_+	hypothetical protein	NA	NA	NA	NA	NA
AVI46447.1|1074345_1074594_-	hypothetical protein	NA	A0A2H4J748	uncultured_Caudovirales_phage	43.9	8.9e-09
>prophage 8
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1388933	1427122	4332232	coat,integrase	Bacillus_phage(83.33%)	50	1398820:1398834	1430126:1430140
AVI46755.1|1388933_1389302_+	SPBc2 prophage-derived uncharacterized protein YolD	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	40.0	3.1e-18
AVI46756.1|1389325_1389556_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46757.1|1389810_1389954_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46758.1|1390106_1391216_+	hypothetical protein	NA	NA	NA	NA	NA
AVI46759.1|1391470_1392550_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	52.7	2.3e-45
AVI46760.1|1392601_1392865_-	putative 9.7 kDa protein in cwlL 5'region	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	3.0e-31
AVI46761.1|1392880_1393150_-	putative 11.0 kDa protein in cwlL 5'region	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	6.2e-24
AVI46762.1|1393212_1393395_-	hypothetical protein	NA	A0EWM9	Staphylococcus_virus	47.9	5.2e-06
AVI46763.1|1393391_1393706_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	45.2	1.8e-14
AVI46764.1|1393717_1395061_-	Phage-like element PBSX protein XkdV	NA	M4ZRP1	Bacillus_phage	44.1	8.2e-48
AVI46765.1|1395081_1397037_-	hypothetical protein	NA	Q9ZXE2	Bacillus_phage	43.3	1.6e-23
AVI46766.1|1397072_1398782_-	N-acetylmuramoyl-L-alanine amidase	NA	D6R400	Bacillus_phage	69.8	1.9e-219
AVI46767.1|1398793_1399630_-	hypothetical protein	NA	D6R3Z9	Bacillus_phage	72.2	1.4e-114
1398820:1398834	attL	ATATGATTTCAAAAT	NA	NA	NA	NA
AVI46768.1|1399629_1403520_-	Tape measure protein	NA	D6R3Z8	Bacillus_phage	60.3	0.0e+00
AVI46769.1|1403717_1404053_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	2.9e-31
AVI46770.1|1404112_1404721_-	hypothetical protein	NA	Q9ZXE9	Bacillus_phage	55.1	1.3e-56
AVI46771.1|1404720_1405101_-	hypothetical protein	NA	Q9ZXF0	Bacillus_phage	55.6	2.0e-31
AVI46772.1|1405097_1405481_-	hypothetical protein	NA	Q9ZXF1	Bacillus_phage	72.4	3.7e-46
AVI46773.1|1405777_1406128_-	hypothetical protein	NA	Q9ZXF3	Bacillus_phage	61.7	4.3e-33
AVI46774.1|1406143_1406593_-	Collagen alpha-1(V) chain	NA	D6R3Z0	Bacillus_phage	53.8	1.8e-15
AVI46775.1|1406618_1406912_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	70.1	5.0e-27
AVI46776.1|1406928_1408134_-	hypothetical protein	NA	Q9ZXF6	Bacillus_phage	66.6	1.4e-144
AVI46777.1|1408173_1408803_-	hypothetical protein	NA	Q9ZXF7	Bacillus_phage	81.8	1.3e-93
AVI46778.1|1408792_1410040_-	hypothetical protein	NA	D6R3Y6	Bacillus_phage	85.1	7.5e-213
AVI46779.1|1410045_1410216_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	74.5	4.1e-13
AVI46780.1|1410227_1411937_-	uncharacterized protein	NA	D6R3Y4	Bacillus_phage	87.0	3.8e-300
AVI46781.1|1411936_1412470_-	hypothetical protein	NA	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
AVI46782.1|1412556_1412883_-	hypothetical protein	NA	Q9T203	Bacillus_phage	56.5	4.9e-31
AVI46783.1|1413395_1413623_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46784.1|1413843_1414068_-|coat	Spore coat protein	coat	NA	NA	NA	NA
AVI46785.1|1414818_1415199_-	hypothetical protein	NA	Q9ZXB9	Bacillus_phage	82.1	1.5e-47
AVI46786.1|1415346_1416156_-	Site-specific DNA-methyltransferase (adenine-specific)	NA	U5P0W8	Brevibacillus_phage	57.2	2.3e-85
AVI46787.1|1416137_1417073_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	47.2	4.2e-67
AVI46788.1|1417095_1417626_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.2	1.9e-80
AVI46789.1|1417622_1417793_-	hypothetical protein	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
AVI46790.1|1417789_1418329_-	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	90.5	1.7e-89
AVI46791.1|1418325_1418763_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	1.2e-61
AVI46792.1|1419003_1421430_-	Putative helicase L207/L206	NA	D6R422	Bacillus_phage	84.5	0.0e+00
AVI46793.1|1421490_1421931_-	hypothetical protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
AVI46794.1|1421930_1422863_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	89.8	4.5e-154
AVI46795.1|1422866_1423424_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	3.1e-70
AVI46796.1|1423489_1423780_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46797.1|1423739_1423856_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46798.1|1423852_1424119_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	50.0	4.7e-16
AVI46799.1|1424136_1424304_-	hypothetical protein	NA	NA	NA	NA	NA
AVI46800.1|1424332_1424602_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	48.3	1.1e-20
AVI46801.1|1424607_1424799_-	hypothetical protein	NA	A0A0M3ULF9	Bacillus_phage	68.9	1.2e-13
AVI46802.1|1425060_1425498_+	hypothetical protein	NA	Q5YAA4	Bacillus_phage	63.2	4.1e-41
AVI46803.1|1425506_1425929_+	putative immunity region protein	NA	A0A0S2SXM3	Bacillus_phage	62.3	9.1e-46
AVI46804.1|1425973_1427122_+|integrase	ICEBs1 integrase	integrase	A0A0M5M609	Bacillus_phage	34.6	3.4e-50
1430126:1430140	attR	ATATGATTTCAAAAT	NA	NA	NA	NA
>prophage 9
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1675033	1725426	4332232	holin,coat,terminase,integrase	Bacillus_phage(60.0%)	69	1673187:1673206	1716773:1716792
1673187:1673206	attL	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
AVI47061.1|1675033_1675681_-	hypothetical protein	NA	A0A0N9SGM1	Paenibacillus_phage	42.9	3.8e-19
AVI47062.1|1675930_1676161_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47063.1|1676415_1676559_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47064.1|1676751_1678368_+	putative ribonuclease YokI	NA	NA	NA	NA	NA
AVI47065.1|1678380_1678797_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
AVI47066.1|1678827_1679772_-	Lysozyme M1	NA	A0A141HSE6	Bacillus_phage	44.0	2.8e-63
AVI47067.1|1679819_1680083_-	Holin	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.2e-29
AVI47068.1|1680098_1680368_-	putative 11.0 kDa protein in cwlL 5'region	NA	A0A2H4JD40	uncultured_Caudovirales_phage	59.6	3.8e-21
AVI47069.1|1680430_1680616_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47070.1|1680612_1680933_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	43.0	1.0e-12
AVI47071.1|1680938_1682303_-	Phage-like element PBSX protein XkdV	NA	M4ZRP1	Bacillus_phage	50.0	4.3e-52
AVI47072.1|1682323_1684279_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	31.8	1.0e-43
AVI47073.1|1684314_1686027_-	N-acetylmuramoyl-L-alanine amidase	NA	D6R400	Bacillus_phage	66.4	7.9e-221
AVI47074.1|1686039_1686876_-	hypothetical protein	NA	D6R3Z9	Bacillus_phage	69.7	3.2e-111
AVI47075.1|1686875_1691345_-	Tape measure protein	NA	A6M961	Geobacillus_virus	42.4	1.2e-71
AVI47076.1|1691407_1691506_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47077.1|1691553_1691916_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47078.1|1691969_1692587_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47079.1|1692601_1692985_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47080.1|1692981_1693380_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47081.1|1693379_1693688_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47082.1|1693677_1693980_-	hypothetical protein	NA	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
AVI47083.1|1694000_1694426_-	Collagen alpha-1(V) chain	NA	D6R3Z0	Bacillus_phage	57.8	9.3e-14
AVI47084.1|1694449_1695733_-	hypothetical protein	NA	A0A288WG01	Bacillus_phage	44.5	1.3e-79
AVI47085.1|1695771_1696503_-	Endopeptidase Clp	NA	A0A2I7SCY8	Paenibacillus_phage	53.7	5.2e-57
AVI47086.1|1696447_1697758_-	hypothetical protein	NA	D6R3Y6	Bacillus_phage	46.7	3.8e-106
AVI47087.1|1697758_1697950_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47088.1|1697961_1699671_-|terminase	Putative terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.7	4.6e-205
AVI47089.1|1699667_1700183_-	hypothetical protein	NA	A6M947	Geobacillus_virus	45.8	1.7e-33
AVI47090.1|1700412_1700787_-	hypothetical protein	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
AVI47091.1|1700813_1701122_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47092.1|1701295_1701637_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47093.1|1701721_1702345_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47094.1|1702589_1702814_-|coat	Spore coat protein	coat	NA	NA	NA	NA
AVI47095.1|1703564_1703945_-	hypothetical protein	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
AVI47096.1|1703962_1704061_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47097.1|1704057_1704435_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
AVI47098.1|1704450_1704972_-	hypothetical protein	NA	D6R425	Bacillus_phage	81.9	8.3e-81
AVI47099.1|1704968_1705139_-	hypothetical protein	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
AVI47100.1|1705135_1705675_-	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
AVI47101.1|1705671_1706109_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	3.6e-61
AVI47102.1|1706086_1706350_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47103.1|1706625_1709058_-	Putative helicase L207/L206	NA	D6R422	Bacillus_phage	80.2	0.0e+00
AVI47104.1|1709118_1709556_-	hypothetical protein	NA	Q9ZXC5	Bacillus_phage	89.7	4.1e-73
AVI47105.1|1709555_1710488_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	88.1	1.9e-152
AVI47106.1|1710491_1711049_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	2.8e-71
AVI47107.1|1711141_1711384_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47108.1|1711364_1711475_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47109.1|1711471_1711738_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	6.0e-19
AVI47110.1|1711800_1712130_+	hypothetical protein	NA	NA	NA	NA	NA
AVI47111.1|1712126_1712285_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47112.1|1712306_1712396_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47113.1|1712410_1712965_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
AVI47114.1|1713022_1713211_-	hypothetical protein	NA	NA	NA	NA	NA
AVI47115.1|1713527_1714322_-	hypothetical protein	NA	D7RWL7	Brochothrix_phage	61.4	9.0e-79
AVI47116.1|1714430_1714664_-	hypothetical protein	NA	A0A2I7SCT7	Paenibacillus_phage	58.1	1.9e-16
AVI47117.1|1714829_1715525_+	hypothetical protein	NA	A0A2I7SCV6	Paenibacillus_phage	53.8	5.3e-67
AVI47118.1|1715595_1716690_+|integrase	ICEBs1 integrase	integrase	A0A0S2GLI2	Bacillus_phage	53.9	4.9e-99
AVI47119.1|1717241_1717715_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
1716773:1716792	attR	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
AVI47120.1|1717826_1720130_-	Ribonuclease	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
AVI47121.1|1720143_1720890_-	Carboxylesterase	NA	NA	NA	NA	NA
AVI47122.1|1721030_1721261_-	putative protein-export membrane protein SecG	NA	NA	NA	NA	NA
AVI47123.1|1721431_1721716_-	Transition state regulatory protein AbrB	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
AVI47124.1|1721744_1722062_-	putative HTH-type transcriptional regulator YvzC	NA	NA	NA	NA	NA
AVI47125.1|1722130_1722532_+	HTH-type transcriptional repressor RghR	NA	S6C481	Thermus_phage	45.3	4.2e-16
AVI47126.1|1722701_1723100_+	Repressor LexA	NA	S6C481	Thermus_phage	50.6	2.1e-15
AVI47127.1|1723147_1723825_-|holin	Choline transport system permease protein OpuBD	holin	NA	NA	NA	NA
AVI47128.1|1723841_1724759_-|holin	Glycine betaine/carnitine/choline-binding protein OpuCC	holin	NA	NA	NA	NA
AVI47129.1|1724772_1725426_-|holin	Glycine betaine/carnitine/choline transport system permease protein OpuCB	holin	NA	NA	NA	NA
>prophage 10
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3145972	3154361	4332232		Synechococcus_phage(57.14%)	8	NA	NA
AVI48457.1|3145972_3147268_+	Adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
AVI48458.1|3147342_3148059_+	Phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
AVI48459.1|3148060_3148315_+	Phosphoribosylformylglycinamidine synthase	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
AVI48460.1|3148311_3148995_+	Phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AVI48461.1|3148978_3151207_+	Phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	41.5	4.2e-158
AVI48462.1|3151182_3152613_+	Amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
AVI48463.1|3152733_3153777_+	Phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
AVI48464.1|3153773_3154361_+	Phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
>prophage 11
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3692012	3730296	4332232	tRNA,coat	Planktothrix_phage(20.0%)	42	NA	NA
AVI48974.1|3692012_3693005_-|tRNA	Tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVI48975.1|3693742_3695368_+	Oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
AVI48976.1|3695463_3696399_+	Dipeptide transport system permease protein DppB	NA	NA	NA	NA	NA
AVI48977.1|3696403_3697321_+	Oligopeptide transport system permease protein OppC	NA	NA	NA	NA	NA
AVI48978.1|3697334_3698402_+	Glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	31.3	5.4e-18
AVI48979.1|3698403_3699327_+	Oligopeptide transport ATP-binding protein AmiF	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.3	2.0e-05
AVI48980.1|3699557_3700136_+	Putative acetyltransferase YjbC	NA	NA	NA	NA	NA
AVI48981.1|3700313_3700709_+	Regulatory protein Spx	NA	NA	NA	NA	NA
AVI48982.1|3700931_3701594_-	putative membrane protein YjbE	NA	W8EBD0	Pseudomonas_phage	37.2	1.3e-27
AVI48983.1|3701879_3702518_+	Adapter protein MecA	NA	NA	NA	NA	NA
AVI48984.1|3702643_3703693_+	UPF0065 protein YflP	NA	NA	NA	NA	NA
AVI48985.1|3703795_3704251_+	hypothetical protein	NA	NA	NA	NA	NA
AVI48986.1|3704273_3705779_+	putative 52.8 kDa protein in TAR-I ttuC' 3'region	NA	NA	NA	NA	NA
AVI48987.1|3705798_3706515_-	Transcriptional regulatory protein CitT	NA	NA	NA	NA	NA
AVI48988.1|3706537_3708133_-	Histidine kinase	NA	NA	NA	NA	NA
AVI48989.1|3708250_3709399_+	Putative competence protein CoiA	NA	NA	NA	NA	NA
AVI48990.1|3709395_3711441_+	Oligoendopeptidase F like protein	NA	NA	NA	NA	NA
AVI48991.1|3711497_3711665_-	putative membrane protein YizD	NA	NA	NA	NA	NA
AVI48992.1|3712076_3712979_-	UPF0413 protein	NA	NA	NA	NA	NA
AVI48993.1|3712975_3713374_-	Group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AVI48994.1|3713655_3714309_-	Membrane-bound lytic murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	72.4	1.0e-40
AVI48995.1|3714321_3714894_-	Glutathione transferase	NA	NA	NA	NA	NA
AVI48996.1|3715024_3715390_+	UPF0738 protein	NA	NA	NA	NA	NA
AVI48997.1|3715421_3716057_+	GTP diphosphokinase	NA	NA	NA	NA	NA
AVI48998.1|3716071_3716875_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVI48999.1|3716886_3717777_+	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AVI49000.1|3717792_3718533_-	Bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A7D9	Microcystis_virus	28.8	4.5e-16
AVI49001.1|3718805_3720650_+	Putative Na(+)/H(+) antiporter YjbQ	NA	NA	NA	NA	NA
AVI49002.1|3720901_3721603_+	Aminopyrimidine aminohydrolase	NA	NA	NA	NA	NA
AVI49003.1|3721577_3722189_+	Thiazole tautomerase	NA	NA	NA	NA	NA
AVI49004.1|3722145_3723282_+	Glycine oxidase	NA	NA	NA	NA	NA
AVI49005.1|3723278_3723482_+	Sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVI49006.1|3723488_3724256_+	Thiazole synthase	NA	NA	NA	NA	NA
AVI49007.1|3724252_3725263_+	Sulfur carrier protein ThiS adenylyltransferase	NA	NA	NA	NA	NA
AVI49008.1|3725287_3726106_+	Hydroxymethylpyrimidine kinase	NA	NA	NA	NA	NA
AVI49009.1|3726262_3727039_+	Enoyl-[acyl-carrier-protein] reductase (NADH)	NA	NA	NA	NA	NA
AVI49010.1|3727142_3727622_+|coat	Spore coat protein	coat	NA	NA	NA	NA
AVI49011.1|3727659_3728109_-|coat	Spore coat protein Y	coat	NA	NA	NA	NA
AVI49012.1|3728259_3728748_-|coat	Spore coat protein Y	coat	NA	NA	NA	NA
AVI49013.1|3728879_3729392_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
AVI49014.1|3729462_3729861_-|coat	Spore coat protein	coat	NA	NA	NA	NA
AVI49015.1|3729909_3730296_-|coat	Spore coat protein	coat	NA	NA	NA	NA
>prophage 12
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3760668	3798684	4332232	terminase	Bacillus_phage(25.81%)	46	NA	NA
AVI49048.1|3760668_3762093_-	putative MFS-type transporter YcnB	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
AVI49049.1|3762108_3762687_-	putative HTH-type transcriptional regulator	NA	NA	NA	NA	NA
AVI49050.1|3763063_3763477_-	hypothetical protein	NA	NA	NA	NA	NA
AVI49051.1|3763851_3764334_-	putative antitoxin YezG	NA	NA	NA	NA	NA
AVI49052.1|3764337_3766287_-	Ribonuclease YxiD	NA	A0A1P8CWI7	Bacillus_phage	24.2	9.2e-24
AVI49053.1|3766253_3766385_-	hypothetical protein	NA	NA	NA	NA	NA
AVI49054.1|3766605_3767253_+	UPF0714 protein YndL	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
AVI49055.1|3767266_3767923_-	Phage-like element PBSX protein XkdA	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
AVI49056.1|3768111_3768465_-	Repressor LexA	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
AVI49057.1|3768637_3768898_+	hypothetical protein	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
AVI49058.1|3768887_3769184_+	hypothetical protein	NA	NA	NA	NA	NA
AVI49059.1|3769184_3770015_+	Phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
AVI49060.1|3770064_3770715_+	Phage-like element PBSX protein XkdC	NA	A6XMI1	Bacillus_virus	54.4	3.0e-56
AVI49061.1|3770714_3770885_+	hypothetical protein	NA	NA	NA	NA	NA
AVI49062.1|3770985_3771327_+	Phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
AVI49063.1|3771323_3771527_+	Phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
AVI49064.1|3771647_3772151_+	Positive control factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
AVI49065.1|3772293_3773094_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
AVI49066.1|3773090_3774389_+|terminase	PBSX phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
AVI49067.1|3774392_3775907_+	uncharacterized protein	NA	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
AVI49068.1|3775914_3776763_+	Phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
AVI49069.1|3776780_3777716_+	Phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
AVI49070.1|3777809_3778184_+	uncharacterized protein	NA	NA	NA	NA	NA
AVI49071.1|3778180_3778537_+	uncharacterized protein	NA	NA	NA	NA	NA
AVI49072.1|3778533_3779022_+	Phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
AVI49073.1|3779034_3779475_+	Phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
AVI49074.1|3779475_3779700_+	uncharacterized protein	NA	NA	NA	NA	NA
AVI49075.1|3779699_3781046_+	uncharacterized protein	NA	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
AVI49076.1|3781047_3781491_+	Phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
AVI49077.1|3781673_3782123_+	uncharacterized protein	NA	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
AVI49078.1|3782305_3786088_+	Phage-like element PBSX protein XkdO	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
AVI49079.1|3786080_3786737_+	Phage-like element PBSX protein XkdP	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
AVI49080.1|3786793_3787774_+	Phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.3	9.2e-41
AVI49081.1|3787770_3788079_+	Phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	37.3	1.0e-06
AVI49082.1|3788097_3788526_+	Phage-like element PBSX protein XkdS	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.7	9.3e-14
AVI49083.1|3788518_3789562_+	Phage-like element PBSX protein XkdT	NA	S6AVU3	Thermus_phage	44.3	9.7e-73
AVI49084.1|3790482_3790869_+	hypothetical protein	NA	NA	NA	NA	NA
AVI49085.1|3790884_3792090_+	Phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
AVI49086.1|3792127_3793159_+	SPBc2 prophage-derived uncharacterized protein YomR	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
AVI49087.1|3793261_3793531_+	putative 11.0 kDa protein in cwlL 5'region	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
AVI49088.1|3793545_3793809_+	putative 9.5 kDa protein in ORF3 5'region	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
AVI49089.1|3793859_3794924_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
AVI49090.1|3795025_3795703_+	HTH-type transcriptional repressor RspR	NA	NA	NA	NA	NA
AVI49091.1|3795725_3796742_+	L-gulonate 5-dehydrogenase	NA	NA	NA	NA	NA
AVI49092.1|3796762_3797860_+	Mannonate dehydratase	NA	NA	NA	NA	NA
AVI49093.1|3797835_3798684_+	putative oxidoreductase UxuB	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 13
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3906098	3913979	4332232	protease	Bacillus_phage(33.33%)	10	NA	NA
AVI49197.1|3906098_3908195_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpE	protease	H6X3M6	Enterobacteria_phage	40.6	1.2e-125
AVI49198.1|3908424_3909459_+	putative membrane protein YkvI	NA	NA	NA	NA	NA
AVI49199.1|3909723_3910383_+	7-cyano-7-deazaguanine synthase	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.9	6.6e-67
AVI49200.1|3910385_3910826_+	6-pyruvoyltetrahydropterin synthase	NA	NA	NA	NA	NA
AVI49201.1|3910875_3911550_+	7-carboxy-7-deazaguanine synthase	NA	A0A1U9WRB6	Streptococcus_virus	46.8	1.2e-50
AVI49202.1|3911571_3912069_+	PreQ(1) synthase	NA	E7DN65	Pneumococcus_phage	74.1	6.1e-57
AVI49203.1|3912741_3912867_-	hypothetical protein	NA	NA	NA	NA	NA
AVI49204.1|3912856_3913138_-	Response regulator aspartate phosphatase	NA	NA	NA	NA	NA
AVI49205.1|3913130_3913514_-	Response regulator aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	38.7	2.9e-14
AVI49206.1|3913571_3913979_-	Response regulator aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	61.4	8.0e-39
>prophage 14
CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	4321931	4331609	4332232		Bacillus_phage(100.0%)	9	NA	NA
AVI49620.1|4321931_4323038_+	Response regulator aspartate phosphatase	NA	D6R410	Bacillus_phage	28.5	2.5e-34
AVI49621.1|4323034_4323163_+	hypothetical protein	NA	NA	NA	NA	NA
AVI49622.1|4323883_4324183_-	hypothetical protein	NA	NA	NA	NA	NA
AVI49623.1|4324201_4324456_-	hypothetical protein	NA	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
AVI49624.1|4324474_4324861_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
AVI49625.1|4324992_4326081_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.7	3.1e-106
AVI49626.1|4326236_4328141_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	2.3e-51
AVI49627.1|4328156_4328954_-	SPBc2 prophage-derived uncharacterized protein YomF	NA	O64043	Bacillus_phage	59.0	2.8e-72
AVI49628.1|4328969_4331609_-	SPBc2 prophage-derived uncharacterized protein YomG	NA	A0A1P8CWQ0	Bacillus_phage	50.3	1.5e-239
