The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	397433	440997	1886411	terminase,head,tRNA,portal,tail,holin	Haemophilus_phage(12.5%)	54	NA	NA
AVJ00872.1|397433_398705_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.2	2.0e-27
AVJ00873.1|398722_399337_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00874.1|399387_399582_-	feS assembly protein IscX	NA	NA	NA	NA	NA
AVJ00875.1|399581_399923_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AVJ00876.1|399962_401822_-	fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.3	2.3e-109
AVJ00877.1|401839_402526_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00878.1|402576_403101_-	fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AVJ00879.1|403113_403437_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.4e-24
AVJ00880.1|403494_403875_-	scaffold protein involved in iron-sulfur cluster assembly	NA	A0A218MKD1	uncultured_virus	80.6	1.4e-53
AVJ00881.1|403934_405149_-	cysteine desulfurase IscS	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
AVJ00882.1|405215_405668_-	iron-sulfur cluster assembly transcription factor IscR	NA	NA	NA	NA	NA
AVJ00883.1|405720_406446_-|tRNA	tRNA:Cm32/Um32 methyltransferase	tRNA	NA	NA	NA	NA
AVJ00884.1|406997_407111_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00885.1|407094_407349_-|tRNA	putative s-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	F6MIM0	Haemophilus_phage	60.3	9.1e-25
AVJ00886.1|407549_408152_-	putative orf32	NA	Q94MX9	Haemophilus_virus	94.0	3.0e-98
AVJ00887.1|408163_409972_-	phage Tail Collar domain protein	NA	Q94MY0	Haemophilus_virus	67.4	7.0e-220
AVJ00888.1|409982_413633_-	fibronectin type III domain protein	NA	A0A0R6PIC9	Moraxella_phage	37.4	2.0e-141
AVJ00889.1|413636_414104_-|tail	putative prophage LambdaSo, tail assembly protein I	tail	A0A1P8DTG7	Proteus_phage	45.3	1.3e-21
AVJ00890.1|414294_415002_-	nlpC/P60 family protein	NA	A0A1B1IV85	uncultured_Mediterranean_phage	43.2	3.4e-53
AVJ00891.1|415003_415654_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	39.1	1.0e-32
AVJ00892.1|415697_416237_-	antirepressor	NA	Q0H8C7	Salmonella_phage	52.8	7.8e-34
AVJ00893.1|416632_417511_-	BRO family, N-terminal domain protein	NA	D0UIK6	Aggregatibacter_phage	78.4	4.7e-129
AVJ00894.1|418006_418546_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00895.1|418805_418919_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00896.1|419291_419624_-|tail	phage minor tail family protein	tail	H6WZM2	Escherichia_phage	38.5	2.7e-16
AVJ00897.1|419632_423025_-	tape measure domain protein	NA	A0A2P1CKJ3	Pantoea_phage	23.5	1.8e-35
AVJ00898.1|423076_423316_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00899.1|423328_423607_-	helix-turn-helix family protein	NA	NA	NA	NA	NA
AVJ00900.1|423614_423998_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00901.1|424066_424291_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00902.1|424335_424743_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00903.1|424742_424859_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00904.1|425017_425668_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00905.1|425670_426042_-|tail	phage minor tail U family protein	tail	NA	NA	NA	NA
AVJ00906.1|426098_426620_-|tail	prophage minor tail Z family protein	tail	K7PKQ5	Enterobacteria_phage	50.0	2.6e-18
AVJ00907.1|426622_426865_-	ATP-binding sugar transporter from pro-phage family protein	NA	NA	NA	NA	NA
AVJ00908.1|426914_427238_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00909.1|427316_429053_-|head	mu-like prophage major head subunit gpT family protein	head	A0A1W6JT88	Pseudomonas_phage	56.2	2.8e-165
AVJ00910.1|429294_430818_-|portal	phage portal protein, lambda family	portal	K7PJP3	Enterobacteria_phage	57.7	2.7e-156
AVJ00911.1|430821_431040_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ00912.1|431036_433160_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.8	1.7e-273
AVJ00913.1|433162_433636_-	hypothetical protein	NA	K7PJY2	Enterobacterial_phage	53.6	4.9e-40
AVJ00914.1|434102_434408_-	hypothetical protein	NA	Q7Y5U9	Haemophilus_phage	56.4	1.2e-20
AVJ00915.1|434418_435012_-	chitinase class I family protein	NA	Q7Y5V0	Haemophilus_phage	53.4	1.0e-55
AVJ00916.1|434989_435346_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AVJ00917.1|435585_436104_-	phage antitermination Q family protein	NA	G8C7V7	Escherichia_phage	33.3	7.6e-18
AVJ00918.1|436104_436650_-	bacteriophage Lambda NinG family protein	NA	D0UIK8	Aggregatibacter_phage	69.1	1.7e-60
AVJ00919.1|436742_437159_-	ninB family protein	NA	Q7Y5V7	Haemophilus_phage	85.4	9.6e-64
AVJ00920.1|437195_437420_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
AVJ00921.1|437416_438052_-	replication P family protein	NA	A0A1I9KFB0	Aeromonas_phage	25.5	9.0e-05
AVJ00922.1|438036_438780_-	helix-turn-helix domain protein	NA	D0UIL5	Aggregatibacter_phage	66.5	3.3e-59
AVJ00923.1|438791_439466_-	phage regulatory Rha family protein	NA	D0UIL6	Aggregatibacter_phage	55.1	4.2e-61
AVJ00924.1|439514_439955_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	32.6	8.1e-13
AVJ00925.1|440340_440997_+	helix-turn-helix domain protein	NA	A0A0M3LSL8	Mannheimia_phage	58.4	7.2e-66
>prophage 2
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	445013	453203	1886411	integrase	Mannheimia_phage(42.86%)	13	439510:439524	456197:456211
439510:439524	attL	TTTTTTTATTTCTTG	NA	NA	NA	NA
AVJ00930.1|445013_445865_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	3.1e-53
AVJ00931.1|445948_446296_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00932.1|446292_446586_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00933.1|446597_447518_+	recombinase, phage RecT family protein	NA	A0A0M3LNU3	Mannheimia_phage	70.9	4.1e-115
AVJ00934.1|447540_448143_+	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	75.8	1.5e-81
AVJ00935.1|448142_448577_+	single-stranded DNA-binding family protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
AVJ00936.1|448548_448668_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00937.1|448678_449248_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00938.1|449244_449481_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00939.1|449477_449837_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ00940.1|449844_451008_+	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A2I7RFJ9	Vibrio_phage	46.1	1.5e-90
AVJ00941.1|451056_451548_+	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	42.0	1.1e-23
AVJ00942.1|452177_453203_+|integrase	phage integrase family protein	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
456197:456211	attR	TTTTTTTATTTCTTG	NA	NA	NA	NA
>prophage 3
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1150364	1159430	1886411		Escherichia_phage(85.71%)	10	NA	NA
AVJ01616.1|1150364_1150865_-	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
AVJ01617.1|1150864_1151476_-	nitrate reductase delta subunit	NA	A0A077SLS7	Escherichia_phage	32.5	2.3e-21
AVJ01618.1|1151587_1152427_-	dimethyl sulfoxide reductase, chain C	NA	A0A077SK59	Escherichia_phage	31.6	5.5e-18
AVJ01619.1|1152428_1152680_-	dimethyl sulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.8	1.1e-22
AVJ01620.1|1152676_1153045_-	dimethyl sulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.3	1.8e-42
AVJ01621.1|1153181_1155476_-	dimethyl sulfoxide reductase, chain A	NA	A0A077SK27	Escherichia_phage	50.0	6.6e-207
AVJ01622.1|1155728_1156838_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ01623.1|1157034_1157175_+	putative merT	NA	NA	NA	NA	NA
AVJ01624.1|1157183_1157462_+	heavy-metal-associated domain protein	NA	NA	NA	NA	NA
AVJ01625.1|1157585_1159430_-	ABC transporter family protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.0	8.1e-22
>prophage 4
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1286303	1294812	1886411		Planktothrix_phage(16.67%)	9	NA	NA
AVJ01752.1|1286303_1287287_-	dppF	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
AVJ01753.1|1287289_1288282_-	dppD	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
AVJ01754.1|1288291_1289179_-	dppC	NA	NA	NA	NA	NA
AVJ01755.1|1289193_1290165_-	dppB	NA	NA	NA	NA	NA
AVJ01756.1|1290139_1290256_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ01757.1|1290284_1292465_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.9e-116
AVJ01758.1|1293074_1293704_-	4Fe-4S single cluster domain protein	NA	S4TZT1	uncultured_phage	30.3	8.6e-16
AVJ01759.1|1293710_1294103_-	queuosine biosynthesis protein QueD	NA	E7DN67	Pneumococcus_phage	40.6	6.3e-17
AVJ01760.1|1294128_1294812_-	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.3e-54
>prophage 5
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1526826	1557958	1886411	integrase,terminase,head	Mannheimia_phage(17.65%)	50	1520118:1520134	1535904:1535920
1520118:1520134	attL	GGTTGTTGATGAAGCCA	NA	NA	NA	NA
AVJ02010.1|1526826_1527225_+|integrase	phage integrase family protein	integrase	A0A0M3LQN1	Mannheimia_phage	65.2	3.5e-39
AVJ02011.1|1527296_1527500_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02012.1|1527541_1527814_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02013.1|1527806_1528082_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02014.1|1528119_1528608_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02015.1|1528687_1529104_-	hypothetical protein	NA	W0B4E9	Acinetobacter_phage	39.2	3.5e-05
AVJ02016.1|1529107_1529755_-	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	40.0	1.0e-08
AVJ02017.1|1529765_1530554_-	C-5 cytosine-specific DNA methylase family protein	NA	U4KJA1	Streptococcus_phage	56.7	4.0e-79
AVJ02018.1|1530906_1531044_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02019.1|1531148_1532045_-	recombination associated protein	NA	S4TWL4	Salmonella_phage	43.7	8.4e-57
AVJ02020.1|1532169_1533462_-	putative gp53	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	8.8e-07
AVJ02021.1|1533524_1533959_-	single-stranded DNA-binding family protein	NA	A0A059WRL7	Vibrio_phage	36.2	1.3e-18
AVJ02022.1|1533958_1534603_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.4	6.8e-85
AVJ02023.1|1534813_1535425_-	BRO family, N-terminal domain protein	NA	Q7Y5X0	Haemophilus_phage	60.6	5.8e-33
AVJ02024.1|1535769_1536681_-	recombinase, phage RecT family protein	NA	A0A0M3LNU3	Mannheimia_phage	70.7	2.4e-115
1535904:1535920	attR	TGGCTTCATCAACAACC	NA	NA	NA	NA
AVJ02025.1|1536692_1536986_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02026.1|1536982_1537333_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02027.1|1537422_1538043_-	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.4	3.7e-19
AVJ02028.1|1538547_1539378_-	kilA-N domain protein	NA	Q4ZC41	Staphylococcus_virus	52.2	3.4e-76
AVJ02029.1|1539542_1539713_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02030.1|1540388_1541420_+	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A0R6PG08	Moraxella_phage	66.4	2.8e-128
AVJ02031.1|1541376_1542036_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02032.1|1542035_1543130_-	hypothetical protein	NA	A0A0R6PKN1	Moraxella_phage	36.2	2.0e-60
AVJ02033.1|1543145_1544051_-	peptidase S24-like family protein	NA	B6SCU0	Bacteriophage	40.8	3.0e-38
AVJ02034.1|1544299_1544413_+	putative DNA-binding transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	69.7	6.4e-07
AVJ02035.1|1544425_1544686_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02036.1|1544828_1544942_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02037.1|1545323_1545683_+	phage replication protein O, N-terminal domain	NA	A0A2H4JAL8	uncultured_Caudovirales_phage	41.9	8.4e-08
AVJ02038.1|1545672_1545996_+	hypothetical protein	NA	D0UIL5	Aggregatibacter_phage	61.9	2.8e-26
AVJ02039.1|1545992_1546634_+	replication P family protein	NA	D0UIL4	Aggregatibacter_phage	41.9	4.2e-34
AVJ02040.1|1546630_1546855_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
AVJ02041.1|1546891_1547308_+	ninB family protein	NA	Q7Y5V7	Haemophilus_phage	86.1	1.9e-64
AVJ02042.1|1547400_1547988_+	bacteriophage Lambda NinG family protein	NA	A0A2I7RAC0	Vibrio_phage	48.0	8.3e-37
AVJ02043.1|1547989_1548355_+	phage antitermination Q family protein	NA	NA	NA	NA	NA
AVJ02044.1|1548427_1548913_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02045.1|1549089_1549935_+	NYN domain protein	NA	A0A0R6PGY5	Moraxella_phage	47.9	2.0e-31
AVJ02046.1|1550343_1550856_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02047.1|1551028_1551145_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02048.1|1551315_1551567_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02049.1|1551547_1552090_+	phage lysozyme family protein	NA	A0A0M3LPQ1	Mannheimia_phage	52.0	3.1e-46
AVJ02050.1|1552062_1552398_+	hypothetical protein	NA	Q7Y5U9	Haemophilus_phage	52.1	9.8e-19
AVJ02051.1|1552378_1552591_+	hypothetical protein	NA	D0UIK0	Aggregatibacter_phage	77.6	1.2e-25
AVJ02052.1|1552592_1552940_-	helix-turn-helix family protein	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	1.2e-22
AVJ02053.1|1552923_1553175_-	plasmid stabilization system family protein	NA	A0A1S5NR91	Burkholderia_phage	52.9	9.9e-16
AVJ02054.1|1553252_1553765_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.0e-19
AVJ02055.1|1553751_1554852_+|terminase	phage terminase, large subunit, PBSX family	terminase	A0A220NQL3	Acinetobacter_phage	53.1	4.6e-97
AVJ02056.1|1554927_1555095_+	hypothetical protein	NA	A0A0M4RQB1	Streptomyces_phage	75.0	3.3e-15
AVJ02057.1|1555096_1556431_+	hypothetical protein	NA	Q7Y5U6	Haemophilus_phage	84.0	4.7e-213
AVJ02058.1|1556459_1557641_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q7Y5U5	Haemophilus_phage	76.7	6.4e-89
AVJ02059.1|1557781_1557958_+	hypothetical protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 6
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1566244	1578307	1886411	tRNA	Acinetobacter_phage(42.86%)	11	NA	NA
AVJ02073.1|1566244_1569091_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	2.4e-150
AVJ02074.1|1569125_1569401_-	hydrogenase assembly chaperone HypC/HupF	NA	NA	NA	NA	NA
AVJ02075.1|1569532_1570963_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	38.3	2.1e-33
AVJ02076.1|1570993_1571995_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.8	1.2e-48
AVJ02077.1|1572047_1572434_-	putative anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVJ02078.1|1572482_1573064_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.4	3.8e-34
AVJ02079.1|1573075_1574632_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	32.1	2.4e-22
AVJ02080.1|1574733_1575498_-	glycosyl transferase 2 family protein	NA	A7IW34	Paramecium_bursaria_Chlorella_virus	29.1	1.2e-14
AVJ02081.1|1575783_1576281_-	putative ferritin-1	NA	NA	NA	NA	NA
AVJ02082.1|1576296_1576785_-	putative ferritin-1	NA	NA	NA	NA	NA
AVJ02083.1|1577287_1578307_+	phosphate ABC transporter, phosphate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.5	9.3e-52
>prophage 7
CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1630642	1706362	1886411	integrase,terminase,head,plate,tRNA,portal,tail,capsid	Mannheimia_phage(42.5%)	92	1647826:1647849	1714379:1714402
AVJ02120.1|1630642_1631608_+|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AVJ02121.1|1631651_1632530_-	cytidine deaminase	NA	NA	NA	NA	NA
AVJ02122.1|1632803_1633286_+	DNA protection during starvation protein	NA	NA	NA	NA	NA
AVJ02123.1|1633762_1635001_-	peptidase T	NA	NA	NA	NA	NA
AVJ02124.1|1635058_1635184_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02125.1|1635296_1636415_+	potA	NA	Q6GZ03	Mycoplasma_phage	37.1	1.9e-29
AVJ02126.1|1636398_1637259_+	potB	NA	Q6GZ02	Mycoplasma_phage	28.2	4.5e-15
AVJ02127.1|1637258_1638029_+	potC	NA	NA	NA	NA	NA
AVJ02128.1|1638158_1639241_+	potD	NA	NA	NA	NA	NA
AVJ02129.1|1639321_1641265_-	heme ABC exporter, ATP-binding protein CcmA	NA	A0A2K9L0W2	Tupanvirus	29.8	5.5e-53
AVJ02130.1|1641358_1642744_-	dGTPase family protein	NA	NA	NA	NA	NA
AVJ02131.1|1642836_1643532_-	lrgB-like family protein	NA	NA	NA	NA	NA
AVJ02132.1|1643550_1643973_-	lrgA family protein	NA	NA	NA	NA	NA
AVJ02133.1|1644108_1644570_+	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	47.0	6.9e-31
AVJ02134.1|1644571_1645771_+	hypothetical protein	NA	Q2XUY6	environmental_halophage	32.0	2.0e-61
AVJ02135.1|1645767_1646148_+	fe-S metabolism associated domain protein	NA	NA	NA	NA	NA
AVJ02136.1|1646138_1646936_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02137.1|1646979_1647819_+	queuine synthase	NA	A0A2I7SAX1	Vibrio_phage	39.3	1.0e-40
1647826:1647849	attL	GCGGTGAAATTTCACCGCACTTTT	NA	NA	NA	NA
AVJ02138.1|1647851_1648976_-	T-protein	NA	NA	NA	NA	NA
AVJ02139.1|1649064_1650117_-|tRNA	tRNA pseudouridine(55) synthase	tRNA	NA	NA	NA	NA
AVJ02140.1|1650116_1650503_-	ribosome-binding factor A	NA	NA	NA	NA	NA
AVJ02141.1|1651012_1652347_+	type I restriction-modification system methylation subunit	NA	A0A2H4PQP4	Staphylococcus_phage	33.1	2.5e-41
AVJ02142.1|1652336_1653704_+	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
AVJ02143.1|1653703_1654342_+	abortive infection family protein	NA	NA	NA	NA	NA
AVJ02144.1|1654411_1657594_+	type I site-specific deoxyribonuclease, HsdR family protein	NA	A0A220A398	Liberibacter_phage	31.4	3.9e-80
AVJ02145.1|1657672_1660162_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	2.7e-28
AVJ02146.1|1660173_1661661_-	transcription termination/antitermination L factor	NA	NA	NA	NA	NA
AVJ02147.1|1661677_1662133_-	ribosome maturation protein	NA	NA	NA	NA	NA
AVJ02148.1|1663417_1664710_+|integrase	phage integrase family protein	integrase	A0A1B5FPC6	Escherichia_phage	33.0	1.2e-43
AVJ02149.1|1664690_1664858_-	DNA binding, excisionase family domain protein	NA	NA	NA	NA	NA
AVJ02150.1|1664857_1665379_-	mazG nucleotide pyrophosphohydrolase domain protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	4.3e-29
AVJ02151.1|1665433_1667620_-	bacteriophage replication protein A (GPA)	NA	Q94N00	Haemophilus_virus	42.7	5.4e-166
AVJ02152.1|1667629_1667938_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02153.1|1667952_1668093_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02154.1|1668062_1668305_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02155.1|1668308_1668689_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02156.1|1668706_1668970_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02157.1|1669260_1669389_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02158.1|1669429_1669555_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02159.1|1669541_1669898_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02160.1|1670114_1670270_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02161.1|1670350_1670644_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02162.1|1670681_1670924_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02163.1|1670986_1671406_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02164.1|1671541_1672225_+	peptidase S24-like family protein	NA	Q76H56	Enterobacteria_phage	33.3	7.9e-23
AVJ02165.1|1672229_1672991_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02166.1|1673256_1674996_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02167.1|1675055_1675445_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02168.1|1675462_1676683_-	phage late control gene D family protein	NA	R9QBT3	Mannheimia_phage	57.7	7.0e-123
AVJ02169.1|1676682_1677120_-	phage P2 GpU family protein	NA	A0A0M3LQ18	Mannheimia_phage	57.3	9.1e-41
AVJ02170.1|1677289_1677418_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02171.1|1677448_1677595_-	phage P2 GpE family protein	NA	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
AVJ02172.1|1677594_1677894_-	mu-like prophage FluMu gp41 family protein	NA	E5E3Q1	Burkholderia_phage	42.9	1.2e-12
AVJ02173.1|1677959_1678466_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	5.4e-53
AVJ02174.1|1678469_1679654_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.2	2.3e-102
AVJ02175.1|1679625_1679889_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02176.1|1679912_1680515_-	putative orf32	NA	Q94MX9	Haemophilus_virus	86.0	3.6e-88
AVJ02177.1|1680526_1683052_-|tail	phage tail-collar fiber family protein	tail	Q94MY0	Haemophilus_virus	65.5	8.0e-246
AVJ02178.1|1683060_1683597_-|tail	phage tail protein I	tail	M1T2R2	Escherichia_phage	53.1	7.0e-51
AVJ02179.1|1683586_1684501_-|plate	baseplate J-like family protein	plate	Q19UQ5	Mannheimia_phage	58.6	1.3e-92
AVJ02180.1|1684497_1684836_-	gene 25-like lysozyme family protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
AVJ02181.1|1684837_1685431_-|plate	phage baseplate assembly V family protein	plate	A0A0M3LPY9	Mannheimia_phage	66.5	2.7e-43
AVJ02182.1|1685540_1685969_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02183.1|1685977_1686535_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02184.1|1686632_1687085_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02185.1|1687062_1687230_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02186.1|1687306_1689304_-|tail	phage tail tape measure protein, TP901 family, core region	tail	V5YUN9	Pseudomonas_phage	33.7	3.8e-65
AVJ02187.1|1689346_1690114_-	hypothetical protein	NA	E5G6Q1	Salmonella_phage	44.8	9.9e-06
AVJ02188.1|1690182_1690443_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02189.1|1690420_1690561_-	phage virion morphogenesis family protein	NA	Q19UR2	Mannheimia_phage	53.3	5.7e-05
AVJ02190.1|1690696_1691008_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02191.1|1691018_1691168_-	phage virion morphogenesis family protein	NA	Q19UR2	Mannheimia_phage	47.8	1.6e-05
AVJ02192.1|1691352_1691652_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ02193.1|1691652_1692114_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	5.7e-25
AVJ02194.1|1692113_1692584_-|tail	P2 phage tail completion R family protein	tail	E5G6N3	Salmonella_phage	45.3	7.3e-28
AVJ02195.1|1692549_1692813_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02196.1|1692809_1693079_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	A0A0M3LS11	Mannheimia_phage	37.4	7.7e-06
AVJ02197.1|1693075_1693294_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02198.1|1693253_1693604_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02199.1|1693588_1694107_-	phage lysozyme family protein	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	9.5e-37
AVJ02200.1|1694099_1694321_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ02201.1|1694322_1694532_-	phage Tail Protein X family protein	NA	NA	NA	NA	NA
AVJ02202.1|1694531_1695038_-|head	phage head completion family protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	2.8e-33
AVJ02203.1|1695331_1695982_-|terminase	phage small terminase subunit	terminase	Q19US0	Mannheimia_phage	46.0	4.1e-45
AVJ02204.1|1695993_1697043_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.3	1.7e-88
AVJ02205.1|1697063_1697879_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.5	6.9e-66
AVJ02206.1|1698043_1699825_+|terminase	ATPase subunit of terminase family protein	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	5.0e-218
AVJ02207.1|1699834_1700845_+|portal	phage portal protein, PBSX family	portal	Q19UT6	Mannheimia_phage	60.4	1.8e-116
AVJ02208.1|1701553_1702228_-	cytidylyltransferase family protein	NA	NA	NA	NA	NA
AVJ02209.1|1702341_1703004_+	putative NAD(P)H nitroreductase yfkO	NA	NA	NA	NA	NA
AVJ02210.1|1703050_1704163_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	NA	NA	NA	NA
AVJ02211.1|1704313_1706362_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A2K9V939	Bandra_megavirus	29.3	2.2e-60
1714379:1714402	attR	GCGGTGAAATTTCACCGCACTTTT	NA	NA	NA	NA
