The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	0	10061	3418310		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
AVF74023.1|1832_2282_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AVF74024.1|3262_4255_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVF74025.1|4257_5589_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVF74026.1|6405_6654_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74027.1|6659_7649_-	hypothetical protein	NA	NA	NA	NA	NA
AVF74028.1|8423_10061_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	8.5e-23
>prophage 2
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	19136	22808	3418310		Staphylococcus_phage(50.0%)	3	NA	NA
AVF74035.1|19136_20465_-	phospholipase	NA	A0A1P8L6H7	Staphylococcus_phage	33.1	3.2e-28
AVF74036.1|20757_21024_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74037.1|21179_22808_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	69.0	1.5e-16
>prophage 3
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	26636	28019	3418310		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVF74042.1|26636_28019_-	antirestriction protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	28.5	1.5e-12
>prophage 4
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	42989	50180	3418310		Escherichia_phage(33.33%)	4	NA	NA
AVF74056.1|42989_45902_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	74.8	0.0e+00
AVF74057.1|45903_47787_-	type III restriction endonuclease subunit M	NA	Q1MVP0	Enterobacteria_phage	55.4	5.0e-184
AVF74058.1|47976_48162_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74059.1|48548_50180_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	29.0	1.0e-23
>prophage 5
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	55803	65573	3418310	tRNA	Mycobacterium_phage(16.67%)	8	NA	NA
AVF74065.1|55803_58851_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.0	1.3e-88
AVF74066.1|58912_59539_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVF76943.1|59545_60895_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.2	1.1e-84
AVF74067.1|60986_62294_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	7.6e-91
AVF74068.1|62498_63401_+	hypothetical protein	NA	A0A291LBS7	Pseudomonas_phage	42.9	1.4e-35
AVF76944.1|63390_63819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74069.1|63956_64223_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	47.7	2.8e-16
AVF74070.1|64292_65573_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.6	4.8e-21
>prophage 6
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	74513	78879	3418310		Tupanvirus(50.0%)	5	NA	NA
AVF74081.1|74513_75770_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	34.4	8.8e-44
AVF74082.1|75776_76289_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AVF74083.1|76248_76842_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74084.1|76841_77375_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AVF74085.1|77508_78879_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.8	3.6e-115
>prophage 7
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	91091	91829	3418310		Bodo_saltans_virus(100.0%)	1	NA	NA
AVF74097.1|91091_91829_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	25.4	6.6e-07
>prophage 8
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	96202	98949	3418310	tRNA	uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AVF74103.1|96202_96697_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.3	2.7e-12
AVF74104.1|96900_98283_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.0	2.9e-48
AVF74105.1|98370_98949_+	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	55.5	3.0e-55
>prophage 9
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	106639	109102	3418310		Escherichia_phage(100.0%)	1	NA	NA
AVF74116.1|106639_109102_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	28.1	3.3e-71
>prophage 10
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	113967	114759	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF74121.1|113967_114759_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.3e-13
>prophage 11
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	124238	127349	3418310		Leptospira_phage(100.0%)	1	NA	NA
AVF74132.1|124238_127349_+	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	19.5	1.7e-24
>prophage 12
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	142585	143233	3418310		Cedratvirus(100.0%)	1	NA	NA
AVF74147.1|142585_143233_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	34.1	9.5e-18
>prophage 13
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	153169	156178	3418310		Feldmannia_irregularis_virus(50.0%)	3	NA	NA
AVF74158.1|153169_153829_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.8	1.7e-06
AVF74159.1|153905_154331_-	hypothetical protein	NA	NA	NA	NA	NA
AVF74160.1|154426_156178_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.2	1.3e-98
>prophage 14
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	162442	163114	3418310		Planktothrix_phage(100.0%)	1	NA	NA
AVF74167.1|162442_163114_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	2.4e-24
>prophage 15
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	167002	168154	3418310		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVF74170.1|167002_168154_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	54.2	1.3e-99
>prophage 16
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	175171	182854	3418310		Vibrio_phage(33.33%)	7	NA	NA
AVF74175.1|175171_175438_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	6.6e-26
AVF74176.1|175815_177060_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVF74177.1|177136_177991_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AVF74178.1|178302_179949_-	putative pyridoxal-dependent aspartate 1-decarboxylase	NA	S4W1T5	Pandoravirus	26.7	4.4e-19
AVF74179.1|180160_180673_-	hypothetical protein	NA	NA	NA	NA	NA
AVF74180.1|180881_181787_-	DUF340 domain-containing protein	NA	NA	NA	NA	NA
AVF74181.1|181933_182854_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	23.5	2.5e-11
>prophage 17
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	188862	196043	3418310		Bacillus_phage(50.0%)	5	NA	NA
AVF74187.1|188862_189966_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.6	1.9e-90
AVF74188.1|190049_191381_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
AVF74189.1|191478_193200_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.8	1.2e-22
AVF74190.1|193192_194980_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.4	5.1e-29
AVF74191.1|195083_196043_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.2	1.4e-62
>prophage 18
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	199529	200849	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF74195.1|199529_200849_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.0	2.1e-16
>prophage 19
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	205391	207746	3418310		Bodo_saltans_virus(100.0%)	1	NA	NA
AVF76946.1|205391_207746_+	DEAD/DEAH box helicase	NA	A0A2H4UU36	Bodo_saltans_virus	26.8	4.6e-30
>prophage 20
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	221483	223019	3418310		Catovirus(100.0%)	1	NA	NA
AVF74211.1|221483_223019_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	3.2e-88
>prophage 21
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	230281	232765	3418310	tRNA	Tupanvirus(50.0%)	2	NA	NA
AVF74217.1|230281_232210_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.7e-127
AVF74218.1|232213_232765_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.1	3.5e-13
>prophage 22
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	241209	246545	3418310	tRNA	Bodo_saltans_virus(33.33%)	4	NA	NA
AVF74228.1|241209_242193_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.9	4.3e-38
AVF74229.1|242211_244617_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.5	3.9e-08
AVF74230.1|244832_245714_-	AEC family transporter	NA	NA	NA	NA	NA
AVF74231.1|246248_246545_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.7e-12
>prophage 23
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	263619	265031	3418310		Tupanvirus(50.0%)	2	NA	NA
AVF74246.1|263619_264387_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	25.5	1.4e-07
AVF74247.1|264455_265031_-	SAM-dependent methyltransferase	NA	A0A088C537	Shewanella_sp._phage	43.3	1.6e-32
>prophage 24
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	279278	282419	3418310		Klosneuvirus(50.0%)	3	NA	NA
AVF74262.1|279278_280253_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	24.6	9.9e-11
AVF74263.1|280309_281224_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVF74264.1|281297_282419_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.0e-28
>prophage 25
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	288009	291791	3418310		Acinetobacter_phage(33.33%)	3	NA	NA
AVF74269.1|288009_289806_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	38.3	1.5e-121
AVF74270.1|289805_290798_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	25.9	1.8e-07
AVF74271.1|290807_291791_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.6e-16
>prophage 26
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	326351	334491	3418310		Paramecium_bursaria_Chlorella_virus(50.0%)	7	NA	NA
AVF74300.1|326351_326909_+	helix-turn-helix domain-containing protein	NA	A0A2H4J245	uncultured_Caudovirales_phage	29.1	1.6e-05
AVF74301.1|326944_328429_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AVF74302.1|328466_329744_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVF74303.1|329761_330628_+	N-carbamoylputrescine amidase	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	48.8	8.6e-75
AVF74304.1|330640_331723_+	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	46.9	8.8e-93
AVF74305.1|331759_333205_+	succinate-semialdehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AVF74306.1|333219_334491_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.5e-30
>prophage 27
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	341117	346607	3418310		Hokovirus(50.0%)	2	NA	NA
AVF74315.1|341117_344294_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.8	1.1e-45
AVF74316.1|344450_346607_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.5e-14
>prophage 28
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	351263	352214	3418310		Morganella_phage(100.0%)	1	NA	NA
AVF76951.1|351263_352214_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-59
>prophage 29
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	363661	364849	3418310		Bacillus_virus(100.0%)	1	NA	NA
AVF74333.1|363661_364849_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.4	6.4e-28
>prophage 30
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	368106	369765	3418310		Vibrio_phage(100.0%)	1	NA	NA
AVF74336.1|368106_369765_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	6.0e-24
>prophage 31
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	373998	379118	3418310		Tetraselmis_virus(50.0%)	3	NA	NA
AVF74341.1|373998_375564_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	46.9	3.7e-124
AVF74342.1|375952_378283_+	deca-heme c-type cytochrome	NA	NA	NA	NA	NA
AVF74343.1|378329_379118_-	sulfatase	NA	A0A075BUR2	Microcystis_phage	36.3	1.0e-26
>prophage 32
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	383041	384559	3418310		Tetraselmis_virus(100.0%)	1	NA	NA
AVF74347.1|383041_384559_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	45.8	9.4e-117
>prophage 33
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	407443	409021	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF74357.1|407443_409021_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.4e-22
>prophage 34
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	422813	423584	3418310		Moraxella_phage(100.0%)	1	NA	NA
AVF74370.1|422813_423584_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	39.8	9.8e-38
>prophage 35
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	430886	434520	3418310		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
AVF74377.1|430886_431651_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	1.1e-17
AVF74378.1|431662_432547_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF74379.1|432543_434520_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	1.1e-11
>prophage 36
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	437783	441302	3418310		Bacillus_phage(100.0%)	2	NA	NA
AVF74382.1|437783_439559_-	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	22.1	7.8e-22
AVF74383.1|439562_441302_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	6.2e-48
>prophage 37
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	447444	452263	3418310		Bodo_saltans_virus(50.0%)	2	NA	NA
AVF74391.1|447444_450255_-	molecular chaperone DnaK	NA	A0A2H4UU19	Bodo_saltans_virus	29.4	5.8e-11
AVF76952.1|450310_452263_-	nucleotide-binding protein	NA	A0A1V0SG59	Hokovirus	24.8	5.6e-13
>prophage 38
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	461351	469196	3418310		Catovirus(33.33%)	5	NA	NA
AVF76955.1|461351_465359_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.8	1.6e-54
AVF76956.1|465541_466021_+	porin family protein	NA	NA	NA	NA	NA
AVF74399.1|466221_466737_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74400.1|467099_468680_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.9e-25
AVF74401.1|468806_469196_+	ATP-binding protein	NA	A0A0M7QCA5	Escherichia_phage	36.8	2.4e-16
>prophage 39
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	488047	488893	3418310		Mimivirus(100.0%)	1	NA	NA
AVF74416.1|488047_488893_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	32.4	7.5e-31
>prophage 40
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	495003	497025	3418310		Bacillus_phage(100.0%)	3	NA	NA
AVF74422.1|495003_495966_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	1.5e-22
AVF74423.1|496156_496501_+	DUF3802 domain-containing protein	NA	NA	NA	NA	NA
AVF76960.1|496545_497025_-	hydrolase	NA	S5MM68	Bacillus_phage	37.4	7.0e-10
>prophage 41
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	506845	507565	3418310		Indivirus(100.0%)	1	NA	NA
AVF74434.1|506845_507565_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.3	8.1e-18
>prophage 42
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	510914	514763	3418310		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVF74438.1|510914_512954_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.7	7.6e-05
AVF76962.1|513170_514763_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.1	4.8e-55
>prophage 43
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	520125	529889	3418310		Escherichia_phage(66.67%)	5	NA	NA
AVF74445.1|520125_522981_+	formate dehydrogenase	NA	A0A077SK27	Escherichia_phage	22.8	4.5e-11
AVF74446.1|522992_523601_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	30.6	2.0e-17
AVF74447.1|523615_524668_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
AVF74448.1|524651_525068_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74449.1|525491_529889_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	55.5	1.2e-31
>prophage 44
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	548459	550736	3418310		Ostreococcus_tauri_virus(50.0%)	2	NA	NA
AVF74467.1|548459_549680_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	35.1	1.3e-44
AVF74468.1|550004_550736_+	NAD-dependent protein deacylase	NA	A0A2I7QWN6	Vibrio_phage	33.0	9.7e-19
>prophage 45
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	554856	565105	3418310	tRNA	uncultured_virus(50.0%)	10	NA	NA
AVF76964.1|554856_555990_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	3.4e-31
AVF74473.1|556372_557170_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74474.1|557162_557999_+	glucosaminidase	NA	A0A218MMX0	uncultured_virus	31.8	3.7e-06
AVF74475.1|558012_558675_+	DUF2987 domain-containing protein	NA	NA	NA	NA	NA
AVF74476.1|558873_559767_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	67.2	2.2e-102
AVF74477.1|559907_560855_-	universal stress protein UspE	NA	NA	NA	NA	NA
AVF74478.1|561035_561782_-	transcriptional regulator FNR	NA	NA	NA	NA	NA
AVF74479.1|561872_562553_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVF74480.1|562561_562726_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
AVF74481.1|562741_565105_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.3	1.3e-77
>prophage 46
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	570807	574286	3418310		Hokovirus(50.0%)	4	NA	NA
AVF74489.1|570807_572529_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.9	3.9e-42
AVF74490.1|572817_573240_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74491.1|573313_573889_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74492.1|574103_574286_+	hypothetical protein	NA	A0A1W6UG66	Vibrio_phage	52.5	1.3e-09
>prophage 47
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	580172	582092	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF74500.1|580172_582092_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.6	3.4e-55
>prophage 48
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	595993	601104	3418310		Moraxella_phage(50.0%)	4	NA	NA
AVF74508.1|595993_598000_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.3	3.0e-86
AVF74509.1|598017_598644_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVF74510.1|598741_599215_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVF74511.1|599307_601104_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	5.1e-37
>prophage 49
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	610172	621412	3418310		uncultured_Caudovirales_phage(33.33%)	12	NA	NA
AVF74518.1|610172_611231_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	1.4e-87
AVF74519.1|611252_611735_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
AVF74520.1|611837_612758_-	siroheme synthase	NA	NA	NA	NA	NA
AVF74521.1|613218_614247_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	1.7e-77
AVF74522.1|614464_615670_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF74523.1|615671_616769_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF74524.1|616792_617542_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.0e-31
AVF74525.1|617791_618454_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	50.5	1.9e-45
AVF74526.1|618530_618905_-	chromosome partitioning protein ParB	NA	I6R9T2	Croceibacter_phage	29.5	3.7e-06
AVF74527.1|619313_619643_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVF74528.1|619645_619918_-	acylphosphatase	NA	NA	NA	NA	NA
AVF74529.1|620008_621412_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	1.4e-18
>prophage 50
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	656054	660609	3418310		Bacillus_virus(50.0%)	4	NA	NA
AVF74536.1|656054_658025_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.9	3.5e-15
AVF74537.1|658112_658811_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVF74538.1|658917_659610_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVF74539.1|659808_660609_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	36.6	8.0e-43
>prophage 51
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	673182	673917	3418310		Planktothrix_phage(100.0%)	1	NA	NA
AVF76967.1|673182_673917_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	6.7e-36
>prophage 52
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	680819	683960	3418310		Leptospira_phage(100.0%)	1	NA	NA
AVF74557.1|680819_683960_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.8e-61
>prophage 53
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	688570	697304	3418310		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
AVF74563.1|688570_689227_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	60.9	6.8e-72
AVF76968.1|689539_690208_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1B0Z0A9	Vibrio_phage	26.5	6.8e-11
AVF74564.1|690406_691216_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVF74565.1|691376_692822_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AVF74566.1|693207_694539_-	trypsin	NA	Q6JPG5	Neodiprion_lecontei_nucleopolyhedrovirus	33.5	3.0e-26
AVF74567.1|694730_695210_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVF74568.1|695399_697304_-	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.2	1.3e-67
>prophage 54
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	752726	756432	3418310		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
AVF74629.1|752726_754175_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.8	6.3e-38
AVF74630.1|754213_754930_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AVF74631.1|754926_756432_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.3	1.5e-87
>prophage 55
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	809506	810356	3418310		Shigella_phage(50.0%)	2	NA	NA
AVF74687.1|809506_809740_-	hypothetical protein	NA	U5P429	Shigella_phage	52.6	1.3e-14
AVF74688.1|809696_810356_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	36.6	9.3e-29
>prophage 56
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	816491	816929	3418310		Marinobacter_phage(100.0%)	1	NA	NA
AVF74699.1|816491_816929_-	hypothetical protein	NA	A0A2D1GMY0	Marinobacter_phage	43.1	5.6e-06
>prophage 57
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	835168	836089	3418310	transposase	Vibrio_phage(100.0%)	1	NA	NA
AVF74730.1|835168_836089_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	5.6e-173
>prophage 58
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	846981	847272	3418310		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVF74752.1|846981_847272_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	56.4	9.1e-21
>prophage 59
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	850861	851866	3418310		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AVF74758.1|850861_851152_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	56.4	9.1e-21
AVF74759.1|851337_851586_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVF74760.1|851575_851866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	56.4	9.1e-21
>prophage 60
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	860459	861422	3418310	integrase	Brevibacillus_phage(100.0%)	1	857893:857908	861852:861867
857893:857908	attL	GAAGATTTGGCTTTTA	NA	NA	NA	NA
AVF74771.1|860459_861422_+|integrase	integron integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.6	1.3e-15
AVF74771.1|860459_861422_+|integrase	integron integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.6	1.3e-15
861852:861867	attR	TAAAAGCCAAATCTTC	NA	NA	NA	NA
>prophage 61
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	869625	873051	3418310		Pandoravirus(50.0%)	2	NA	NA
AVF74781.1|869625_870990_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	40.2	1.8e-42
AVF74782.1|871350_873051_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	1.1e-44
>prophage 62
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	880066	883938	3418310	tRNA	uncultured_phage(33.33%)	3	NA	NA
AVF74789.1|880066_880429_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	38.6	4.1e-10
AVF74790.1|880722_882348_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	5.7e-19
AVF74791.1|882537_883938_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.4	1.6e-86
>prophage 63
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	891232	895721	3418310		Bacillus_virus(33.33%)	3	NA	NA
AVF74799.1|891232_891964_+	3'-5' exonuclease	NA	M1IDT3	Bacillus_virus	27.0	1.2e-05
AVF74800.1|892034_893918_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.8	3.1e-21
AVF74801.1|894149_895721_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.1	1.4e-19
>prophage 64
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	903585	904242	3418310		Streptococcus_phage(100.0%)	1	NA	NA
AVF74809.1|903585_904242_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	29.8	1.6e-17
>prophage 65
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	911804	912401	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF76984.1|911804_912401_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	43.4	1.9e-36
>prophage 66
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	921418	929604	3418310		Pseudomonas_phage(50.0%)	5	NA	NA
AVF74825.1|921418_924139_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-109
AVF74826.1|924614_925322_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVF74827.1|925823_928106_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2I7S840	Vibrio_phage	69.3	4.2e-312
AVF74828.1|928189_929323_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	73.6	1.8e-160
AVF74829.1|929322_929604_+	(2Fe-2S)-binding protein	NA	G9IAA2	Pseudomonas_phage	39.0	2.7e-09
>prophage 67
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	935338	938215	3418310		Pandoravirus(100.0%)	1	NA	NA
AVF74835.1|935338_938215_-	aminotransferase class III	NA	S4W1T5	Pandoravirus	30.0	3.0e-15
>prophage 68
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	943526	945890	3418310		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVF74839.1|943526_945890_+	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	25.3	4.4e-36
>prophage 69
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	950233	955407	3418310		Acinetobacter_phage(66.67%)	6	NA	NA
AVF74845.1|950233_950854_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	23.7	8.8e-05
AVF74846.1|950913_951771_-	PHP domain-containing protein	NA	NA	NA	NA	NA
AVF74847.1|951866_951992_+	Trp operon leader peptide	NA	NA	NA	NA	NA
AVF74848.1|952168_953734_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
AVF74849.1|953750_954359_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	39.9	2.0e-33
AVF74850.1|954396_955407_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.1	4.0e-55
>prophage 70
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	959939	961481	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF74855.1|959939_961481_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.3	1.3e-41
>prophage 71
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	964617	968896	3418310		Bacillus_phage(50.0%)	4	NA	NA
AVF74859.1|964617_967158_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	31.4	8.6e-06
AVF76986.1|967263_967512_+	hypothetical protein	NA	NA	NA	NA	NA
AVF74860.1|967711_968275_+	septation protein A	NA	NA	NA	NA	NA
AVF74861.1|968500_968896_+	acyl-CoA thioester hydrolase YciA	NA	A0A292GK23	Xanthomonas_phage	28.7	8.6e-06
>prophage 72
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	977366	979700	3418310		Pseudomonas_phage(100.0%)	1	NA	NA
AVF74868.1|977366_979700_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.8	5.7e-105
>prophage 73
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	987331	989202	3418310		Shigella_phage(50.0%)	2	NA	NA
AVF74874.1|987331_988372_-	glycosyltransferase	NA	U5P087	Shigella_phage	49.7	2.5e-76
AVF74875.1|988524_989202_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.7	2.1e-23
>prophage 74
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1000970	1001675	3418310		Planktothrix_phage(100.0%)	1	NA	NA
AVF76988.1|1000970_1001675_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	1.9e-40
>prophage 75
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1007256	1008069	3418310		Acinetobacter_phage(100.0%)	1	NA	NA
AVF74891.1|1007256_1008069_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	39.7	9.4e-23
>prophage 76
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1016505	1019598	3418310		Escherichia_phage(100.0%)	1	NA	NA
AVF74900.1|1016505_1019598_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	24.7	1.0e-05
>prophage 77
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1031630	1035857	3418310	protease	Geobacillus_virus(50.0%)	4	NA	NA
AVF74912.1|1031630_1031912_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	36.7	2.4e-10
AVF74913.1|1032125_1033796_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVF76989.1|1033906_1034587_-	cytidylate kinase	NA	NA	NA	NA	NA
AVF74914.1|1034795_1035857_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	5.7e-20
>prophage 78
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1039115	1043216	3418310		Streptomyces_phage(50.0%)	2	NA	NA
AVF74918.1|1039115_1042190_+	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	25.3	1.9e-76
AVF74919.1|1042262_1043216_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	5.5e-30
>prophage 79
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1055196	1055829	3418310		Bacteriophage(100.0%)	1	NA	NA
AVF74930.1|1055196_1055829_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.0	1.1e-26
>prophage 80
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1059105	1060323	3418310		Ralstonia_phage(50.0%)	2	NA	NA
AVF74934.1|1059105_1059339_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	4.9e-09
AVF74935.1|1059585_1060323_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	5.5e-14
>prophage 81
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1069891	1071451	3418310		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVF74944.1|1069891_1071451_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.5	7.0e-91
>prophage 82
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1075022	1079159	3418310	tRNA	Catovirus(50.0%)	3	NA	NA
AVF74948.1|1075022_1075664_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	3.0e-32
AVF74949.1|1075844_1076921_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AVF74950.1|1077083_1079159_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	29.7	8.2e-63
>prophage 83
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1100958	1102925	3418310		Bacillus_virus(50.0%)	2	NA	NA
AVF74968.1|1100958_1101972_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	32.8	1.5e-17
AVF74969.1|1101950_1102925_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.2	6.6e-15
>prophage 84
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1111500	1114241	3418310		Streptococcus_phage(50.0%)	3	NA	NA
AVF74977.1|1111500_1112397_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	30.6	1.8e-27
AVF74978.1|1112535_1112880_-	phosphorelay protein LuxU	NA	NA	NA	NA	NA
AVF76992.1|1112876_1114241_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	2.1e-06
>prophage 85
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1117588	1119886	3418310		Tetraselmis_virus(100.0%)	1	NA	NA
AVF74980.1|1117588_1119886_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	2.6e-158
>prophage 86
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1129590	1130235	3418310		Acaryochloris_phage(100.0%)	1	NA	NA
AVF74992.1|1129590_1130235_+	ribonuclease T	NA	L0N6K9	Acaryochloris_phage	24.7	2.2e-06
>prophage 87
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1134814	1135399	3418310		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVF74998.1|1134814_1135399_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	1.6e-40
>prophage 88
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1147777	1155646	3418310		Vibrio_phage(33.33%)	7	NA	NA
AVF75007.1|1147777_1148776_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	59.5	1.7e-106
AVF75008.1|1148861_1149089_+	hypothetical protein	NA	NA	NA	NA	NA
AVF75009.1|1149111_1150920_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AVF75010.1|1151359_1152283_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	29.3	1.5e-16
AVF75011.1|1152554_1153244_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVF75012.1|1153427_1153634_+	hypothetical protein	NA	NA	NA	NA	NA
AVF75013.1|1153678_1155646_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.5	1.4e-32
>prophage 89
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1167511	1169548	3418310		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVF75022.1|1167511_1169548_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.0	9.3e-19
>prophage 90
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1180604	1183264	3418310		Bacteriophage(50.0%)	2	NA	NA
AVF75037.1|1180604_1182710_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.8	7.8e-45
AVF75038.1|1182718_1183264_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.6e-29
>prophage 91
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1186539	1188054	3418310		Mollivirus(100.0%)	1	NA	NA
AVF75043.1|1186539_1188054_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.9	8.0e-84
>prophage 92
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1198268	1199402	3418310		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVF75051.1|1198268_1199402_-	DUF3410 domain-containing protein	NA	A0A2R8FDS8	Brazilian_cedratvirus	30.3	4.7e-20
>prophage 93
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1205847	1212353	3418310		Pandoravirus(50.0%)	5	NA	NA
AVF75060.1|1205847_1206933_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	4.5e-89
AVF75061.1|1207113_1208046_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVF75062.1|1208108_1208639_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVF75063.1|1208735_1209200_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVF75064.1|1209575_1212353_+	peptidase M16	NA	A0A1V0SJA4	Klosneuvirus	27.3	1.7e-100
>prophage 94
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1216976	1217552	3418310		Sinorhizobium_phage(100.0%)	1	NA	NA
AVF75069.1|1216976_1217552_+	RNA polymerase subunit sigma	NA	A0A0F6TH34	Sinorhizobium_phage	27.1	7.4e-06
>prophage 95
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1238769	1242549	3418310		Bacillus_virus(50.0%)	5	NA	NA
AVF75090.1|1238769_1239387_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	30.5	4.5e-17
AVF76998.1|1239677_1240172_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
AVF75091.1|1240185_1240680_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVF75092.1|1240715_1241780_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVF75093.1|1241769_1242549_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.1	2.1e-19
>prophage 96
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1246808	1247957	3418310		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AVF75097.1|1246808_1247177_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.1	4.3e-07
AVF75098.1|1247222_1247957_-	RNA polymerase sigma factor FliA	NA	Q2I8C6	Bacillus_phage	27.2	1.2e-08
>prophage 97
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1290495	1291416	3418310		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVF75141.1|1290495_1290846_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	4.2e-20
AVF75142.1|1290846_1291416_+	NAD(P)H:quinone oxidoreductase	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	31.6	1.7e-15
>prophage 98
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1295769	1297618	3418310		Prochlorococcus_phage(100.0%)	2	NA	NA
AVF75147.1|1295769_1296810_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.5	5.5e-76
AVF75148.1|1296961_1297618_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.5	8.7e-27
>prophage 99
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1302502	1312068	3418310		uncultured_Caudovirales_phage(20.0%)	10	NA	NA
AVF75152.1|1302502_1304278_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.0	3.8e-16
AVF75153.1|1304351_1304762_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVF75154.1|1304846_1305239_-	DUF1353 domain-containing protein	NA	I3UMI9	Colwellia_phage	36.8	2.4e-08
AVF75155.1|1305430_1305961_-	hypothetical protein	NA	NA	NA	NA	NA
AVF75156.1|1306185_1307436_-	TIGR03503 family protein	NA	NA	NA	NA	NA
AVF75157.1|1307444_1308167_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	7.0e-38
AVF75158.1|1308226_1308691_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	4.4e-49
AVF75159.1|1308687_1309434_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVF77002.1|1309471_1310230_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVF75160.1|1310484_1312068_+	lytic transglycosylase	NA	A0A0A7NU10	Lactobacillus_phage	34.3	2.4e-14
>prophage 100
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1317074	1321271	3418310		Saccharomonospora_phage(50.0%)	2	NA	NA
AVF75167.1|1317074_1320554_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	3.2e-205
AVF75168.1|1320635_1321271_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	39.4	5.1e-24
>prophage 101
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1330648	1332259	3418310		Tupanvirus(50.0%)	2	NA	NA
AVF75176.1|1330648_1331491_-	CDP-diglyceride synthetase	NA	A0A2K9L268	Tupanvirus	34.3	2.3e-08
AVF75177.1|1331503_1332259_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.7	6.0e-24
>prophage 102
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1359426	1365350	3418310		Tupanvirus(50.0%)	4	NA	NA
AVF75205.1|1359426_1361973_+	chitinase	NA	A0A2K9L6L9	Tupanvirus	27.2	2.0e-18
AVF75206.1|1362063_1362807_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AVF75207.1|1362868_1363426_-	transcription elongation factor	NA	NA	NA	NA	NA
AVF75208.1|1363424_1365350_+	RecQ family ATP-dependent DNA helicase	NA	G5CQD7	Megavirus	35.0	4.9e-54
>prophage 103
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1386312	1387524	3418310		environmental_halophage(100.0%)	1	NA	NA
AVF75231.1|1386312_1387524_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	38.4	1.4e-86
>prophage 104
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1395667	1401498	3418310		Virus_Rctr197k(50.0%)	2	NA	NA
AVF75241.1|1395667_1397815_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.3	6.3e-26
AVF75242.1|1397814_1401498_-	exodeoxyribonuclease V subunit beta	NA	B6V2U6	Bacillus_phage	25.7	1.7e-10
>prophage 105
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1435069	1440308	3418310		Catovirus(50.0%)	4	NA	NA
AVF75271.1|1435069_1436776_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	30.9	1.6e-48
AVF75272.1|1436844_1437054_-	hypothetical protein	NA	NA	NA	NA	NA
AVF75273.1|1437151_1438099_+	transcriptional regulator	NA	NA	NA	NA	NA
AVF75274.1|1438217_1440308_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	3.5e-61
>prophage 106
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1448377	1449706	3418310		Geobacillus_virus(100.0%)	1	NA	NA
AVF75281.1|1448377_1449706_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.3	2.9e-77
>prophage 107
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1453703	1455293	3418310		Streptococcus_phage(100.0%)	1	NA	NA
AVF75286.1|1453703_1455293_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	28.2	5.2e-33
>prophage 108
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1478000	1479983	3418310	protease	Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVF75309.1|1478000_1479983_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.0	3.8e-118
>prophage 109
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1487441	1493475	3418310		Bacillus_phage(33.33%)	4	NA	NA
AVF75317.1|1487441_1488734_+	peptidase M23	NA	A0A1P8CWQ1	Bacillus_phage	46.5	5.2e-15
AVF75318.1|1488798_1491903_-	MFS transporter	NA	S5VTK5	Leptospira_phage	23.1	1.3e-56
AVF75319.1|1491912_1493028_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVF75320.1|1493133_1493475_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.4	5.5e-25
>prophage 110
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1497776	1501163	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF75324.1|1497776_1501163_+	HAMP domain-containing protein	NA	W8CYM9	Bacillus_phage	40.7	1.8e-19
>prophage 111
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1505812	1506796	3418310		Bacillus_virus(100.0%)	1	NA	NA
AVF75328.1|1505812_1506796_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.9e-15
>prophage 112
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1515081	1521804	3418310		Streptococcus_phage(33.33%)	5	NA	NA
AVF75334.1|1515081_1516494_+	phosphonomutase	NA	A0A1X9I671	Streptococcus_phage	25.8	9.2e-34
AVF75335.1|1516652_1517684_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	3.2e-28
AVF75336.1|1517683_1519309_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVF75337.1|1519408_1520422_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF75338.1|1520574_1521804_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.9	2.7e-58
>prophage 113
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1525692	1547777	3418310	tRNA,protease	Catovirus(14.29%)	19	NA	NA
AVF75342.1|1525692_1528023_-|protease	serine protease	protease	A0A1V0SCG0	Catovirus	27.1	3.1e-10
AVF75343.1|1528145_1530518_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AVF75344.1|1530510_1532979_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.1	7.5e-31
AVF75345.1|1533045_1533762_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVF75346.1|1533898_1534345_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AVF75347.1|1534440_1535304_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVF77010.1|1535412_1536774_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.4	2.8e-27
AVF75348.1|1536770_1537256_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVF75349.1|1537280_1538075_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AVF75350.1|1538086_1538992_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AVF75351.1|1539045_1539975_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	37.2	6.9e-46
AVF75352.1|1539996_1540095_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AVF75353.1|1540102_1540873_-	ABC transporter permease	NA	NA	NA	NA	NA
AVF75354.1|1540873_1541791_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.1	5.3e-22
AVF75355.1|1542041_1543712_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
AVF75356.1|1543993_1544662_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVF75357.1|1544739_1545270_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	35.2	2.0e-13
AVF75358.1|1545589_1546204_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVF75359.1|1546349_1547777_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.3e-40
>prophage 114
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1581296	1600054	3418310	tRNA	uncultured_Mediterranean_phage(16.67%)	17	NA	NA
AVF75388.1|1581296_1581494_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	5.2e-12
AVF75389.1|1581586_1582774_-	aspartate kinase	NA	NA	NA	NA	NA
AVF75390.1|1582986_1585569_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	5.9e-79
AVF75391.1|1585711_1586179_-	recombination regulator RecX	NA	NA	NA	NA	NA
AVF75392.1|1586306_1587350_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.0	8.1e-112
AVF75393.1|1587550_1588033_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	48.1	1.8e-26
AVF75394.1|1588117_1590679_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	1.7e-30
AVF75395.1|1590761_1591748_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
AVF75396.1|1591828_1592752_-	LysM peptidoglycan-binding domain-containing protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
AVF75397.1|1592765_1593392_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	54.5	2.3e-37
AVF75398.1|1593391_1594168_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.4	2.3e-66
AVF75399.1|1594167_1595211_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVF75400.1|1595256_1595733_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AVF75401.1|1595747_1596455_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.3	7.0e-06
AVF75402.1|1596456_1596738_-	cell division protein FtsB	NA	NA	NA	NA	NA
AVF75403.1|1597033_1598335_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	9.1e-137
AVF75404.1|1598413_1600054_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	2.1e-154
>prophage 115
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1603622	1617242	3418310		Erysipelothrix_phage(20.0%)	13	NA	NA
AVF75407.1|1603622_1604942_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.3	4.0e-39
AVF75408.1|1605134_1607933_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	31.5	5.3e-57
AVF75409.1|1608002_1608383_-	holo-ACP synthase	NA	NA	NA	NA	NA
AVF75410.1|1608393_1609128_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVF75411.1|1609124_1609856_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVF75412.1|1609971_1610934_-	GTPase Era	NA	NA	NA	NA	NA
AVF75413.1|1610926_1611604_-	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	35.6	8.7e-22
AVF75414.1|1611625_1612525_-	signal peptidase I	NA	NA	NA	NA	NA
AVF75415.1|1612629_1614423_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	24.5	9.3e-23
AVF75416.1|1614581_1615052_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF75417.1|1615054_1616014_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AVF75418.1|1616010_1616649_-	anti-sigma E factor	NA	NA	NA	NA	NA
AVF75419.1|1616663_1617242_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.6	3.7e-05
>prophage 116
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1628019	1629252	3418310		Catovirus(100.0%)	1	NA	NA
AVF75434.1|1628019_1629252_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	9.3e-107
>prophage 117
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1637461	1639420	3418310		Acinetobacter_phage(100.0%)	1	NA	NA
AVF75443.1|1637461_1639420_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.1	5.2e-11
>prophage 118
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1642855	1644010	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF75446.1|1642855_1644010_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.3	1.4e-128
>prophage 119
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1655730	1656909	3418310		Klosneuvirus(100.0%)	1	NA	NA
AVF75461.1|1655730_1656909_+	YggW family oxidoreductase	NA	A0A1V0SKT9	Klosneuvirus	26.3	4.4e-05
>prophage 120
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1663776	1665732	3418310		Tetraselmis_virus(100.0%)	1	NA	NA
AVF75468.1|1663776_1665732_+	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	44.2	3.5e-156
>prophage 121
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1682216	1683476	3418310		Streptococcus_phage(100.0%)	1	NA	NA
AVF77014.1|1682216_1683476_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	31.6	7.2e-22
>prophage 122
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1697283	1699239	3418310		Tetraselmis_virus(100.0%)	1	NA	NA
AVF75494.1|1697283_1699239_+	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	44.2	3.5e-156
>prophage 123
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1715677	1716937	3418310		Streptococcus_phage(100.0%)	1	NA	NA
AVF77017.1|1715677_1716937_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	31.6	7.2e-22
>prophage 124
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1728399	1732313	3418310		Geobacillus_virus(50.0%)	2	NA	NA
AVF75511.1|1728399_1729539_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	35.0	7.0e-08
AVF75512.1|1730687_1732313_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	67.5	2.9e-15
>prophage 125
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1755523	1760552	3418310	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
AVF75526.1|1755523_1757032_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	2.0e-47
AVF77020.1|1757147_1757597_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVF75527.1|1757693_1760552_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	4.2e-150
>prophage 126
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1766814	1767744	3418310		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVF75535.1|1766814_1767744_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	43.6	1.2e-58
>prophage 127
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1773464	1781620	3418310		Bacillus_virus(25.0%)	10	NA	NA
AVF75545.1|1773464_1774268_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-21
AVF75546.1|1774642_1775608_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVF75547.1|1775637_1776609_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	1.8e-41
AVF75548.1|1776695_1777259_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVF75549.1|1777239_1777734_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVF75550.1|1777735_1778461_+	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	5.1e-20
AVF75551.1|1778511_1779981_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVF75552.1|1780005_1780293_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVF75553.1|1780295_1780742_+	PTS IIA-like nitrogen-regulatory protein PtsN	NA	NA	NA	NA	NA
AVF75554.1|1780756_1781620_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.5e-07
>prophage 128
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1785540	1793922	3418310		Brazilian_cedratvirus(33.33%)	5	NA	NA
AVF75559.1|1785540_1786503_-	glycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	30.5	5.7e-27
AVF75560.1|1786605_1787358_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AVF75561.1|1787700_1788966_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AVF75562.1|1789074_1791984_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	2.2e-21
AVF75563.1|1792545_1793922_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	44.4	2.2e-104
>prophage 129
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1803781	1814635	3418310	transposase	Vibrio_phage(40.0%)	8	NA	NA
AVF75571.1|1803781_1804825_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	20.3	2.7e-06
AVF75572.1|1804976_1805591_-	hypothetical protein	NA	NA	NA	NA	NA
AVF75573.1|1805783_1806704_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	5.6e-173
AVF75574.1|1806917_1808927_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVF75575.1|1809169_1809709_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	92.2	3.0e-57
AVF75576.1|1809986_1810631_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVF75577.1|1810790_1811663_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.4	2.9e-62
AVF75578.1|1811812_1814635_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
>prophage 130
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1819604	1824808	3418310		Dickeya_phage(50.0%)	2	NA	NA
AVF75583.1|1819604_1823285_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	78.0	7.3e-22
AVF75584.1|1823476_1824808_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	36.2	3.1e-39
>prophage 131
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1848820	1850221	3418310		Salmonella_phage(100.0%)	1	NA	NA
AVF75595.1|1848820_1850221_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	73.0	1.4e-183
>prophage 132
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1853723	1854563	3418310		Vibrio_phage(100.0%)	1	NA	NA
AVF75602.1|1853723_1854563_-	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	50.2	1.9e-71
>prophage 133
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1858035	1859775	3418310		Vibrio_phage(100.0%)	1	NA	NA
AVF75606.1|1858035_1859775_-	type IV pilus secretin PilQ	NA	O80264	Vibrio_phage	21.5	1.0e-10
>prophage 134
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1866312	1867041	3418310		Synechococcus_phage(100.0%)	1	NA	NA
AVF75613.1|1866312_1867041_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.0	1.4e-46
>prophage 135
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1879399	1879939	3418310		Vibrio_phage(100.0%)	1	NA	NA
AVF75622.1|1879399_1879939_+	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	27.4	1.6e-10
>prophage 136
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1887992	1893661	3418310		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AVF75630.1|1887992_1889177_-	elongation factor Tu	NA	D0UIL0	Aggregatibacter_phage	78.1	5.8e-05
AVF75631.1|1889330_1891430_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.1	7.3e-51
AVF75632.1|1891505_1891976_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVF75633.1|1892077_1892452_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVF75634.1|1892629_1892905_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AVF75635.1|1892912_1893269_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	32.7	6.8e-10
AVF75636.1|1893265_1893661_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	6.4e-17
>prophage 137
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1901262	1903182	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF75647.1|1901262_1903182_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	5.1e-67
>prophage 138
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1910667	1912828	3418310		Klosneuvirus(50.0%)	2	NA	NA
AVF75656.1|1910667_1911879_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.9	5.7e-24
AVF75657.1|1912240_1912828_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.5	1.5e-67
>prophage 139
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1925645	1932285	3418310		Lactococcus_phage(50.0%)	5	NA	NA
AVF75669.1|1925645_1928153_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	3.9e-67
AVF75670.1|1928268_1928694_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVF75671.1|1928851_1930036_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVF75672.1|1930116_1930752_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AVF75673.1|1930968_1932285_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	37.0	6.3e-69
>prophage 140
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1937655	1941396	3418310		Wolbachia_phage(50.0%)	2	NA	NA
AVF75680.1|1937655_1939668_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.2	3.7e-60
AVF75681.1|1939686_1941396_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	4.1e-12
>prophage 141
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1945285	1945831	3418310		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVF75685.1|1945285_1945831_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.2	4.1e-30
>prophage 142
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1956070	1960385	3418310		Brevibacillus_phage(50.0%)	5	NA	NA
AVF77023.1|1956070_1957198_+	peptidase M23	NA	A0A0K2CNY2	Brevibacillus_phage	39.0	1.4e-11
AVF75695.1|1957271_1958228_-	acetyltransferase	NA	NA	NA	NA	NA
AVF75696.1|1958372_1959008_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVF75697.1|1959029_1959404_-	VanZ family protein	NA	NA	NA	NA	NA
AVF75698.1|1959413_1960385_-	elongation factor P lysine(34) lysyltransferase	NA	A0A1V0SAC0	Catovirus	27.7	1.1e-25
>prophage 143
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1964255	1971134	3418310		Vibrio_virus(25.0%)	7	NA	NA
AVF75703.1|1964255_1965659_-	hypothetical protein	NA	A0A2H5BGM4	Vibrio_virus	46.1	1.5e-44
AVF75704.1|1965926_1966493_-	elongation factor P	NA	NA	NA	NA	NA
AVF75705.1|1966525_1967548_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AVF75706.1|1967643_1968141_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	32.3	3.1e-08
AVF75707.1|1968241_1968817_-	phaC PHA synthase	NA	NA	NA	NA	NA
AVF75708.1|1969119_1970766_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.5	1.1e-190
AVF75709.1|1970843_1971134_-	co-chaperone GroES	NA	A0A221S331	uncultured_virus	41.5	1.0e-11
>prophage 144
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1975816	1978683	3418310		Bacillus_phage(50.0%)	3	NA	NA
AVF75713.1|1975816_1976506_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.2	7.2e-32
AVF75714.1|1976505_1977900_+	two-component system sensor histidine kinase CpxA	NA	NA	NA	NA	NA
AVF75715.1|1978074_1978683_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.9	1.5e-52
>prophage 145
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	1993004	1996436	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF75728.1|1993004_1996436_-	PAS domain-containing protein	NA	A0A2K9L5I4	Tupanvirus	25.6	1.0e-14
>prophage 146
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2000728	2002681	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF75732.1|2000728_2002681_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.9	5.5e-85
>prophage 147
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2009024	2010596	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF75740.1|2009024_2010596_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	4.0e-46
>prophage 148
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2034912	2039085	3418310		Prochlorococcus_phage(50.0%)	4	NA	NA
AVF75746.1|2034912_2036505_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.0	6.0e-74
AVF75747.1|2036699_2037989_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVF75748.1|2038074_2038806_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AVF75749.1|2038812_2039085_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	60.7	2.0e-22
>prophage 149
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2045899	2054235	3418310		Vibrio_phage(50.0%)	2	NA	NA
AVF75757.1|2045899_2050102_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.9	9.1e-69
AVF75758.1|2050206_2054235_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	27.2	1.8e-21
>prophage 150
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2058209	2061022	3418310		Aggregatibacter_phage(50.0%)	2	NA	NA
AVF75765.1|2058209_2059394_-	elongation factor Tu	NA	D0UIL0	Aggregatibacter_phage	78.1	5.8e-05
AVF75766.1|2060098_2061022_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.2	1.8e-30
>prophage 151
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2087634	2088255	3418310		Enterobacteria_phage(100.0%)	1	NA	NA
AVF75783.1|2087634_2088255_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	43.3	2.4e-10
>prophage 152
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2094800	2097467	3418310		Salicola_phage(50.0%)	3	NA	NA
AVF75790.1|2094800_2095658_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	37.5	7.3e-42
AVF75791.1|2095834_2096803_-	cell division protein FtsX	NA	NA	NA	NA	NA
AVF75792.1|2096792_2097467_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	8.6e-14
>prophage 153
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2103613	2104627	3418310		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVF75802.1|2103613_2104627_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.3	1.4e-07
>prophage 154
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2107934	2108270	3418310		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVF75806.1|2107934_2108270_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.8	1.4e-20
>prophage 155
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2118582	2119515	3418310		Virus_Rctr41k(100.0%)	1	NA	NA
AVF75816.1|2118582_2119515_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	31.9	1.4e-17
>prophage 156
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2141906	2143658	3418310		Streptomyces_phage(50.0%)	2	NA	NA
AVF75830.1|2141906_2142233_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	40.2	1.5e-16
AVF75831.1|2142344_2143658_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	32.7	2.8e-45
>prophage 157
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2147211	2157961	3418310		Vibrio_phage(25.0%)	8	NA	NA
AVF75834.1|2147211_2147886_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	62.2	2.6e-63
AVF75835.1|2148120_2148426_-	DUF3630 domain-containing protein	NA	NA	NA	NA	NA
AVF75836.1|2148435_2150271_-	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	36.5	5.7e-84
AVF75837.1|2150449_2151367_+	EamA family transporter RarD	NA	NA	NA	NA	NA
AVF75838.1|2151440_2152238_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVF75839.1|2152329_2152989_+	LysE family translocator	NA	NA	NA	NA	NA
AVF75840.1|2153100_2154867_+	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	24.7	3.2e-07
AVF75841.1|2155786_2157961_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.8	1.2e-117
>prophage 158
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2163546	2165337	3418310		Acinetobacter_phage(100.0%)	1	NA	NA
AVF75848.1|2163546_2165337_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.5	2.9e-93
>prophage 159
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2172106	2172490	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF75855.1|2172106_2172490_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	40.3	3.9e-11
>prophage 160
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2184872	2186108	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF75870.1|2184872_2186108_-	hypothetical protein	NA	A0A0E3M2X0	Bacillus_phage	28.8	5.5e-06
>prophage 161
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2196924	2197482	3418310		Pandoravirus(100.0%)	1	NA	NA
AVF75877.1|2196924_2197482_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	29.3	1.1e-14
>prophage 162
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2202825	2204325	3418310	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AVF75884.1|2202825_2203344_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.9	1.3e-17
AVF75885.1|2203377_2204325_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	25.1	4.9e-07
>prophage 163
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2219138	2220785	3418310		Micromonas_pusilla_virus(100.0%)	1	NA	NA
AVF75898.1|2219138_2220785_+	acetolactate synthase 2 catalytic subunit	NA	G8DDL3	Micromonas_pusilla_virus	29.2	5.3e-65
>prophage 164
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2229510	2230872	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF75907.1|2229510_2230872_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.9	1.0e-29
>prophage 165
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2238172	2239852	3418310		Leptospira_phage(50.0%)	2	NA	NA
AVF75917.1|2238172_2239054_-	chromosome partitioning protein ParB	NA	S5VSZ7	Leptospira_phage	35.8	2.5e-13
AVF75918.1|2239078_2239852_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.6	1.3e-18
>prophage 166
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2246530	2248239	3418310		Staphylococcus_phage(50.0%)	4	NA	NA
AVF75925.1|2246530_2246788_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	54.5	3.5e-16
AVF75926.1|2246754_2247111_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVF75927.1|2247124_2247259_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVF75928.1|2247501_2248239_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	1.1e-30
>prophage 167
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2251650	2258002	3418310		Rhizobium_phage(33.33%)	7	NA	NA
AVF75933.1|2251650_2252751_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.4	1.3e-51
AVF75934.1|2252760_2253840_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AVF75935.1|2253853_2256271_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	5.0e-112
AVF75936.1|2256394_2256616_-	hypothetical protein	NA	NA	NA	NA	NA
AVF75937.1|2256614_2257031_+	hypothetical protein	NA	NA	NA	NA	NA
AVF75938.1|2257045_2257162_+	hypothetical protein	NA	NA	NA	NA	NA
AVF75939.1|2257564_2258002_+	heat-shock protein Hsp20	NA	E3SM62	Prochlorococcus_phage	35.1	5.4e-17
>prophage 168
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2266415	2266664	3418310		Dickeya_phage(100.0%)	1	NA	NA
AVF77030.1|2266415_2266664_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	69.4	1.3e-07
>prophage 169
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2273000	2273624	3418310		Streptococcus_phage(100.0%)	1	NA	NA
AVF75951.1|2273000_2273624_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.2	5.5e-23
>prophage 170
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2289757	2291773	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF75961.1|2289757_2291773_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.2	2.1e-116
>prophage 171
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2295051	2296767	3418310		Bacillus_virus(100.0%)	1	NA	NA
AVF75965.1|2295051_2296767_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	4.9e-21
>prophage 172
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2315295	2317338	3418310		Indivirus(100.0%)	1	NA	NA
AVF75981.1|2315295_2317338_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	5.2e-46
>prophage 173
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2335776	2347393	3418310	transposase	Bacillus_virus(20.0%)	11	NA	NA
AVF76003.1|2335776_2338224_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	36.8	7.5e-23
AVF76004.1|2338418_2339324_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVF76005.1|2339492_2341025_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	80.3	2.3e-22
AVF76006.1|2341102_2341882_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AVF76007.1|2341893_2342529_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AVF76008.1|2342525_2344160_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	30.7	2.0e-32
AVF76009.1|2344212_2344458_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVF76010.1|2344461_2344860_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVF76011.1|2344928_2345681_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.1	4.0e-28
AVF77033.1|2345750_2345867_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76012.1|2346189_2347393_+|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	31.4	1.3e-20
>prophage 174
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2350623	2353410	3418310		uncultured_virus(100.0%)	1	NA	NA
AVF76015.1|2350623_2353410_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.4	8.1e-74
>prophage 175
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2365015	2370743	3418310		Ectocarpus_siliculosus_virus(50.0%)	4	NA	NA
AVF76024.1|2365015_2366062_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.9	8.1e-11
AVF76025.1|2366195_2366777_-	nitrogen regulation protein NR	NA	NA	NA	NA	NA
AVF76026.1|2366973_2368383_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
AVF76027.1|2368913_2370743_+	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	42.1	6.2e-22
>prophage 176
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2376733	2383227	3418310		Staphylococcus_phage(50.0%)	5	NA	NA
AVF76034.1|2376733_2378362_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	49.0	3.2e-139
AVF76035.1|2378698_2379574_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AVF76036.1|2379605_2379992_-	heat-shock protein	NA	NA	NA	NA	NA
AVF76037.1|2380245_2381172_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
AVF76038.1|2381208_2383227_+	type II secretion system protein GspD	NA	O80264	Vibrio_phage	30.1	2.6e-29
>prophage 177
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2402099	2405695	3418310		Bacillus_phage(66.67%)	3	NA	NA
AVF76058.1|2402099_2402819_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.0	8.0e-34
AVF76059.1|2402921_2404214_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	25.6	4.1e-12
AVF76060.1|2404285_2405695_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	69.3	7.0e-42
>prophage 178
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2411586	2412210	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF76065.1|2411586_2412210_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	32.1	3.0e-13
>prophage 179
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2417693	2420294	3418310		Acinetobacter_phage(100.0%)	1	NA	NA
AVF76073.1|2417693_2420294_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.7	2.1e-84
>prophage 180
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2425059	2426792	3418310		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVF76078.1|2425059_2425917_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	1.5e-10
AVF76079.1|2425952_2426792_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	1.9e-18
>prophage 181
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2431758	2440298	3418310		Methanothermobacter_phage(20.0%)	11	NA	NA
AVF76087.1|2431758_2432958_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.2	1.9e-40
AVF77038.1|2432996_2433176_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76088.1|2433151_2434825_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	9.0e-28
AVF76089.1|2434939_2435614_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVF76090.1|2435916_2436153_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVF76091.1|2436166_2436337_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVF76092.1|2436603_2437086_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76093.1|2437188_2437998_+	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	29.8	6.1e-22
AVF76094.1|2438004_2438769_-	glycosyltransferase	NA	A0A1D8KNF8	Synechococcus_phage	31.2	2.2e-13
AVF76095.1|2438789_2439770_-	glycosyl transferase	NA	NA	NA	NA	NA
AVF76096.1|2439797_2440298_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.1	6.2e-25
>prophage 182
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2445020	2449505	3418310		Enterobacteria_phage(60.0%)	5	NA	NA
AVF76102.1|2445020_2446079_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.9e-100
AVF76103.1|2446098_2446980_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	7.6e-111
AVF76104.1|2446972_2447857_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.6	1.9e-40
AVF76105.1|2447853_2448417_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.1	1.8e-52
AVF76106.1|2448413_2449505_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.0	2.4e-29
>prophage 183
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2455356	2456298	3418310		Prochlorococcus_phage(100.0%)	1	NA	NA
AVF76113.1|2455356_2456298_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	9.5e-35
>prophage 184
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2465697	2469637	3418310		Enterobacteria_phage(60.0%)	5	NA	NA
AVF76120.1|2465697_2466771_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.3	2.5e-95
AVF76121.1|2466858_2467746_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	7.2e-109
AVF76122.1|2467745_2468624_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.8	1.2e-39
AVF76123.1|2468627_2469173_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	3.4e-53
AVF76124.1|2469172_2469637_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	39.5	3.2e-20
>prophage 185
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2477059	2483107	3418310		Tupanvirus(25.0%)	4	NA	NA
AVF76133.1|2477059_2478235_+	aminotransferase	NA	A0A2K9L470	Tupanvirus	49.3	1.1e-101
AVF76134.1|2478413_2480360_+	nucleoside-diphosphate sugar epimerase	NA	A0A1V0SAI8	Catovirus	25.7	2.9e-17
AVF76135.1|2480516_2481683_+	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	56.0	1.2e-116
AVF76136.1|2481757_2483107_-	MBL fold hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	26.0	4.9e-08
>prophage 186
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2498017	2499349	3418310		Erwinia_phage(100.0%)	1	NA	NA
AVF76152.1|2498017_2499349_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.3	5.3e-39
>prophage 187
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2521891	2523271	3418310		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVF76189.1|2521891_2523271_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.8	1.9e-55
>prophage 188
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2528100	2532148	3418310		Hokovirus(50.0%)	3	NA	NA
AVF76193.1|2528100_2529531_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.7	7.4e-31
AVF76194.1|2529781_2531506_+	SLC13 family permease	NA	NA	NA	NA	NA
AVF76195.1|2531530_2532148_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	38.1	3.8e-08
>prophage 189
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2535262	2535991	3418310		Planktothrix_phage(100.0%)	1	NA	NA
AVF76199.1|2535262_2535991_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	9.6e-27
>prophage 190
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2544719	2557249	3418310	transposase	uncultured_Caudovirales_phage(50.0%)	12	NA	NA
AVF76207.1|2544719_2545067_+	gamma-glutamylcyclotransferase	NA	A0A1B1IUC5	uncultured_Mediterranean_phage	34.1	1.7e-05
AVF76208.1|2545116_2545479_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AVF76209.1|2546086_2547007_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	5.6e-173
AVF76210.1|2548785_2550639_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	1.3e-14
AVF76211.1|2550897_2551281_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76212.1|2551296_2551512_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76213.1|2551523_2552804_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76214.1|2552821_2554003_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	2.3e-22
AVF76215.1|2553999_2554380_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76216.1|2554864_2555401_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76217.1|2555574_2556105_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	60.4	3.0e-54
AVF76218.1|2556232_2557249_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.6	8.6e-74
>prophage 191
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2562430	2565771	3418310		Planktothrix_phage(50.0%)	4	NA	NA
AVF76223.1|2562430_2563135_+	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	4.0e-22
AVF76224.1|2563153_2564101_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF76225.1|2564193_2565270_+	alkene reductase	NA	NA	NA	NA	NA
AVF76226.1|2565333_2565771_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	31.3	3.5e-08
>prophage 192
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2572225	2573227	3418310		Indivirus(100.0%)	1	NA	NA
AVF76232.1|2572225_2573227_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	8.6e-10
>prophage 193
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2576911	2578273	3418310		Vibrio_phage(50.0%)	2	NA	NA
AVF76238.1|2576911_2577394_+	type 3 dihydrofolate reductase	NA	A0A1Q2U372	Vibrio_phage	44.5	4.5e-33
AVF76239.1|2577466_2578273_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YRJ8	Escherichia_phage	41.2	1.6e-06
>prophage 194
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2596124	2600107	3418310		Catovirus(50.0%)	2	NA	NA
AVF76255.1|2596124_2597933_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.8	3.0e-45
AVF76256.1|2598382_2600107_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	31.2	4.9e-61
>prophage 195
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2606210	2608043	3418310		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVF76262.1|2606210_2608043_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	45.0	6.2e-131
>prophage 196
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2615900	2622518	3418310		Klosneuvirus(50.0%)	3	NA	NA
AVF76267.1|2615900_2617694_+	N-6 DNA methylase	NA	A0A1V0SLK8	Klosneuvirus	29.5	2.2e-24
AVF76268.1|2617690_2618866_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVF76269.1|2618900_2622518_+	restriction endonuclease subunit R	NA	Q6NDX2	Leptospira_phage	23.8	8.8e-12
>prophage 197
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2643724	2645092	3418310	integrase	Klebsiella_phage(100.0%)	1	2629495:2629510	2651793:2651808
2629495:2629510	attL	AGTTATGTGCAAAAAC	NA	NA	NA	NA
AVF76283.1|2643724_2645092_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.9	2.4e-39
AVF76283.1|2643724_2645092_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.9	2.4e-39
2651793:2651808	attR	GTTTTTGCACATAACT	NA	NA	NA	NA
>prophage 198
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2648972	2654138	3418310		Morganella_phage(33.33%)	7	NA	NA
AVF76285.1|2648972_2649185_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.7	2.1e-19
AVF76286.1|2649304_2649505_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76287.1|2649725_2649911_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76288.1|2650887_2651097_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.3	2.4e-15
AVF76289.1|2651525_2652137_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76290.1|2652199_2653519_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AVF76291.1|2653586_2654138_-	hypothetical protein	NA	A0A2I7RAA0	Vibrio_phage	51.2	6.8e-49
>prophage 199
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2659600	2661247	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF76296.1|2659600_2661247_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.6	8.0e-13
>prophage 200
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2666318	2672130	3418310	tRNA	Vibrio_phage(25.0%)	5	NA	NA
AVF76302.1|2666318_2668181_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	4.2e-34
AVF76303.1|2668280_2670047_-	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	29.4	1.3e-45
AVF76304.1|2670196_2670640_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.0	3.9e-23
AVF76305.1|2670667_2670883_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVF77046.1|2671113_2672130_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	4.8e-109
>prophage 201
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2675727	2678703	3418310		Sinorhizobium_phage(50.0%)	2	NA	NA
AVF76311.1|2675727_2676948_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.0	5.1e-89
AVF76312.1|2677086_2678703_+	general secretion pathway protein GspA	NA	Q6QIE1	Burkholderia_phage	30.4	3.7e-10
>prophage 202
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2682270	2688264	3418310		Ostreococcus_lucimarinus_virus(33.33%)	5	NA	NA
AVF76316.1|2682270_2683530_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	36.9	7.6e-64
AVF76317.1|2683661_2684348_-	TIGR00153 family protein	NA	NA	NA	NA	NA
AVF76318.1|2684554_2686087_+	inorganic triphosphatase	NA	NA	NA	NA	NA
AVF76319.1|2686128_2686902_-	ion transporter	NA	R9TGG8	Vibrio_phage	31.2	7.3e-09
AVF76320.1|2687007_2688264_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.0	5.9e-24
>prophage 203
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2691288	2692719	3418310		Synechococcus_phage(100.0%)	1	NA	NA
AVF76322.1|2691288_2692719_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	E3SJ88	Synechococcus_phage	40.8	1.6e-17
>prophage 204
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2697295	2704125	3418310		Bacillus_virus(50.0%)	4	NA	NA
AVF76328.1|2697295_2699176_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.8	4.2e-98
AVF76329.1|2699179_2701465_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.8	8.9e-87
AVF76330.1|2701502_2702567_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	32.9	8.3e-11
AVF76331.1|2702757_2704125_-	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.3	5.8e-09
>prophage 205
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2711167	2716107	3418310	protease	Pseudomonas_phage(33.33%)	6	NA	NA
AVF76342.1|2711167_2711653_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	43.9	3.2e-26
AVF76343.1|2711724_2712393_-	BON domain-containing protein	NA	NA	NA	NA	NA
AVF76344.1|2712414_2713005_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	33.3	3.7e-13
AVF76345.1|2713008_2713377_-	YraN family protein	NA	NA	NA	NA	NA
AVF76346.1|2713363_2715175_-	YraN family protein	NA	NA	NA	NA	NA
AVF76347.1|2715243_2716107_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.6	4.4e-55
>prophage 206
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2739216	2740356	3418310		Halovirus(100.0%)	1	NA	NA
AVF76367.1|2739216_2740356_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	4.5e-47
>prophage 207
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2766606	2768961	3418310		Hokovirus(100.0%)	1	NA	NA
AVF76383.1|2766606_2768961_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	28.9	1.4e-39
>prophage 208
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2778230	2780789	3418310		Aeromonas_phage(33.33%)	4	NA	NA
AVF76393.1|2778230_2778608_-	autonomous glycyl radical cofactor GrcA	NA	A0A219YAN3	Aeromonas_phage	55.2	4.8e-30
AVF76394.1|2778934_2779819_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.3	2.1e-31
AVF76395.1|2779898_2780015_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76396.1|2780108_2780789_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	45.2	2.3e-51
>prophage 209
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2785027	2786251	3418310		Klosneuvirus(100.0%)	1	NA	NA
AVF76401.1|2785027_2786251_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	35.3	3.1e-54
>prophage 210
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2789480	2795853	3418310	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
AVF76405.1|2789480_2790398_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.7	1.2e-34
AVF76406.1|2790457_2791246_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVF76407.1|2791289_2793029_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	4.7e-64
AVF76408.1|2793202_2794300_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	41.4	2.4e-05
AVF76409.1|2794335_2795853_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.8	2.3e-86
>prophage 211
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2801681	2806496	3418310		Hokovirus(50.0%)	4	NA	NA
AVF76416.1|2801681_2803928_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	29.8	1.2e-14
AVF76417.1|2803934_2804726_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVF76418.1|2804813_2805635_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVF76419.1|2805644_2806496_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	84.5	5.0e-144
>prophage 212
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2814378	2822375	3418310	tRNA	Klosneuvirus(33.33%)	7	NA	NA
AVF76427.1|2814378_2817207_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.6	8.2e-82
AVF76428.1|2817280_2817787_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AVF76429.1|2817931_2818363_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVF77050.1|2818399_2819353_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AVF76430.1|2819399_2819870_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
AVF76431.1|2819944_2820673_-	two-component system response regulator YehT	NA	W8CYM9	Bacillus_phage	31.5	3.6e-05
AVF76432.1|2820704_2822375_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	57.2	1.5e-168
>prophage 213
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2828482	2836395	3418310		Klebsiella_phage(25.0%)	6	NA	NA
AVF76439.1|2828482_2829559_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.8	6.7e-85
AVF76440.1|2829580_2830708_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVF76441.1|2830785_2831787_-	peptidase M23	NA	A0A1B0XUH3	Freshwater_phage	43.0	1.3e-13
AVF76442.1|2831826_2832186_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AVF76443.1|2832416_2834084_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.3	2.3e-39
AVF76444.1|2834448_2836395_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	40.4	3.5e-15
>prophage 214
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2839458	2846379	3418310		Bacillus_phage(50.0%)	5	NA	NA
AVF76449.1|2839458_2840946_-	lytic transglycosylase F	NA	U5PVY0	Bacillus_phage	39.0	4.4e-10
AVF76450.1|2841088_2841817_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVF76451.1|2841953_2842931_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVF76452.1|2842932_2843661_+	multi-copper polyphenol oxidoreductase	NA	NA	NA	NA	NA
AVF76453.1|2843805_2846379_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.0	4.0e-128
>prophage 215
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2854940	2859674	3418310		Bacillus_phage(50.0%)	4	NA	NA
AVF76459.1|2854940_2856341_-	U32 family peptidase	NA	Q6DW11	Phage_TP	75.9	1.2e-163
AVF76460.1|2856506_2857421_-	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	69.2	8.4e-121
AVF76461.1|2857645_2858335_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.6	1.4e-35
AVF76462.1|2858375_2859674_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	28.2	3.2e-25
>prophage 216
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2868365	2869184	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF76468.1|2868365_2869184_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	5.6e-15
>prophage 217
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2878120	2885239	3418310	tRNA,protease	uncultured_Mediterranean_phage(75.0%)	6	NA	NA
AVF76475.1|2878120_2879287_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.8	1.3e-12
AVF76476.1|2879555_2880608_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVF76477.1|2880755_2881892_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.8	5.1e-91
AVF76478.1|2882069_2882399_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.9	1.5e-11
AVF76479.1|2882420_2884277_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVF76480.1|2884291_2885239_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.8	5.8e-56
>prophage 218
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2890011	2895807	3418310		uncultured_virus(20.0%)	8	NA	NA
AVF76487.1|2890011_2890395_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.0e-53
AVF76488.1|2890465_2890789_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	8.9e-25
AVF76489.1|2890844_2891360_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVF76490.1|2891381_2893235_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	6.7e-109
AVF76491.1|2893248_2893587_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVF76492.1|2893631_2893826_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVF76493.1|2893987_2895286_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.6	8.5e-34
AVF76494.1|2895381_2895807_+	nucleoside-diphosphate kinase	NA	A0A2P1ELL9	Moumouvirus	41.4	1.3e-20
>prophage 219
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2906175	2909205	3418310		Bodo_saltans_virus(50.0%)	2	NA	NA
AVF76503.1|2906175_2907507_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.1	7.9e-35
AVF76504.1|2907738_2909205_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.4	2.0e-95
>prophage 220
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2919585	2922394	3418310		Pandoravirus(50.0%)	2	NA	NA
AVF76512.1|2919585_2920854_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	23.8	4.4e-11
AVF76513.1|2921062_2922394_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	2.8e-24
>prophage 221
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2925638	2930399	3418310		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
AVF76517.1|2925638_2927174_-	GNAT family N-acetyltransferase	NA	M1I1L7	Acanthocystis_turfacea_Chlorella_virus	27.5	6.8e-06
AVF76518.1|2927294_2928176_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF76519.1|2928574_2929138_+	porin family protein	NA	NA	NA	NA	NA
AVF76520.1|2929259_2930399_-	lipase family protein	NA	A0A2P0VP29	Tetraselmis_virus	34.7	2.9e-09
>prophage 222
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2934092	2934872	3418310		Escherichia_phage(100.0%)	1	NA	NA
AVF76523.1|2934092_2934872_-	serine/threonine protein phosphatase	NA	A0A1C3S6W5	Escherichia_phage	28.1	1.4e-15
>prophage 223
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2938623	2948552	3418310	integrase	Bacillus_virus(20.0%)	9	2943701:2943719	2953669:2953687
AVF76526.1|2938623_2940627_-	hypothetical protein	NA	G3MA91	Bacillus_virus	30.4	5.2e-14
AVF76527.1|2940634_2941309_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76528.1|2941305_2941941_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76529.1|2942708_2943164_+	hypothetical protein	NA	U5P429	Shigella_phage	30.8	4.0e-07
AVF76530.1|2943183_2943357_+	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	42.1	4.9e-06
2943701:2943719	attL	GCGAGAACACTGTTCTCGC	NA	NA	NA	NA
AVF76531.1|2944071_2945478_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.9e-16
AVF76532.1|2945727_2946330_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVF76533.1|2946375_2947080_+	hypothetical protein	NA	NA	NA	NA	NA
AVF76534.1|2947955_2948552_+|integrase	integrase	integrase	A0A090C6M9	Clostridium_phage	31.3	1.3e-05
2953669:2953687	attR	GCGAGAACAGTGTTCTCGC	NA	NA	NA	NA
>prophage 224
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2951914	2955208	3418310	transposase	Vibrio_phage(100.0%)	2	NA	NA
AVF76539.1|2951914_2952223_-	hypothetical protein	NA	A0A2I7RHG8	Vibrio_phage	45.8	4.8e-20
AVF76540.1|2954287_2955208_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	5.6e-173
>prophage 225
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2961279	2970000	3418310		Liberibacter_phage(66.67%)	5	NA	NA
AVF77056.1|2961279_2961870_+	resolvase	NA	A0A219Y9V9	Aeromonas_phage	34.8	2.3e-18
AVF76547.1|2962859_2963561_-	M48 family peptidase	NA	NA	NA	NA	NA
AVF76548.1|2963592_2966964_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	3.7e-65
AVF76549.1|2967065_2968337_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVF76550.1|2968338_2970000_-	type I restriction endonuclease subunit M	NA	A0A220A2U4	Liberibacter_phage	36.9	6.3e-90
>prophage 226
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2976542	2978872	3418310	integrase	Vibrio_phage(50.0%)	2	2973114:2973127	2985328:2985341
2973114:2973127	attL	TCTTCTGTAACTTT	NA	NA	NA	NA
AVF76556.1|2976542_2977769_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	44.3	4.2e-99
AVF76557.1|2978386_2978872_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.4	1.3e-24
2985328:2985341	attR	AAAGTTACAGAAGA	NA	NA	NA	NA
>prophage 227
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2987945	2991212	3418310		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVF76566.1|2987945_2989859_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.2	2.1e-145
AVF76567.1|2990063_2991212_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.8	6.4e-25
>prophage 228
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	2999694	3003588	3418310		Burkholderia_phage(100.0%)	1	NA	NA
AVF76577.1|2999694_3003588_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.3e-125
>prophage 229
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3011790	3022558	3418310		Staphylococcus_phage(42.86%)	11	NA	NA
AVF76584.1|3011790_3013080_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.1	3.5e-72
AVF76585.1|3013344_3013809_+	oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34)	NA	NA	NA	NA	NA
AVF76586.1|3013900_3015148_+	esterase FrsA	NA	NA	NA	NA	NA
AVF76587.1|3015263_3015653_+	Crl family RNA polymerase assembly factor	NA	NA	NA	NA	NA
AVF76588.1|3015774_3016914_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	4.5e-63
AVF76589.1|3016931_3018182_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	4.3e-99
AVF76590.1|3018388_3018838_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVF76591.1|3018845_3019973_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	1.2e-44
AVF76592.1|3019981_3020635_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.6	3.1e-32
AVF76593.1|3020808_3021918_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	1.0e-64
AVF76594.1|3022087_3022558_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	1.7e-32
>prophage 230
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3041634	3042480	3418310		Vibrio_phage(100.0%)	1	NA	NA
AVF76612.1|3041634_3042480_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	40.3	7.7e-44
>prophage 231
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3045548	3046583	3418310		Planktothrix_phage(100.0%)	1	NA	NA
AVF76617.1|3045548_3046583_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	5.2e-34
>prophage 232
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3055563	3061526	3418310		Aeromonas_phage(33.33%)	6	NA	NA
AVF76625.1|3055563_3056814_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.8	3.1e-97
AVF76626.1|3057233_3058199_-	lipoyl synthase	NA	NA	NA	NA	NA
AVF76627.1|3058195_3058858_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AVF76628.1|3059034_3059313_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76629.1|3059452_3060631_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.6	8.1e-92
AVF76630.1|3060722_3061526_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	54.4	3.1e-18
>prophage 233
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3067193	3069767	3418310	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVF76637.1|3067193_3069767_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.9	4.8e-190
>prophage 234
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3073498	3074596	3418310		Erwinia_phage(100.0%)	1	NA	NA
AVF76642.1|3073498_3074596_-	PhoH family protein	NA	W8D063	Erwinia_phage	46.9	5.7e-47
>prophage 235
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3082213	3083158	3418310		Tupanvirus(100.0%)	1	NA	NA
AVF76647.1|3082213_3083158_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.9	1.5e-43
>prophage 236
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3089352	3090204	3418310		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AVF76655.1|3089352_3090204_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.1	3.4e-47
>prophage 237
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3101598	3104295	3418310		uncultured_virus(100.0%)	1	NA	NA
AVF76666.1|3101598_3104295_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	1.3e-100
>prophage 238
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3115168	3116095	3418310		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVF76678.1|3115168_3116095_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.6	1.1e-32
>prophage 239
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3123972	3124899	3418310		Sulfitobacter_phage(100.0%)	1	NA	NA
AVF76688.1|3123972_3124899_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	36.4	6.7e-17
>prophage 240
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3133397	3141008	3418310		Hokovirus(33.33%)	7	NA	NA
AVF76695.1|3133397_3135122_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.4	1.1e-15
AVF76696.1|3135262_3135520_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVF76697.1|3135634_3135817_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76698.1|3135820_3136789_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	51.6	1.0e-68
AVF77060.1|3136953_3137697_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVF76699.1|3137948_3138905_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVF76700.1|3138995_3141008_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.6	5.5e-141
>prophage 241
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3154742	3162794	3418310		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AVF76718.1|3154742_3156647_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.1	1.8e-109
AVF76719.1|3156967_3157612_+	adenylate kinase	NA	NA	NA	NA	NA
AVF76720.1|3157779_3158742_+	ferrochelatase	NA	NA	NA	NA	NA
AVF76721.1|3158791_3160180_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.9	2.4e-66
AVF76722.1|3160513_3161014_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
AVF76723.1|3161129_3162794_-	asparagine synthase B	NA	A0A1X9VNR2	Mimivirus	41.5	6.3e-90
>prophage 242
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3169308	3174091	3418310	tRNA	Escherichia_phage(50.0%)	6	NA	NA
AVF76728.1|3169308_3170979_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	82.5	7.5e-277
AVF76729.1|3171201_3171651_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AVF76730.1|3171851_3172355_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AVF76731.1|3172407_3172941_-	flavodoxin FldA	NA	NA	NA	NA	NA
AVF76732.1|3172989_3173211_-	DUF2788 domain-containing protein	NA	NA	NA	NA	NA
AVF76733.1|3173323_3174091_-	histidine kinase	NA	A0A2P1N4Q7	Mycobacterium_phage	26.7	2.0e-06
>prophage 243
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3190672	3191461	3418310		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVF76748.1|3190672_3191461_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.1	3.7e-16
>prophage 244
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3200904	3211117	3418310	tRNA	Tupanvirus(25.0%)	10	NA	NA
AVF76756.1|3200904_3202638_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.2	2.8e-85
AVF76757.1|3202767_3202857_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76758.1|3202858_3203455_+	VOC family protein	NA	NA	NA	NA	NA
AVF76759.1|3203769_3204603_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	31.2	4.8e-14
AVF76760.1|3204821_3206762_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.4	1.9e-90
AVF76761.1|3206791_3207493_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVF76762.1|3207553_3207859_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
AVF76763.1|3207900_3208458_+	starvation-inducible protein	NA	NA	NA	NA	NA
AVF76764.1|3208464_3209319_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVF76765.1|3209425_3211117_+	long-chain-fatty-acid--CoA ligase FadD	NA	Q75ZG1	Hepacivirus	25.1	4.2e-41
>prophage 245
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3218206	3221478	3418310		Enterococcus_phage(50.0%)	3	NA	NA
AVF76773.1|3218206_3219067_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.0	9.6e-34
AVF76774.1|3219532_3220756_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
AVF76775.1|3220752_3221478_-	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.8	2.1e-10
>prophage 246
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3227127	3228681	3418310		Catovirus(100.0%)	1	NA	NA
AVF76782.1|3227127_3228681_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	30.4	7.7e-58
>prophage 247
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3237778	3239827	3418310		Pseudomonas_phage(50.0%)	2	NA	NA
AVF76793.1|3237778_3238519_+	transglycosylase	NA	A0A2H4GYF1	Pseudomonas_phage	53.0	9.7e-43
AVF76794.1|3238618_3239827_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	6.0e-58
>prophage 248
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3246610	3248080	3418310		Microcystis_phage(100.0%)	1	NA	NA
AVF76798.1|3246610_3248080_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.2	2.4e-56
>prophage 249
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3256782	3261706	3418310	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AVF76805.1|3256782_3257409_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.9	1.4e-63
AVF76806.1|3257479_3258760_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.6	2.5e-131
AVF76807.1|3258890_3261242_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	6.3e-221
AVF76808.1|3261433_3261706_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	60.2	2.2e-21
>prophage 250
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3274820	3276248	3418310		Staphylococcus_phage(100.0%)	1	NA	NA
AVF76821.1|3274820_3276248_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	1.2e-25
>prophage 251
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3297050	3307928	3418310		Bacillus_phage(33.33%)	7	NA	NA
AVF76838.1|3297050_3299054_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.2	1.0e-14
AVF76839.1|3299501_3300236_+	RNA methyltransferase	NA	NA	NA	NA	NA
AVF76840.1|3300483_3300903_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AVF76841.1|3301075_3303382_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	1.4e-127
AVF76842.1|3303696_3304455_+	uridine phosphorylase	NA	NA	NA	NA	NA
AVF76843.1|3304612_3305773_-	DUF1887 domain-containing protein	NA	NA	NA	NA	NA
AVF76844.1|3305936_3307928_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	6.5e-25
>prophage 252
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3321458	3328115	3418310		Planktothrix_phage(33.33%)	5	NA	NA
AVF76857.1|3321458_3322166_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	6.2e-39
AVF76858.1|3322168_3323413_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVF76859.1|3323561_3324071_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AVF76860.1|3324079_3326335_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	24.8	5.6e-17
AVF76861.1|3326366_3328115_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.2	7.6e-62
>prophage 253
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3331694	3332966	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF76866.1|3331694_3332966_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	38.1	2.9e-10
>prophage 254
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3336898	3341261	3418310		Tetraselmis_virus(100.0%)	3	NA	NA
AVF76870.1|3336898_3337639_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	32.9	4.0e-28
AVF76871.1|3337850_3338840_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AVF76872.1|3338984_3341261_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.4	2.4e-161
>prophage 255
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3345306	3346077	3418310		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVF76875.1|3345306_3346077_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	2.0e-14
>prophage 256
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3351405	3355889	3418310		Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
AVF76880.1|3351405_3352212_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	25.6	1.9e-12
AVF76881.1|3352307_3352472_-	primosomal protein	NA	NA	NA	NA	NA
AVF76882.1|3352471_3353017_-	prepilin peptidase	NA	NA	NA	NA	NA
AVF76883.1|3353013_3353799_-	hypothetical protein	NA	NA	NA	NA	NA
AVF76884.1|3353813_3355889_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.5e-45
>prophage 257
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3361747	3365309	3418310	protease	Lake_Baikal_phage(33.33%)	3	NA	NA
AVF76889.1|3361747_3361966_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	9.5e-15
AVF76890.1|3362670_3362991_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.1e-14
AVF76891.1|3363041_3365309_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
>prophage 258
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3369981	3374425	3418310		Tupanvirus(50.0%)	2	NA	NA
AVF76898.1|3369981_3372612_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	33.9	1.3e-84
AVF76899.1|3373207_3374425_+	glucose-1-phosphate adenylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	29.9	1.5e-08
>prophage 259
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3381429	3382140	3418310		Bacillus_phage(100.0%)	1	NA	NA
AVF76907.1|3381429_3382140_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	32.6	3.3e-24
>prophage 260
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3397475	3402726	3418310	tRNA	Tupanvirus(33.33%)	5	NA	NA
AVF76919.1|3397475_3399254_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.7	1.4e-10
AVF76920.1|3399395_3400142_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF76921.1|3400234_3400756_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	25.8	6.5e-09
AVF76922.1|3400823_3401435_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVF77068.1|3401721_3402726_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	2.1e-08
>prophage 261
CP014053	Vibrio alginolyticus strain ARGOS_108 chromosome 1, complete sequence	3418310	3415316	3416483	3418310		Ralstonia_phage(100.0%)	1	NA	NA
AVF76938.1|3415316_3416483_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	42.9	6.8e-83

>prophage 1
CP014052	Vibrio alginolyticus strain ARGOS_108 plasmid unnamed1, complete sequence	217123	4971	62771	217123	integrase,transposase	Staphylococcus_phage(21.43%)	58	17880:17900	66466:66486
AVF73795.1|4971_5733_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.8	1.5e-14
AVF73796.1|6295_7000_-	disulfide isomerase	NA	NA	NA	NA	NA
AVF73797.1|7155_12672_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73798.1|12879_13254_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AVF73799.1|13348_13723_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AVF73800.1|13737_14286_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AVF73801.1|14285_15635_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AVF73802.1|15638_16586_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AVF73803.1|16575_17205_-	pilus assembly protein	NA	NA	NA	NA	NA
AVF73804.1|17201_17483_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
17880:17900	attL	AGACTTTCACATGTGAAAGTG	NA	NA	NA	NA
AVF73805.1|17952_18354_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73806.1|18370_19000_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVF73807.1|18956_19541_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73808.1|19550_21419_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVF73809.1|21425_24500_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVF73810.1|24663_24903_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73811.1|24895_25684_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73812.1|25665_25968_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73813.1|25968_28176_+	DNA topoisomerase 3	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	23.1	5.9e-19
AVF73814.1|28892_29084_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73815.1|29046_29964_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	88.4	7.3e-157
AVF74016.1|30023_30329_+	restriction endonuclease subunit R	NA	Q71TG1	Escherichia_phage	74.7	4.1e-32
AVF73816.1|30728_31343_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73817.1|31352_31946_-	hypothetical protein	NA	A0A2I7QSF1	Vibrio_phage	38.0	1.2e-22
AVF73818.1|31942_33904_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73819.1|33965_34199_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73820.1|34258_34735_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73821.1|34731_34953_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73822.1|34949_35153_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73823.1|35166_35460_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73824.1|35478_35760_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73825.1|35930_37080_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.2	4.0e-51
AVF73826.1|37914_39498_+	lactate permease	NA	NA	NA	NA	NA
AVF73827.1|39595_40315_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73828.1|40328_41744_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AVF73829.1|41755_42511_+	lactate utilization protein C	NA	NA	NA	NA	NA
AVF73830.1|42707_43610_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF73831.1|43799_44207_+	hypothetical protein	NA	NA	NA	NA	NA
AVF73832.1|44507_45455_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.1e-41
AVF73833.1|45526_46114_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73834.1|46178_47328_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.2	4.7e-52
AVF73835.1|47356_47725_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73836.1|47714_48071_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73837.1|48067_48313_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73838.1|48309_48741_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73839.1|49045_49348_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73840.1|49365_49641_-	RNA-binding protein	NA	I6S5Y4	Salmonella_phage	55.6	1.6e-19
AVF73841.1|49781_50054_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73842.1|50066_51257_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AVF73843.1|51258_52041_-	ParA family protein	NA	E9LUK9	Lactobacillus_phage	27.5	6.7e-10
AVF73844.1|52824_53601_-	M48 family peptidase	NA	NA	NA	NA	NA
AVF73845.1|53600_56879_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	27.3	3.5e-60
AVF73846.1|56929_57787_-	hypothetical protein	NA	NA	NA	NA	NA
AVF73847.1|57866_59102_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	38.0	9.9e-24
AVF73848.1|59091_60609_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.8	2.9e-86
AVF73849.1|60629_61583_-	pyrophosphatase	NA	NA	NA	NA	NA
AVF73850.1|61584_61989_-	S-adenosylhomocysteine hydrolase	NA	NA	NA	NA	NA
AVF73851.1|62177_62771_-|integrase	integrase	integrase	A3F636	Streptococcus_phage	29.6	1.3e-10
66466:66486	attR	CACTTTCACATGTGAAAGTCT	NA	NA	NA	NA
