The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1707570	1717012	4840855		Enterobacteria_phage(85.71%)	9	NA	NA
AUY28730.1|1707570_1708497_+	osmoprotectant transport system ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUY28731.1|1708501_1709233_+	osmoprotectant transport system permease protein	NA	NA	NA	NA	NA
AUY28732.1|1709380_1710112_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUY28733.1|1710333_1712019_+	Histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUY28734.1|1712015_1712735_+	Transcriptional regulatory protein YehT	NA	NA	NA	NA	NA
AUY28735.1|1712781_1713252_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUY28736.1|1713292_1713754_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUY28737.1|1713878_1715879_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AUY28738.1|1715875_1717012_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 2
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1817369	1825889	4840855		Acanthocystis_turfacea_Chlorella_virus(16.67%)	8	NA	NA
AUY28821.1|1817369_1818488_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	65.5	8.7e-136
AUY28822.1|1818491_1819457_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.8	4.9e-87
AUY28823.1|1819459_1819921_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AUY28824.1|1819926_1821333_+	bifunctional Mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.6e-49
AUY28825.1|1821332_1822079_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	39.3	1.6e-08
AUY28826.1|1822084_1823509_+	phosphomannomutase	NA	NA	NA	NA	NA
AUY28827.1|1823606_1823882_+	Insertion element IS1 protein	NA	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUY28828.1|1824482_1825889_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 3
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1843455	1852769	4840855	integrase,transposase,terminase	Enterobacteria_phage(76.92%)	13	1841635:1841648	1851256:1851269
1841635:1841648	attL	TACTGCTGCGCCAG	NA	NA	NA	NA
AUY28847.1|1843455_1844352_+|integrase	Phage integrase family protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	1.9e-173
AUY28848.1|1844332_1844524_-	AlpA family transcriptional regulator	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AUY28849.1|1844628_1844808_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
AUY28850.1|1844820_1845402_+	Serine/threonine-protein phosphatase	NA	K7P721	Enterobacteria_phage	99.0	7.7e-112
AUY28851.1|1845398_1846022_+	Antitermination Q	NA	K7PM87	Enterobacteria_phage	99.0	2.0e-113
AUY28852.1|1846455_1846779_+	Holin	NA	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUY28853.1|1846762_1847239_+	Lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AUY28854.1|1847235_1847673_+	Phage endopeptidase	NA	K7P710	Enterobacteria_phage	95.9	1.4e-68
AUY28855.1|1847709_1847985_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	100.0	2.7e-46
AUY28856.1|1848268_1848637_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	97.6	1.5e-60
AUY28857.1|1848740_1848983_+	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AUY28858.1|1848985_1849426_+|terminase	Phage terminase small subunit	terminase	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
AUY28859.1|1851746_1852769_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
1851256:1851269	attR	CTGGCGCAGCAGTA	NA	NA	NA	NA
>prophage 4
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	2352051	2366154	4840855	integrase	Escherichia_phage(22.22%)	14	2349755:2349768	2362120:2362133
2349755:2349768	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
AUY29303.1|2352051_2354478_-	Anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AUY29304.1|2354676_2354982_-	hypothetical protein	NA	NA	NA	NA	NA
AUY29305.1|2355053_2355800_+	lipoprotein	NA	NA	NA	NA	NA
AUY29306.1|2355802_2356363_-	diamine N-acetyltransferase	NA	NA	NA	NA	NA
AUY29307.1|2356397_2356739_-	hypothetical protein	NA	NA	NA	NA	NA
AUY29308.1|2356873_2357200_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUY29309.1|2357405_2358620_+	mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUY29310.1|2358631_2359651_+	mannonate dehydratase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AUY29311.1|2359838_2361119_-|integrase	Phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
AUY29312.1|2361153_2361390_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AUY29313.1|2361477_2363949_-	Exonuclease VIII	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
2362120:2362133	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
AUY29314.1|2364042_2364234_-	hypothetical protein	NA	NA	NA	NA	NA
AUY29315.1|2364725_2365691_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
AUY29316.1|2365731_2366154_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
>prophage 5
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	2777237	2788015	4840855		Enterobacteria_phage(36.36%)	12	NA	NA
AUY29681.1|2777237_2779193_-	5-methylcytosine-specific restriction enzyme B	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
AUY29682.1|2780982_2781471_-	Phage replication protein O family protein	NA	A0A0M5M7Y1	Salmonella_phage	50.0	2.6e-36
AUY29683.1|2781557_2782097_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AUY29684.1|2782285_2782591_+	hypothetical protein	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.3e-43
AUY29685.1|2782587_2783268_+	Exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AUY29686.1|2783264_2783423_+	hypothetical protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AUY29687.1|2783419_2784484_+	DGQHR domain protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AUY29688.1|2784637_2784856_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AUY29689.1|2784903_2785143_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AUY29690.1|2785282_2785519_+	Excisionase	NA	NA	NA	NA	NA
AUY29691.1|2785508_2786651_+	Integrase	NA	O21929	Phage_21	99.7	8.1e-206
AUY29692.1|2786764_2788015_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 6
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	3175154	3183924	4840855		Salmonella_phage(88.89%)	12	NA	NA
AUY30025.1|3175154_3175520_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.9e-24
AUY30026.1|3175501_3177895_-	Bacteriophage replication A family protein	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AUY30027.1|3177891_3178749_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AUY30028.1|3178745_3178973_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AUY30029.1|3178972_3179206_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AUY30030.1|3179273_3179615_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AUY30031.1|3179637_3179862_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30032.1|3180036_3180546_-	Phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AUY30033.1|3180578_3180800_-	Putative phage regulatory protein	NA	NA	NA	NA	NA
AUY30034.1|3180888_3181824_+	Bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.8e-30
AUY30035.1|3181835_3182780_+	hypothetical protein	NA	NA	NA	NA	NA
AUY30036.1|3182871_3183924_+	Phage intergrase	NA	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
>prophage 7
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	3266076	3289404	4840855	lysis	Enterobacteria_phage(50.0%)	40	NA	NA
AUY30111.1|3266076_3267408_+	Diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AUY30112.1|3267819_3268476_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AUY30113.1|3269366_3269927_-	Terminase small subunit	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AUY30114.1|3270605_3271016_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AUY30115.1|3271061_3271226_+	hypothetical protein	NA	NA	NA	NA	NA
AUY30116.1|3271367_3271520_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AUY30117.1|3271507_3271987_-	prophage endopeptidase	NA	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AUY30118.1|3271971_3272469_-	Lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AUY30119.1|3272468_3272684_-|lysis	Phage lysis protein	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AUY30120.1|3272871_3273459_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30121.1|3273467_3273602_-	araC-type regulatory protein	NA	NA	NA	NA	NA
AUY30122.1|3273755_3273917_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30123.1|3273953_3274913_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30124.1|3275105_3275630_+	apolipoprotein D and lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AUY30125.1|3275785_3276163_-	Antitermination protein Q-like protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AUY30126.1|3276248_3276386_-	Phage protein	NA	K7PHH3	Enterobacteria_phage	68.3	9.2e-08
AUY30127.1|3276385_3276748_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AUY30128.1|3276744_3277035_-	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AUY30129.1|3277027_3277198_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AUY30130.1|3277197_3277653_-	Putative DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AUY30131.1|3277843_3278296_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30132.1|3278292_3278853_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30133.1|3279109_3279301_+	hypothetical protein	NA	NA	NA	NA	NA
AUY30134.1|3279337_3279631_-	Protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AUY30135.1|3279627_3280329_-	Replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AUY30136.1|3280325_3281330_-	Phage replication protein O domain	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.6e-109
AUY30137.1|3281341_3281881_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AUY30138.1|3281950_3282181_-	Antirepressor	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AUY30139.1|3282219_3282975_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AUY30140.1|3283097_3283847_+	hypothetical protein	NA	NA	NA	NA	NA
AUY30141.1|3283843_3284671_+	hypothetical protein	NA	NA	NA	NA	NA
AUY30142.1|3285179_3285386_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUY30143.1|3285461_3285758_+	Host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AUY30144.1|3285763_3286549_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUY30145.1|3286545_3287226_+	Exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AUY30146.1|3287222_3287405_+	hypothetical protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AUY30147.1|3287377_3287569_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AUY30148.1|3287645_3287861_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AUY30149.1|3288391_3288541_-	hypothetical protein	NA	NA	NA	NA	NA
AUY30150.1|3289236_3289404_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
>prophage 8
CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	4534062	4618632	4840855	tRNA,protease,tail,lysis	Escherichia_virus(20.0%)	76	NA	NA
AUY31198.1|4534062_4535163_+|tRNA	tRNA/tmRNA (uracil-C(5))-methyltransferase	tRNA	NA	NA	NA	NA
AUY31199.1|4535202_4535562_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31200.1|4535561_4536266_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUY31201.1|4536542_4537943_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AUY31202.1|4537925_4538843_-	R family transcriptional regulator	NA	NA	NA	NA	NA
AUY31203.1|4539094_4540378_-	MFS transporter	NA	NA	NA	NA	NA
AUY31204.1|4540444_4541659_-	mannonate dehydratase	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
AUY31205.1|4542155_4543529_-	Argininosuccinate lyase	NA	NA	NA	NA	NA
AUY31206.1|4543589_4544366_-	Acetylglutamate kinase	NA	NA	NA	NA	NA
AUY31207.1|4544373_4545378_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AUY31208.1|4545531_4546683_+	Acetylornithine deacetylase	NA	NA	NA	NA	NA
AUY31209.1|4547034_4549686_+	Phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUY31210.1|4549868_4551602_+	Phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AUY31211.1|4551750_4552602_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
AUY31212.1|4552588_4552930_-	PTS system, fructose-specific IIB-like component	NA	NA	NA	NA	NA
AUY31213.1|4552931_4553810_-	pyruvate formate lyase activating enzyme	NA	NA	NA	NA	NA
AUY31214.1|4553775_4556073_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AUY31215.1|4556123_4556444_-	PTS system, fructose-specific IIB-like component	NA	NA	NA	NA	NA
AUY31216.1|4556458_4557538_-	PTS system fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AUY31217.1|4557846_4560348_+	PTS fructose transporter subunit IIA	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AUY31218.1|4560359_4561022_+	Fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AUY31219.1|4561032_4562136_+	Glycerol dehydrogenase	NA	NA	NA	NA	NA
AUY31220.1|4562410_4563028_+	Putative amidase domain protein	NA	NA	NA	NA	NA
AUY31221.1|4563054_4563960_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31222.1|4564053_4566234_-	Catalase-peroxidase	NA	NA	NA	NA	NA
AUY31223.1|4566562_4567453_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUY31224.1|4567801_4570234_-	Bifunctional aspartokinase/homoserine dehydrogenase 2	NA	NA	NA	NA	NA
AUY31225.1|4570236_4571397_-	Cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUY31226.1|4572174_4572783_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31227.1|4572927_4573200_+	Insertion element iso-IS1N protein insA	NA	A0A0U2RK18	Escherichia_phage	81.0	1.8e-34
AUY31228.1|4573770_4574064_-	Insertion element IS1 8 protein insB	NA	U5P0U6	Shigella_phage	87.9	7.2e-42
AUY31229.1|4574789_4578962_-	Protein rhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.7e-25
AUY31230.1|4579121_4579334_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUY31231.1|4579536_4581735_+	Primosome assembly protein PriA	NA	NA	NA	NA	NA
AUY31232.1|4581890_4582916_+	HTH-type transcriptional repressor CytR	NA	NA	NA	NA	NA
AUY31233.1|4584059_4584590_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AUY31234.1|4584599_4585931_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AUY31235.1|4585997_4586924_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AUY31236.1|4587016_4587502_+	Regulator of ribonuclease activity A	NA	NA	NA	NA	NA
AUY31237.1|4587586_4587826_-	Cell division protein ZapB	NA	NA	NA	NA	NA
AUY31238.1|4588257_4589103_+	Glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AUY31239.1|4589125_4590634_+	Glycerol kinase	NA	NA	NA	NA	NA
AUY31240.1|4590637_4591777_+	Fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
AUY31241.1|4591873_4592620_+	Ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AUY31242.1|4592624_4593053_-	Universal stress protein D	NA	NA	NA	NA	NA
AUY31243.1|4593079_4593379_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31244.1|4593590_4594031_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31245.1|4594131_4594731_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31246.1|4594838_4595606_+	Triosephosphate isomerase	NA	NA	NA	NA	NA
AUY31247.1|4595660_4596416_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AUY31248.1|4596522_4597512_-	Periplasmic sulfate-binding protein	NA	NA	NA	NA	NA
AUY31249.1|4597831_4598794_-	ATP-dependent 6-phosphofructokinase isozyme 1	NA	NA	NA	NA	NA
AUY31250.1|4598974_4599877_-	Ferrous-iron efflux pump FieF	NA	NA	NA	NA	NA
AUY31251.1|4601579_4602479_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
AUY31252.1|4602694_4603222_-	Tail fiber assembly protein GpG	NA	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
AUY31253.1|4603223_4604225_-|tail	Phage tail fiber protein	tail	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
AUY31254.1|4604748_4605534_+	Putative phage protein	NA	NA	NA	NA	NA
AUY31255.1|4605605_4606058_-|tail	Putative tail protein	tail	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
AUY31256.1|4606050_4606518_-|tail	Phage tail completion protein GpR	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
AUY31257.1|4606480_4606639_-|lysis	Phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
AUY31258.1|4606625_4607051_-|lysis	Phage lysis timing protein LysB	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
AUY31259.1|4607038_4607440_-|lysis	Phage lysis protein LysA	lysis	Q858W1	Yersinia_virus	90.2	5.1e-54
AUY31260.1|4608753_4609827_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
AUY31261.1|4609831_4610857_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
AUY31262.1|4610853_4611792_-	Cytosine-specific methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
AUY31263.1|4612034_4612241_-	Phage protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
AUY31264.1|4612240_4612693_-	ASCH domain protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
AUY31265.1|4612692_4613226_-	hypothetical protein	NA	Q7Y4B8	Escherichia_virus	92.8	2.0e-69
AUY31266.1|4613289_4613790_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AUY31267.1|4613786_4613984_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
AUY31268.1|4613959_4614232_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AUY31269.1|4614384_4614678_+	Repressor	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AUY31270.1|4614747_4615728_+	Integrase	NA	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
AUY31271.1|4615913_4616414_-	Periplasmic protein CpxP	NA	NA	NA	NA	NA
AUY31272.1|4616563_4617262_+	two-component system, OmpR family, response regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUY31273.1|4617258_4618632_+	two-component system, OmpR family, sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
CP026474	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869A, complete sequence	107229	2056	52577	107229	integrase,transposase,protease	Escherichia_phage(38.1%)	45	43977:44036	54471:55786
AUY31458.1|2056_2710_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUY31459.1|2802_3060_+	Antitoxin PemI	NA	NA	NA	NA	NA
AUY31460.1|3061_3394_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31461.1|5938_6643_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31462.1|6741_7341_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AUY31463.1|7426_8302_+	OXA-1 family class D beta-lactamase	NA	NA	NA	NA	NA
AUY31464.1|8439_8988_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A1V0SJ47	Klosneuvirus	38.0	2.0e-08
AUY31465.1|8933_9638_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31466.1|9684_11700_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AUY31467.1|12338_13214_-	class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AUY31468.1|13595_14300_-	TnpA IS26 (1)	NA	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31469.1|14884_15745_+	beta-lactamase class A TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUY31470.1|15855_18363_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	70.8	0.0e+00
AUY31471.1|18365_18926_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AUY31472.1|19498_20140_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUY31473.1|20355_21027_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31474.1|22559_23411_+	Replication protein C	NA	NA	NA	NA	NA
AUY31475.1|23718_24534_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AUY31476.1|24594_25398_+	APH(3'') family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
AUY31477.1|25397_26234_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUY31478.1|26294_26999_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31479.1|27138_27903_+|transposase	IS6100 transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUY31480.1|28395_28980_-	macrolide 2'-phosphotransferase I repressor A	NA	NA	NA	NA	NA
AUY31481.1|28979_30218_-	MFS transporter	NA	NA	NA	NA	NA
AUY31482.1|30214_31129_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUY31483.1|31250_31955_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31484.1|31991_33119_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31485.1|33169_33397_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31486.1|34093_34636_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31487.1|34648_35509_-	aminoglycoside 3-N-acetyltransferase VI AAC(3)-Iia	NA	NA	NA	NA	NA
AUY31488.1|35651_36620_+|transposase	transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.5e-187
AUY31489.1|36723_37590_+|transposase	TnpA transposase of IS10	transposase	A4KWT9	Enterobacteria_phage	100.0	1.3e-163
AUY31490.1|38765_39626_+	beta-lactamase class A TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUY31491.1|39775_40201_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUY31492.1|40212_40917_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31493.1|41318_42332_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUY31494.1|43093_43882_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
43977:44036	attL	GCGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTT	NA	NA	NA	NA
AUY31495.1|44428_45268_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUY31496.1|45672_47214_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUY31497.1|47526_48558_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AUY31498.1|48568_49207_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AUY31499.1|49211_49472_-	bleomycin resistance protein	NA	NA	NA	NA	NA
AUY31500.1|49580_50393_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
AUY31501.1|50951_51656_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY31502.1|51689_52577_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
54471:55786	attR	GCGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAGATATATCATGAAAGGCTGGCTTTTTCTTGTTATCGCAATAGTTGGCGAAGTAATCGCAACATCCGCATTAAAATCTAGCGAGGGCTTTACTAAGCTTGCCCCTTCCGCCGTTGTCATAATCGGTTATGGCATCGCATTTTATTTTCTTTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGGCGTCGTCATAATTACAGCCATTGCCTGGTTGCTTCATGGGCAAAAGCTTGATGCGTGGGGCTTTGTAGGTATGGGGCTCATAATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGCCGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
>prophage 2
CP026474	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869A, complete sequence	107229	62148	75184	107229		Escherichia_phage(36.36%)	12	NA	NA
AUY31509.1|62148_62514_+	Transposase	NA	Q76S41	Shigella_phage	100.0	9.6e-60
AUY31510.1|62471_63377_+	Transposase	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
AUY31511.1|63843_64101_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31512.1|64619_65360_+	Site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUY31513.1|65644_66622_-	Protein RepA	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AUY31514.1|67754_68114_-	PdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AUY31515.1|68141_68321_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AUY31516.1|68325_68706_-	prevent-host-death family protein	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AUY31517.1|68705_68927_-	Antitoxin phd	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AUY31518.1|69109_70666_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AUY31519.1|70662_71946_+	type I restriction-modification system subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
AUY31520.1|72067_75184_+	type I restriction-modification system subunit R	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
>prophage 1
CP026475	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence	104701	839	32261	104701	tail,plate	Escherichia_phage(65.52%)	30	NA	NA
AUY31548.1|839_2858_-	DNA adenine methylase	NA	Q1MVI4	Enterobacteria_phage	95.2	0.0e+00
AUY31549.1|2854_3760_-	Recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AUY31550.1|3752_4037_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
AUY31551.1|4499_5288_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	7.3e-121
AUY31552.1|5327_5750_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AUY31553.1|5927_6320_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
AUY31554.1|6637_7498_+	Replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AUY31555.1|7410_7983_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31556.1|8055_9252_+	Chromosome partitioning protein ParA	NA	A0A077SL49	Escherichia_phage	99.7	1.1e-224
AUY31557.1|9268_10270_+	Chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AUY31558.1|10495_12202_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
AUY31559.1|12262_13852_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.2	2.4e-304
AUY31560.1|13861_14677_+	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	98.5	1.1e-111
AUY31561.1|15305_15815_+|plate	Baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AUY31562.1|15956_16583_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	99.5	4.0e-114
AUY31563.1|16918_18088_-	Transposase	NA	A0A077SLN2	Escherichia_phage	99.5	2.4e-205
AUY31564.1|18245_19055_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.9	3.3e-145
AUY31565.1|19120_19921_-	host killing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	3.5e-147
AUY31566.1|20085_21129_-	antirepressor	NA	Q71TN2	Escherichia_phage	97.7	1.9e-185
AUY31567.1|21125_21347_-	Cell division protein	NA	Q38557	Escherichia_phage	97.3	8.1e-38
AUY31568.1|21926_22244_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
AUY31569.1|22251_23031_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	2.7e-144
AUY31570.1|23240_23807_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	9.5e-99
AUY31571.1|23817_24429_+|tail	Major tail tube protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AUY31572.1|24443_25325_+	phage morphogenetic protein PmgB	NA	A0A1B0VBL3	Salmonella_phage	99.3	1.8e-173
AUY31573.1|25406_29126_+	Transglycosylase	NA	Q71TP0	Escherichia_phage	87.9	0.0e+00
AUY31574.1|29125_29482_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AUY31575.1|29478_30912_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
AUY31576.1|30911_31748_+	Tail tube protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
AUY31577.1|31826_32261_+	Tail fiber protein R	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
>prophage 2
CP026475	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence	104701	36661	103982	104701	tail,lysis,plate,head,terminase	Escherichia_phage(59.65%)	63	NA	NA
AUY31579.1|36661_36943_+	LydC	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
AUY31580.1|37010_37340_+	Holin	NA	Q37876	Escherichia_phage	100.0	1.3e-52
AUY31581.1|37336_37780_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AUY31582.1|37766_38369_+	OdaE	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
AUY31583.1|38370_40290_+	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
AUY31584.1|40286_40652_+	DdrA	NA	Q1MVM8	Enterobacteria_phage	96.7	1.5e-44
AUY31585.1|40664_43652_+	Putative ddrB	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
AUY31586.1|43641_43959_+	Repressor	NA	Q1MVN0	Enterobacteria_phage	86.7	1.9e-43
AUY31587.1|43989_44778_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.0	2.4e-140
AUY31588.1|44784_45462_-	hypothetical protein	NA	A0A1B0VBT1	Salmonella_phage	96.9	7.9e-124
AUY31589.1|45968_46790_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31590.1|47328_52092_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31591.1|52579_54613_-	Integrase	NA	NA	NA	NA	NA
AUY31592.1|54629_56168_-	hypothetical protein	NA	NA	NA	NA	NA
AUY31593.1|56154_57423_-	Integrase	NA	NA	NA	NA	NA
AUY31594.1|57560_58049_-	Single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	5.5e-87
AUY31595.1|58131_58776_+	Lysozyme	NA	A0A1B0V7G8	Salmonella_phage	99.1	4.4e-124
AUY31596.1|59067_60087_-|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	1.2e-184
AUY31597.1|60079_61789_-	hypothetical protein	NA	Q71TR7	Escherichia_phage	99.5	0.0e+00
AUY31598.1|61865_68633_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
AUY31599.1|68666_69107_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AUY31600.1|69103_69352_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AUY31601.1|69393_70698_-	hypothetical protein	NA	Q38324	Lactococcus_phage	30.4	1.2e-06
AUY31602.1|70754_71396_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	8.2e-115
AUY31603.1|71583_72144_-	Recombination enhancement function protein	NA	Q5QBN4	Enterobacteria_phage	97.8	4.2e-99
AUY31604.1|72753_73785_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
AUY31605.1|73792_74014_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
AUY31606.1|74617_74827_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AUY31607.1|74937_75789_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AUY31608.1|75813_77298_-|terminase	Large terminase protein	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AUY31609.1|77297_78491_-	Terminase A protein	NA	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
AUY31610.1|78576_79029_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AUY31611.1|79117_80161_-	hypothetical protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
AUY31612.1|80372_80753_-	death-on-curing family protein	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AUY31613.1|80752_80974_-	prevent-host-death family protein	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AUY31614.1|81046_81436_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AUY31615.1|81610_82195_+	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	97.9	2.8e-109
AUY31616.1|83403_83541_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31617.1|83616_83979_-	PmgV	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
AUY31618.1|83975_84908_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	4.5e-178
AUY31619.1|84889_85264_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.8	4.9e-67
AUY31620.1|85270_85564_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
AUY31621.1|86058_86943_-	phage protein	NA	Q1MVF7	Enterobacteria_phage	97.7	6.9e-120
AUY31622.1|87990_88488_-	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	61.1	2.4e-45
AUY31623.1|88484_88724_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
AUY31624.1|88716_88920_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
AUY31625.1|89003_89732_-	hypothetical protein	NA	Q71T76	Escherichia_phage	98.7	2.4e-139
AUY31626.1|89926_90433_-	Putative kinase-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
AUY31627.1|90505_91768_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
AUY31628.1|91769_91988_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AUY31629.1|92069_92771_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AUY31630.1|92767_93445_-	Serine/threonine-protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AUY31631.1|93441_94068_-	PmgP	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AUY31632.1|94791_95370_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.0	7.4e-107
AUY31633.1|95372_95618_-	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	6.2e-39
AUY31634.1|96151_97369_+|tail	Phage tail protein	tail	A0A077SL53	Escherichia_phage	100.0	1.1e-224
AUY31635.1|97372_98101_+|tail	Phage tail protein	tail	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AUY31636.1|98087_98873_+|plate	Baseplate protein	plate	Q71T90	Escherichia_phage	99.6	4.6e-144
AUY31637.1|98874_99891_+|tail	putative tail length determination protein	tail	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
AUY31638.1|99883_100516_+|plate	Baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
AUY31639.1|100562_101561_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.0	3.8e-191
AUY31640.1|101560_102925_-	DNA helicase	NA	A0A1B0VG30	Salmonella_phage	99.8	1.1e-252
AUY31641.1|103556_103982_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
>prophage 1
CP026476	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869C, complete sequence	51479	25786	43996	51479	transposase,protease	Escherichia_phage(33.33%)	19	NA	NA
AUY31676.1|25786_26608_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUY31677.1|26717_26972_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31678.1|26989_27265_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31679.1|27261_27540_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31680.1|27536_27683_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31681.1|29725_29923_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUY31682.1|29969_30674_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUY31683.1|31020_31188_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31684.1|31194_31386_-|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	72.2	5.4e-14
AUY31685.1|31753_32410_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AUY31686.1|32728_33343_-	resolvase TniR	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
AUY31687.1|33504_33762_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY31688.1|33822_34368_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31689.1|34504_35077_+|transposase	transposase	transposase	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AUY31690.1|35113_36505_+	hypothetical protein	NA	NA	NA	NA	NA
AUY31691.1|36468_37434_-	replication protein A	NA	NA	NA	NA	NA
AUY31692.1|38368_39166_-	carbapenem-hydrolyzing class D beta-lactamase OXA-181	NA	NA	NA	NA	NA
AUY31693.1|39786_42645_-	Transposase	NA	A0A125RQ78	Bacillus_phage	24.7	5.2e-52
AUY31694.1|43291_43996_+|transposase	transposase IS26	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
