The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	19173	81800	5087117	holin,head,lysis,integrase,capsid,tail,protease,terminase,portal	Enterobacteria_phage(35.42%)	75	11793:11808	77062:77077
11793:11808	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
AUY42244.1|19173_20304_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AUY42245.1|20281_20530_-	excisionase	NA	NA	NA	NA	NA
AUY42246.1|20594_23066_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
AUY42247.1|23158_23350_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUY42248.1|23346_23535_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUY42249.1|24100_24322_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42250.1|24351_24522_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46967.1|24481_24637_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AUY46968.1|24929_25454_-	LexA family transcriptional repressor	NA	A0A1W6JP50	Morganella_phage	31.6	2.2e-12
AUY42251.1|25659_25902_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AUY42252.1|25885_26311_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUY42253.1|26382_27453_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
AUY42254.1|27493_27916_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
AUY46969.1|28107_29070_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42255.1|29085_30087_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46970.1|30345_30489_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42256.1|30647_30860_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
AUY42257.1|31027_31306_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
AUY42258.1|31307_32354_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
AUY42259.1|32366_32741_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AUY42260.1|32737_33559_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
AUY42261.1|33783_33981_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
AUY42262.1|34131_35181_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
AUY42263.1|35693_35915_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42264.1|36455_36683_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
AUY42265.1|36640_36802_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
AUY42266.1|36951_37167_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AUY42267.1|37171_37516_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
AUY42268.1|37481_37754_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42269.1|38692_39157_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
AUY42270.1|39464_39875_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
AUY42271.1|39932_40166_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
AUY42272.1|40552_41101_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AUY42273.1|41072_43001_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
AUY42274.1|42984_43191_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUY42275.1|43187_44780_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
AUY42276.1|44769_46275_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
AUY42277.1|46311_46659_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
AUY42278.1|46716_47745_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
AUY42279.1|47796_48180_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AUY42280.1|48172_48526_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AUY42281.1|48541_49075_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
AUY42282.1|49071_49467_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUY42283.1|49474_50227_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AUY42284.1|50240_50672_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
AUY42285.1|50698_51112_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AUY42286.1|51092_53666_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
AUY42287.1|53662_53992_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
AUY42288.1|53991_54690_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
AUY42289.1|54694_55438_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
AUY42290.1|55335_55977_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AUY42291.1|56109_56295_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42292.1|56455_59935_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AUY42293.1|60002_60602_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AUY42294.1|60753_63729_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	85.3	2.1e-48
AUY42295.1|63728_64313_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
AUY42296.1|64285_64423_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUY46971.1|64367_64994_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUY42297.1|65092_65362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AUY42298.1|66134_66641_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AUY42299.1|66686_67187_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AUY42300.1|67272_67452_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42301.1|67832_68639_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUY42302.1|68638_69832_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUY42303.1|69843_71202_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
AUY42304.1|71205_72801_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AUY42305.1|72800_74363_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AUY46972.1|74454_74499_-	trp operon leader peptide	NA	NA	NA	NA	NA
AUY42306.1|74636_75518_+	phosphatase	NA	NA	NA	NA	NA
AUY42307.1|75514_76135_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUY42308.1|76162_78058_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
77062:77077	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
AUY42309.1|78270_79146_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AUY42310.1|79185_79776_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AUY42311.1|79772_80531_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
AUY42312.1|80750_81800_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	659450	730256	5087117	holin,head,lysis,capsid,integrase,tail,protease,terminase,portal	Escherichia_phage(40.0%)	91	721508:721524	751072:751088
AUY42865.1|659450_659630_+|integrase	integrase	integrase	NA	NA	NA	NA
AUY42866.1|659718_660033_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AUY42867.1|660247_661906_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AUY42868.1|661898_662894_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AUY42869.1|662886_663573_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AUY42870.1|663572_664946_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AUY42871.1|664964_665408_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
AUY42872.1|665404_666532_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AUY42873.1|666636_667101_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AUY42874.1|667105_668110_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUY42875.1|668106_668520_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUY42876.1|668522_668888_+	flagellar protein FliO	NA	NA	NA	NA	NA
AUY42877.1|668887_669625_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AUY42878.1|669634_669904_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUY42879.1|669912_670698_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AUY42880.1|670987_671611_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUY42881.1|671654_671897_-	DsrB protein	NA	NA	NA	NA	NA
AUY42882.1|671829_672018_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42883.1|672005_672233_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AUY42884.1|672530_673346_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AUY42885.1|673342_675037_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AUY42886.1|674957_675146_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42887.1|675468_676386_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AUY42888.1|676558_677479_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AUY42889.1|677467_677938_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AUY42890.1|677918_679337_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
AUY42891.1|679403_680099_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	7.3e-08
AUY42892.1|680138_680504_-	permease	NA	NA	NA	NA	NA
AUY42893.1|680596_680851_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42894.1|681069_682185_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	47.4	2.2e-91
AUY42895.1|682781_683633_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AUY42896.1|683739_685098_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUY46999.1|685097_685769_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.8e-32
AUY42897.1|685901_686315_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUY42898.1|686423_687428_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUY42899.1|687428_688064_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUY42900.1|688320_688971_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUY42901.1|689006_689336_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42902.1|690051_690339_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42903.1|690348_690627_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
AUY42904.1|690623_692687_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	7.2e-152
AUY42905.1|692751_693351_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.5	5.9e-107
AUY42906.1|693418_697117_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	75.6	0.0e+00
AUY42907.1|697177_697825_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
AUY42908.1|697722_698466_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
AUY42909.1|698471_699170_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	4.0e-131
AUY42910.1|699169_699526_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AUY42911.1|699503_702731_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AUY47000.1|702777_703038_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
AUY42912.1|703079_703466_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AUY42913.1|703465_704170_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
AUY42914.1|704230_704575_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
AUY42915.1|704571_705021_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AUY42916.1|705017_705356_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AUY42917.1|705364_705682_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AUY42918.1|705758_706976_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AUY42919.1|706990_707590_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AUY42920.1|707582_708809_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
AUY42921.1|708956_710714_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
AUY42922.1|710713_711196_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
AUY42923.1|711343_711694_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
AUY42924.1|711832_712372_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42925.1|712377_712644_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42926.1|712799_713267_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	90.3	2.1e-67
AUY42927.1|713263_713797_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AUY42928.1|713860_714211_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.8	1.8e-39
AUY42929.1|714215_714431_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AUY42930.1|715328_716210_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42931.1|716225_716489_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42932.1|716478_716877_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47001.1|716912_717278_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
AUY42933.1|717270_717642_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.7e-35
AUY42934.1|717654_718704_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.8e-109
AUY42935.1|718705_718984_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUY42936.1|719151_719364_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
AUY42937.1|719544_720210_-	hypothetical protein	NA	NA	NA	NA	NA
AUY42938.1|720384_720810_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.2e-63
AUY42939.1|720825_721596_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
721508:721524	attL	GCCTCTTCACGACTGAT	NA	NA	NA	NA
AUY42940.1|721617_722364_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AUY42941.1|722370_723333_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AUY42942.1|723355_723781_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUY42943.1|723777_724032_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AUY42944.1|724111_724531_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AUY42945.1|724747_724906_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42946.1|724889_725189_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42947.1|725260_725479_+	hypothetical protein	NA	NA	NA	NA	NA
AUY42948.1|726028_726217_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUY42949.1|726213_726405_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUY42950.1|726497_728969_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
AUY42951.1|729027_729231_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUY42952.1|729230_730256_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	2.6e-102
751072:751088	attR	GCCTCTTCACGACTGAT	NA	NA	NA	NA
>prophage 3
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	835174	843890	5087117		Enterobacteria_phage(42.86%)	9	NA	NA
AUY43036.1|835174_836302_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
AUY43037.1|836311_837550_-	flippase	NA	NA	NA	NA	NA
AUY43038.1|837581_838130_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
AUY43039.1|838134_839013_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
AUY43040.1|839070_839970_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
AUY43041.1|839969_841055_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
AUY43042.1|841127_841373_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43043.1|841427_842321_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUY43044.1|842495_843890_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 4
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	898562	935294	5087117	holin,head,lysis,integrase,capsid,tail,terminase,plate,portal	Escherichia_phage(45.0%)	44	900144:900158	933366:933380
AUY43089.1|898562_899924_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	5.5e-217
900144:900158	attL	CATTGACCACATCGA	NA	NA	NA	NA
AUY43090.1|900196_900478_-	transcriptional regulator	NA	M1SNR2	Escherichia_phage	96.8	1.3e-48
AUY43091.1|900496_901660_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
AUY43092.1|901659_902139_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.1	2.1e-83
AUY43093.1|902153_904601_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.8	0.0e+00
AUY47009.1|904593_904713_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AUY43094.1|904745_905021_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AUY43095.1|905077_905596_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AUY43096.1|905568_906801_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	1.1e-224
AUY43097.1|907131_907509_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47010.1|907531_908185_-|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	3.4e-07
AUY43098.1|908222_909065_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43099.1|909486_910014_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
AUY43100.1|910017_912747_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	81.6	0.0e+00
AUY43101.1|912757_913288_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.5e-101
AUY43102.1|913280_914189_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
AUY43103.1|914193_914541_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AUY43104.1|914537_915173_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.1e-111
AUY43105.1|915239_915692_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	9.1e-76
AUY43106.1|915684_916152_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
AUY43107.1|916114_916288_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AUY43108.1|916259_916685_-	protein lysB	NA	U5N3W5	Enterobacteria_phage	96.5	6.1e-66
AUY43109.1|916672_917098_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AUY43110.1|917112_917610_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
AUY43111.1|917609_917891_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUY43112.1|917894_918098_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	6.8e-31
AUY43113.1|918097_918607_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
AUY43114.1|918706_919450_-|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AUY43115.1|919453_920527_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
AUY43116.1|920585_921440_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
AUY43117.1|921613_923386_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AUY43118.1|923385_924420_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.6e-200
AUY43119.1|924923_927140_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43120.1|927363_929655_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.6	0.0e+00
AUY43121.1|929644_929920_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AUY43122.1|929916_930141_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AUY43123.1|930143_930443_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AUY43124.1|930442_930667_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUY43125.1|930730_931231_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AUY43126.1|931408_931684_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AUY43127.1|931798_932098_+	XRE family transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
AUY43128.1|932213_933227_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
AUY43129.1|933661_933979_-	hypothetical protein	NA	NA	NA	NA	NA
933366:933380	attR	CATTGACCACATCGA	NA	NA	NA	NA
AUY43130.1|934394_935294_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 5
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	972766	982211	5087117		Enterobacteria_phage(85.71%)	10	NA	NA
AUY43160.1|972766_973903_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
AUY43161.1|973899_975903_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
AUY43162.1|976027_976489_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AUY43163.1|976529_977000_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUY43164.1|977046_977766_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUY43165.1|977762_979448_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUY43166.1|979669_980401_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
AUY43167.1|980460_980568_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43168.1|980548_981280_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUY43169.1|981284_982211_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 6
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1190802	1260950	5087117	holin,coat,head,lysis,integrase,tail,tRNA,protease,terminase,portal	Enterobacteria_phage(76.36%)	87	1207760:1207776	1253067:1253083
AUY43355.1|1190802_1191615_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUY43356.1|1191614_1192628_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUY43357.1|1192693_1193830_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
AUY43358.1|1193928_1194924_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUY43359.1|1194920_1196099_-	arabinose transporter	NA	NA	NA	NA	NA
AUY43360.1|1196040_1196262_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43361.1|1196363_1197584_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AUY43362.1|1197742_1199749_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUY43363.1|1199869_1200148_-	YfcL family protein	NA	NA	NA	NA	NA
AUY43364.1|1200181_1200730_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUY43365.1|1200729_1201539_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43366.1|1201538_1202363_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUY43367.1|1202366_1203452_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AUY43368.1|1203486_1204419_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUY43369.1|1204584_1205136_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUY43370.1|1205455_1206298_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AUY43371.1|1206299_1206827_-	fimbrial protein	NA	NA	NA	NA	NA
AUY43372.1|1206823_1207303_-	fimbrial protein	NA	NA	NA	NA	NA
AUY43373.1|1207299_1207803_-	hypothetical protein	NA	NA	NA	NA	NA
1207760:1207776	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
AUY43374.1|1207819_1208572_-	fimbrial protein StfD	NA	NA	NA	NA	NA
AUY43375.1|1208591_1211240_-	outer membrane usher protein	NA	NA	NA	NA	NA
AUY43376.1|1212428_1212914_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUY43377.1|1213116_1215261_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUY43378.1|1215260_1216571_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUY43379.1|1216751_1217036_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AUY43380.1|1217120_1217372_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43381.1|1217407_1218748_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUY43382.1|1218805_1219561_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUY43383.1|1219586_1219757_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43384.1|1219854_1220787_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
AUY43385.1|1221098_1222256_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AUY43386.1|1223334_1226280_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.3	0.0e+00
AUY47019.1|1226380_1227283_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
AUY43387.1|1227515_1227668_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUY43388.1|1227782_1228031_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
AUY43389.1|1228030_1228567_+|protease	Clp protease	protease	NA	NA	NA	NA
AUY43390.1|1228615_1229065_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
AUY43391.1|1229073_1229640_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47020.1|1229836_1230166_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43392.1|1230183_1231965_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.2	2.5e-92
AUY43393.1|1231990_1232197_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	82.2	2.7e-11
AUY43394.1|1232196_1233648_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
AUY43395.1|1233658_1234351_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
AUY43396.1|1234353_1234809_-	hypothetical protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
AUY43397.1|1234808_1235510_-|tail	phage tail protein	tail	A5VW68	Enterobacteria_phage	100.0	3.2e-120
AUY43398.1|1235509_1236928_-	hypothetical protein	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
AUY43399.1|1236937_1237399_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AUY43400.1|1237379_1237568_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AUY43401.1|1237609_1238863_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
AUY43402.1|1238881_1239775_-	scaffolding protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
AUY43403.1|1239865_1242064_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
AUY43404.1|1242065_1243481_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
AUY43405.1|1243477_1243918_-|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
AUY43406.1|1243920_1244163_-	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AUY43407.1|1244390_1244933_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
AUY43408.1|1245138_1245291_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
AUY43409.1|1245278_1245716_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
AUY43410.1|1245712_1246189_-	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AUY43411.1|1246172_1246496_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUY43412.1|1247092_1247611_-	antiterminator	NA	A5VW83	Enterobacteria_phage	99.4	2.6e-95
AUY43413.1|1247607_1247796_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AUY43414.1|1247792_1248155_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AUY43415.1|1248151_1248442_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
AUY43416.1|1248441_1249164_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
AUY43417.1|1249156_1249333_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AUY43418.1|1249325_1249751_-	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
AUY43419.1|1249747_1249924_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
AUY43420.1|1249920_1250331_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
AUY43421.1|1250342_1250528_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43422.1|1251239_1252616_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
AUY43423.1|1252612_1253560_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
1253067:1253083	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
AUY43424.1|1253562_1253835_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AUY43425.1|1253857_1254151_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AUY43426.1|1254259_1254445_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AUY43427.1|1254525_1255176_+	LexA family transcriptional repressor	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
AUY43428.1|1255698_1255998_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
AUY43429.1|1256006_1256477_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
AUY43430.1|1256566_1256842_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
AUY43431.1|1257098_1257704_+	recombinase	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
AUY43432.1|1257703_1258087_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
AUY43433.1|1258110_1258407_+	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
AUY43434.1|1258501_1259020_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
AUY43435.1|1259016_1259316_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
AUY43436.1|1259317_1259890_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
AUY43437.1|1260167_1260452_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
AUY43438.1|1260524_1260692_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
AUY43439.1|1260749_1260950_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 7
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1476705	1568111	5087117	holin,lysis,tail,tRNA,terminase,portal	Enterobacteria_phage(45.9%)	101	NA	NA
AUY43622.1|1476705_1477443_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AUY43623.1|1477574_1478909_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AUY47026.1|1478941_1479823_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY43624.1|1479925_1480513_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AUY43625.1|1480568_1480952_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AUY43626.1|1481256_1481946_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AUY43627.1|1481993_1483031_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUY43628.1|1483020_1483224_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43629.1|1483237_1483657_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AUY47027.1|1483725_1484424_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUY43630.1|1484455_1487116_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUY43631.1|1487229_1488585_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AUY43632.1|1488630_1488954_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43633.1|1488950_1490249_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
AUY43634.1|1491549_1491777_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43635.1|1498731_1501305_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
AUY43636.1|1501434_1502166_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUY43637.1|1502162_1503143_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AUY43638.1|1503277_1504015_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUY43639.1|1504043_1504250_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43640.1|1504284_1504626_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AUY47028.1|1504729_1504777_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43641.1|1504875_1506036_+	prephenate dehydratase	NA	NA	NA	NA	NA
AUY43642.1|1506078_1507200_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUY43643.1|1507210_1508281_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AUY43644.1|1508490_1508856_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43645.1|1509004_1509523_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUY43646.1|1509512_1510739_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUY43647.1|1510754_1511237_+	hypothetical protein	NA	NA	NA	NA	NA
AUY43648.1|1511313_1511661_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUY43649.1|1511702_1512470_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUY43650.1|1512500_1513049_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUY43651.1|1513067_1513316_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUY43652.1|1513452_1514814_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUY47029.1|1514980_1515772_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUY47030.1|1515837_1517079_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUY43653.1|1517133_1517727_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUY43654.1|1517723_1517918_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUY43655.1|1517849_1518728_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUY43656.1|1518813_1520475_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUY43657.1|1520623_1520965_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUY43658.1|1521026_1521317_-	RnfH family protein	NA	NA	NA	NA	NA
AUY43659.1|1521306_1521783_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUY43660.1|1521914_1522397_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AUY43661.1|1523208_1524417_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
AUY43662.1|1524451_1525885_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AUY43663.1|1526508_1526631_+	ferredoxin	NA	NA	NA	NA	NA
AUY43664.1|1526966_1527746_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUY43665.1|1527947_1528241_-	hypothetical protein	NA	NA	NA	NA	NA
AUY43666.1|1528253_1528532_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	4.5e-25
AUY43667.1|1528528_1530592_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.1	1.5e-125
AUY43668.1|1530656_1531256_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.5	1.1e-105
AUY43669.1|1531323_1535022_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	74.9	0.0e+00
AUY43670.1|1535082_1535730_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
AUY43671.1|1535627_1536371_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
AUY43672.1|1536375_1537074_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.1	4.4e-130
AUY43673.1|1537083_1537413_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AUY43674.1|1537412_1540478_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
AUY43675.1|1540449_1540779_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUY47031.1|1540787_1541174_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AUY43676.1|1541234_1541978_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
AUY47032.1|1541988_1542390_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
AUY43677.1|1542386_1542965_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AUY43678.1|1542976_1543252_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUY43679.1|1543244_1543613_-	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUY43680.1|1543654_1545682_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
AUY43681.1|1545626_1547135_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
AUY43682.1|1547134_1547347_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUY43683.1|1547343_1549443_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
AUY43684.1|1549451_1549991_-	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AUY43685.1|1550663_1550816_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
AUY43686.1|1550803_1551271_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
AUY43687.1|1551267_1551801_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
AUY43688.1|1551856_1552171_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	97.1	2.0e-50
AUY43689.1|1552175_1552391_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AUY43690.1|1553212_1553638_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AUY43691.1|1553561_1553789_-	hypothetical protein	NA	A0A291AX11	Escherichia_phage	97.3	3.8e-14
AUY43692.1|1553918_1554671_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
AUY43693.1|1554684_1555674_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AUY43694.1|1555681_1556491_-	DNA-binding protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
AUY43695.1|1556510_1556900_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	4.6e-68
AUY43696.1|1556896_1557223_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AUY43697.1|1557219_1557873_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
AUY43698.1|1557872_1558367_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
AUY43699.1|1558363_1559182_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
AUY43700.1|1559178_1559403_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
AUY43701.1|1559399_1560548_-	peptidase	NA	A5LH69	Enterobacteria_phage	80.6	2.9e-163
AUY43702.1|1560544_1561096_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AUY43703.1|1561088_1561349_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	2.7e-40
AUY43704.1|1561320_1561473_-	amino acid permease	NA	NA	NA	NA	NA
AUY43705.1|1561446_1562139_+	transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	4.9e-121
AUY43706.1|1562194_1562473_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	92.3	1.5e-12
AUY43707.1|1562861_1563224_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUY43708.1|1563289_1564114_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUY43709.1|1564241_1564778_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
AUY43710.1|1564768_1565131_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
AUY43711.1|1565127_1565343_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AUY43712.1|1565402_1565609_+	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AUY43713.1|1565569_1566745_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
AUY43714.1|1567040_1567289_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
AUY43715.1|1567292_1568111_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
>prophage 8
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1641554	1648694	5087117		Escherichia_phage(83.33%)	6	NA	NA
AUY43788.1|1641554_1644116_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
AUY43789.1|1644221_1644878_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
AUY43790.1|1644928_1645696_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AUY43791.1|1645891_1646800_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AUY43792.1|1646796_1648059_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AUY43793.1|1648055_1648694_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	3489150	3543855	5087117	transposase,holin,integrase,tRNA,protease	Vibrio_phage(16.67%)	48	3518332:3518346	3540816:3540830
AUY45473.1|3489150_3490503_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUY45474.1|3490686_3491073_+	cytochrome b562	NA	NA	NA	NA	NA
AUY45475.1|3491117_3491582_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
AUY45476.1|3491739_3493878_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AUY45477.1|3494271_3495927_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AUY45478.1|3495976_3497398_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AUY45479.1|3497516_3498464_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AUY47106.1|3498648_3498702_+	MgtA leader peptide	NA	NA	NA	NA	NA
AUY45480.1|3498842_3501539_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
AUY45481.1|3501744_3502131_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUY45482.1|3502203_3502665_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUY45483.1|3502677_3503613_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AUY45484.1|3503616_3503751_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AUY45485.1|3503840_3504329_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AUY45486.1|3504444_3505848_-	YfcC family protein	NA	NA	NA	NA	NA
AUY45487.1|3505904_3506909_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUY45488.1|3506919_3507864_-	carbamate kinase	NA	NA	NA	NA	NA
AUY45489.1|3507874_3509095_-	arginine deiminase	NA	NA	NA	NA	NA
AUY45490.1|3509772_3510225_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AUY45491.1|3510270_3511275_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUY45492.1|3511436_3511853_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AUY45493.1|3512029_3512533_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUY45494.1|3512725_3513913_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AUY45495.1|3513959_3516815_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AUY45496.1|3516814_3517258_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUY45497.1|3517515_3519027_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
3518332:3518346	attL	CCCCAGCTCTTTCAT	NA	NA	NA	NA
AUY45498.1|3519293_3520394_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUY45499.1|3520393_3521476_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUY45500.1|3521636_3523139_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
AUY45501.1|3523216_3524215_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY45502.1|3524281_3525601_-	gluconate permease	NA	NA	NA	NA	NA
AUY45503.1|3525665_3526430_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUY45504.1|3526453_3527485_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AUY45505.1|3527701_3528265_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AUY45506.1|3528268_3529288_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
AUY45507.1|3529605_3529800_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47107.1|3529828_3531019_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AUY45508.1|3531191_3532465_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
AUY45509.1|3533865_3534096_-	hypothetical protein	NA	NA	NA	NA	NA
AUY45510.1|3534111_3534306_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45511.1|3535009_3535153_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45512.1|3535180_3536509_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUY45513.1|3537135_3538353_+	MFS transporter	NA	NA	NA	NA	NA
AUY47108.1|3538364_3539483_+	oxidoreductase	NA	NA	NA	NA	NA
AUY45514.1|3539525_3539651_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45515.1|3539703_3540099_-	hypothetical protein	NA	NA	NA	NA	NA
AUY45516.1|3541748_3541907_-|holin	choline transporter	holin	NA	NA	NA	NA
3540816:3540830	attR	ATGAAAGAGCTGGGG	NA	NA	NA	NA
AUY45517.1|3541851_3543855_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
>prophage 10
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	3948737	4001559	5087117	transposase,plate,integrase	Enterobacteria_phage(20.0%)	50	3989293:3989312	4001645:4001664
AUY45884.1|3948737_3950084_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUY45885.1|3950086_3950611_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUY47122.1|3950607_3951888_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUY45886.1|3951904_3952954_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUY45887.1|3952917_3954777_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUY45888.1|3954764_3955190_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUY45889.1|3955194_3956679_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUY45890.1|3956701_3957205_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUY45891.1|3957910_3958429_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUY45892.1|3958649_3960632_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	6.9e-27
AUY45893.1|3960738_3961785_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AUY45894.1|3961777_3963217_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AUY45895.1|3963191_3963482_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45896.1|3964732_3965236_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45897.1|3965305_3965818_+	integrating conjugative element protein	NA	NA	NA	NA	NA
AUY45898.1|3966088_3966859_-	amidohydrolase	NA	NA	NA	NA	NA
AUY45899.1|3967012_3967486_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AUY45900.1|3967528_3969973_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUY45901.1|3970212_3970791_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AUY45902.1|3970995_3971763_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUY45903.1|3971733_3972474_-	transpeptidase	NA	NA	NA	NA	NA
AUY45904.1|3972776_3973535_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
AUY45905.1|3973710_3974208_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY45906.1|3974527_3976267_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AUY47123.1|3976211_3976997_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AUY45907.1|3977067_3978123_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUY45908.1|3978174_3978468_+	antitoxin YafN	NA	NA	NA	NA	NA
AUY45909.1|3978470_3978869_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AUY45910.1|3978878_3979331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUY45911.1|3979508_3980660_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
AUY45912.1|3980656_3981271_+	peptide chain release factor H	NA	NA	NA	NA	NA
AUY45913.1|3981327_3982785_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AUY45914.1|3983045_3983504_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUY45915.1|3983595_3984840_+	esterase	NA	NA	NA	NA	NA
AUY45916.1|3984897_3985299_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AUY45917.1|3985408_3986464_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
AUY45918.1|3986752_3987856_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUY45919.1|3987867_3989121_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
3989293:3989312	attL	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
AUY45920.1|3989369_3989684_-	hypothetical protein	NA	NA	NA	NA	NA
AUY45921.1|3990635_3991187_-	resolvase	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
AUY45922.1|3993116_3993686_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY45923.1|3993994_3994198_+	ABC transporter ATPase	NA	NA	NA	NA	NA
AUY45924.1|3994197_3994506_+	transporter	NA	NA	NA	NA	NA
AUY45925.1|3995501_3995699_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AUY45926.1|3995703_3996087_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45927.1|3996101_3997133_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45928.1|3997286_3997484_+	hypothetical protein	NA	NA	NA	NA	NA
AUY45929.1|3997518_3999420_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.5	1.5e-42
AUY45930.1|3999493_4000150_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	62.0	1.3e-59
AUY45931.1|4000224_4001559_-|integrase	integrase	integrase	NA	NA	NA	NA
4001645:4001664	attR	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 11
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4261586	4314092	5087117	holin,lysis,integrase,capsid,tail,tRNA,protease,terminase,portal	Enterobacteria_phage(34.55%)	70	4256666:4256681	4283260:4283275
4256666:4256681	attL	CGCTCAATGGCGTTAA	NA	NA	NA	NA
AUY46174.1|4261586_4262972_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AUY46175.1|4263007_4263529_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46176.1|4263636_4263849_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUY46177.1|4263850_4264717_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AUY46178.1|4264766_4264955_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46179.1|4265079_4266243_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AUY46180.1|4266098_4266554_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	84.0	4.0e-63
AUY46181.1|4266469_4266775_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
AUY46182.1|4266774_4267137_-	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AUY46183.1|4267127_4267664_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AUY46184.1|4267791_4268616_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUY46185.1|4268681_4269044_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUY46186.1|4269730_4270405_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AUY46187.1|4270495_4270696_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AUY46188.1|4270739_4271291_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AUY46189.1|4271287_4272124_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
AUY47135.1|4272128_4272353_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
AUY46190.1|4272349_4272649_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY46191.1|4272645_4273641_+	replication protein	NA	Q8SBF1	Shigella_phage	87.9	3.8e-50
AUY46192.1|4273637_4274132_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
AUY46193.1|4274131_4274785_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
AUY46194.1|4274781_4275108_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
AUY46195.1|4275104_4275494_+	hypothetical protein	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AUY46196.1|4275513_4276311_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
AUY46197.1|4276326_4276842_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
AUY46198.1|4276851_4277841_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
AUY46199.1|4277858_4278239_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
AUY46200.1|4278390_4278669_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	94.6	3.3e-44
AUY46201.1|4279450_4281421_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	5.4e-250
AUY46202.1|4281557_4281740_+	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
AUY46203.1|4281777_4282047_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	71.9	2.2e-08
AUY46204.1|4282122_4282338_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AUY46205.1|4282342_4282687_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AUY46206.1|4282652_4282925_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46207.1|4283030_4283564_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	5.3e-99
4283260:4283275	attR	TTAACGCCATTGAGCG	NA	NA	NA	NA
AUY46208.1|4283862_4284330_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.3	1.2e-54
AUY46209.1|4284479_4284728_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46210.1|4284782_4285259_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
AUY46211.1|4285255_4287379_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
AUY46212.1|4287351_4287588_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AUY46213.1|4287587_4289090_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
AUY47136.1|4289103_4291059_+	peptidase S14	NA	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
AUY46214.1|4291146_4291473_+	DUF2190 domain-containing protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
AUY46215.1|4291465_4291747_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
AUY46216.1|4291749_4292373_+|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	98.1	4.7e-99
AUY46217.1|4292385_4292784_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
AUY46218.1|4292791_4293538_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
AUY46219.1|4293556_4293988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
AUY46220.1|4294014_4294419_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
AUY46221.1|4294408_4297021_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AUY46222.1|4297017_4297347_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUY46223.1|4297346_4298045_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
AUY46224.1|4298055_4298799_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
AUY46225.1|4298696_4299377_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	8.2e-113
AUY46226.1|4299623_4303316_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
AUY46227.1|4303383_4303983_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.5	5.9e-107
AUY46228.1|4304047_4306111_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.2	4.6e-151
AUY46229.1|4306107_4306386_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
AUY46230.1|4306395_4306689_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46231.1|4306728_4306827_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
AUY46232.1|4306799_4306895_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUY47137.1|4306853_4307507_-	methyltransferase	NA	NA	NA	NA	NA
AUY46233.1|4307605_4307911_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AUY46234.1|4308094_4309579_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUY46235.1|4309765_4310719_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUY46236.1|4310744_4310936_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46237.1|4311827_4312184_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	67.5	3.8e-53
AUY46238.1|4312156_4312282_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUY47138.1|4312238_4312865_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUY46239.1|4313138_4314092_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
>prophage 12
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4623935	4634055	5087117	protease	Vibrio_phage(33.33%)	6	NA	NA
AUY46526.1|4623935_4625882_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AUY46527.1|4625954_4626179_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUY46528.1|4626501_4626822_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AUY46529.1|4626852_4629129_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AUY46530.1|4629841_4630825_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
AUY46531.1|4630821_4634055_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.9	5.0e-83
>prophage 13
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4786455	4825347	5087117	transposase,integrase	Stx2-converting_phage(42.86%)	34	4785685:4785699	4789017:4789031
4785685:4785699	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
AUY46655.1|4786455_4787658_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
AUY46656.1|4787844_4789662_-	hypothetical protein	NA	NA	NA	NA	NA
4789017:4789031	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
AUY46657.1|4790773_4791070_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUY46658.1|4791314_4791512_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AUY46659.1|4791730_4793164_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AUY46660.1|4793984_4794548_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUY47153.1|4795222_4800181_+	nuclease	NA	NA	NA	NA	NA
AUY46661.1|4800177_4801614_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47154.1|4801718_4801925_+	methyltransferase	NA	NA	NA	NA	NA
AUY46662.1|4802093_4803983_-	enterotoxin	NA	NA	NA	NA	NA
AUY46663.1|4803996_4805172_-	putative C-S lyase	NA	NA	NA	NA	NA
AUY46664.1|4805183_4806755_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
AUY46665.1|4806868_4807273_-	aldolase	NA	NA	NA	NA	NA
AUY46666.1|4807220_4807523_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46667.1|4807455_4808280_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AUY46668.1|4808342_4808780_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46669.1|4808861_4809497_-	galactonate dehydratase	NA	NA	NA	NA	NA
AUY46670.1|4809683_4809923_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46671.1|4810054_4811327_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.8e-170
AUY47155.1|4811612_4811813_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46672.1|4811940_4812039_+	acetolactate synthase	NA	NA	NA	NA	NA
AUY46673.1|4812040_4812823_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AUY46674.1|4813128_4814049_+	ribokinase	NA	NA	NA	NA	NA
AUY46675.1|4814076_4815393_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUY46676.1|4815404_4816418_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUY47156.1|4816872_4817253_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
AUY46677.1|4817249_4817597_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
AUY46678.1|4817646_4819185_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
AUY46679.1|4819738_4819882_+	chemotaxis protein	NA	NA	NA	NA	NA
AUY46680.1|4820914_4821697_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
AUY46681.1|4821940_4822117_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AUY46682.1|4822079_4822259_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46683.1|4822490_4823819_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUY46684.1|4824084_4825347_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 14
CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4954340	4999574	5087117	head,lysis,integrase,capsid,tail,tRNA,terminase,portal	Enterobacteria_phage(57.14%)	67	4944860:4944873	4974631:4974644
4944860:4944873	attL	CACCACCACAAATG	NA	NA	NA	NA
AUY46809.1|4954340_4955447_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUY46810.1|4955500_4955962_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUY46811.1|4955971_4956625_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUY46812.1|4956796_4958047_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AUY46813.1|4958160_4959303_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AUY46814.1|4959292_4959529_-	excisionase	NA	NA	NA	NA	NA
AUY46815.1|4959668_4959908_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AUY46816.1|4959891_4960218_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AUY46817.1|4960217_4960439_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AUY46818.1|4960825_4961017_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AUY46819.1|4960989_4961172_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AUY46820.1|4961168_4961849_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AUY46821.1|4961845_4962631_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUY46822.1|4962636_4962933_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
AUY46823.1|4962901_4963054_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
AUY47166.1|4963008_4963278_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	98.9	3.0e-42
AUY46824.1|4963357_4963726_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AUY46825.1|4963908_4964109_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
AUY46826.1|4964322_4964904_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
AUY46827.1|4964920_4965193_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
AUY46828.1|4965170_4965353_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
AUY46829.1|4965629_4966382_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AUY46830.1|4966378_4966936_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46831.1|4966975_4967671_-	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
AUY46832.1|4967746_4967962_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUY46833.1|4968103_4968400_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
AUY46834.1|4968432_4969332_+	Replication protein O	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
AUY46835.1|4969328_4970030_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	6.4e-129
AUY46836.1|4970026_4970317_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
AUY46837.1|4970372_4970831_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AUY46838.1|4970827_4971355_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
AUY46839.1|4971351_4971528_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
AUY46840.1|4971488_4971872_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.7e-62
AUY46841.1|4971864_4972059_+	protein ninF	NA	NA	NA	NA	NA
AUY46842.1|4972078_4972441_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AUY46843.1|4972437_4972578_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
AUY46844.1|4972663_4973047_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AUY46845.1|4973235_4974318_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AUY46846.1|4974906_4975122_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
4974631:4974644	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
AUY46847.1|4975121_4975619_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
AUY46848.1|4975835_4976018_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AUY46849.1|4976108_4976402_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AUY46850.1|4976828_4977209_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AUY46851.1|4977331_4977685_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47167.1|4977572_4977893_-	hypothetical protein	NA	NA	NA	NA	NA
AUY46852.1|4977827_4978079_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUY46853.1|4978160_4978709_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
AUY46854.1|4978680_4980609_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
AUY46855.1|4980592_4980799_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AUY46856.1|4980795_4982388_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
AUY46857.1|4983951_4984299_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
AUY46858.1|4984356_4985385_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
AUY46859.1|4985388_4985811_+	hypothetical protein	NA	NA	NA	NA	NA
AUY46860.1|4985803_4986157_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
AUY46861.1|4986168_4986747_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
AUY46862.1|4986743_4987139_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
AUY47168.1|4987146_4987887_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
AUY46863.1|4987902_4988325_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
AUY46864.1|4988306_4988741_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
AUY46865.1|4988733_4991295_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
AUY46866.1|4991291_4991621_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
AUY46867.1|4991620_4992319_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
AUY46868.1|4992324_4993068_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
AUY46869.1|4992965_4993637_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AUY46870.1|4993697_4997180_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
AUY46871.1|4997238_4999299_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
AUY46872.1|4999295_4999574_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 1
CP026494	Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence	201203	11048	68968	201203	protease,transposase	Shigella_phage(12.5%)	43	NA	NA
AUY47458.1|11048_12002_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AUY47459.1|12105_12495_+	GlcNAc transferase	NA	NA	NA	NA	NA
AUY47460.1|12862_13126_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47461.1|13274_13691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
AUY47462.1|15405_16593_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
AUY47463.1|16589_18530_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AUY47464.1|18533_19904_+	RND transporter	NA	NA	NA	NA	NA
AUY47613.1|22299_23076_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47465.1|23077_25342_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUY47466.1|27683_28055_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47467.1|28097_28565_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47468.1|28564_28834_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47469.1|29065_30463_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AUY47470.1|31097_32291_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUY47471.1|32745_34019_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
AUY47472.1|34680_34974_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUY47473.1|35488_35671_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47614.1|37656_37920_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47474.1|38118_39234_+	glycosyl transferase	NA	NA	NA	NA	NA
AUY47475.1|39373_43033_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
AUY47476.1|43136_44366_+	esterase family protein	NA	NA	NA	NA	NA
AUY47477.1|44450_45407_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUY47478.1|45451_47629_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AUY47479.1|47916_48144_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47480.1|48367_48553_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AUY47481.1|48473_49508_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
AUY47482.1|49525_49717_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47483.1|50067_50376_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47484.1|50474_50657_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY47485.1|50653_50851_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
AUY47615.1|51565_52807_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AUY47486.1|52799_54896_+	colicin V secretion protein CvaB	NA	W8CYL7	Bacillus_phage	26.5	4.7e-34
AUY47487.1|55065_55377_-	colicin V	NA	NA	NA	NA	NA
AUY47488.1|55472_55679_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47489.1|56530_56800_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47490.1|56796_57777_+	FAD-binding protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
AUY47616.1|57852_58233_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
AUY47491.1|58229_58577_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUY47492.1|60753_64887_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	41.5	4.7e-296
AUY47493.1|65527_65896_+	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.9e-39
AUY47494.1|65852_67004_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
AUY47495.1|67125_67491_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY47496.1|67957_68968_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
>prophage 2
CP026494	Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence	201203	74608	117776	201203	tRNA,transposase,bacteriocin,integrase	Escherichia_phage(33.33%)	37	67232:67247	120724:120739
67232:67247	attL	ACGCTGAAGTTCTGCG	NA	NA	NA	NA
AUY47502.1|74608_74866_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AUY47503.1|74866_75100_-	HNH endonuclease	NA	NA	NA	NA	NA
AUY47504.1|75618_75807_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47505.1|75852_75972_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY47506.1|76890_77277_-	hypothetical protein	NA	Q6H9S3	Enterobacteria_phage	98.4	5.9e-68
AUY47507.1|77197_77539_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	92.4	5.5e-41
AUY47508.1|78485_79154_+	cysteine hydrolase	NA	NA	NA	NA	NA
AUY47509.1|79159_80020_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47510.1|80114_81674_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AUY47511.1|81670_83095_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AUY47512.1|83087_84044_+	carbamate kinase	NA	NA	NA	NA	NA
AUY47513.1|84060_84450_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUY47514.1|84472_85696_+	cytosine permease	NA	NA	NA	NA	NA
AUY47515.1|85773_86664_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY47516.1|87097_87487_+	cytochrome B562	NA	NA	NA	NA	NA
AUY47517.1|89875_90166_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47518.1|90223_90889_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47519.1|93641_94571_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY47520.1|94958_95564_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
AUY47521.1|95649_96498_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AUY47522.1|96457_98005_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AUY47523.1|98004_99423_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AUY47524.1|99535_101086_+	xanthine permease	NA	NA	NA	NA	NA
AUY47525.1|101112_102075_+	carbamate kinase	NA	NA	NA	NA	NA
AUY47526.1|104650_105433_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
AUY47527.1|105429_106452_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AUY47617.1|106465_106573_-|integrase	integrase	integrase	NA	NA	NA	NA
AUY47528.1|106822_107224_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	7.9e-07
AUY47529.1|107327_107615_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.3e-19
AUY47530.1|107611_107863_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUY47618.1|110512_110905_+	cysteine hydrolase	NA	NA	NA	NA	NA
AUY47531.1|111042_111927_+	EamA family transporter	NA	NA	NA	NA	NA
AUY47532.1|111958_113158_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUY47533.1|113236_113914_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUY47534.1|113945_114188_-	relaxase	NA	NA	NA	NA	NA
AUY47535.1|114245_117212_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUY47536.1|117215_117776_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
120724:120739	attR	CGCAGAACTTCAGCGT	NA	NA	NA	NA
>prophage 1
CP026492	Escherichia coli strain HS13-1 plasmid pHS13-1-IncHI2, complete sequence	264344	1718	36822	264344	transposase,integrase	Escherichia_phage(35.0%)	39	1518:1577	34629:36065
1518:1577	attL	TTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGG	NA	NA	NA	NA
AUY47173.1|1718_2558_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUY47174.1|2487_2667_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47175.1|2685_2889_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47176.1|3113_3818_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY47177.1|4007_4823_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AUY47178.1|4973_5678_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY47179.1|6127_7357_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
AUY47180.1|7502_8366_+	KR domain-containing protein	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUY47181.1|8403_8649_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47182.1|9117_9909_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUY47183.1|10763_10949_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47184.1|11088_11421_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AUY47185.1|11590_12382_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUY47186.1|12474_13734_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUY47187.1|13995_14787_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUY47188.1|15194_15692_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUY47189.1|15836_16850_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	3.0e-71
AUY47190.1|16788_17403_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUY47191.1|17528_18089_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AUY47192.1|18091_21043_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AUY47431.1|21051_21453_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47193.1|21537_22242_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AUY47194.1|23166_24051_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AUY47195.1|24267_25482_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AUY47196.1|25509_25815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY47197.1|26176_27133_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	3.4e-72
AUY47198.1|27169_27874_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUY47199.1|28157_28814_+	quinolone resistance pentapeptide repeat protein QnrS2	NA	NA	NA	NA	NA
AUY47200.1|29196_29757_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47201.1|29702_30407_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY47432.1|31443_31998_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AUY47433.1|32128_32959_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AUY47202.1|33096_33729_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AUY47203.1|33813_34266_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AUY47204.1|34488_34836_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUY47205.1|34829_35669_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUY47206.1|35598_35778_-	hypothetical protein	NA	NA	NA	NA	NA
AUY47207.1|35796_36000_+	hypothetical protein	NA	NA	NA	NA	NA
AUY47208.1|36117_36822_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
34629:36065	attR	TTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGGCGTCGTCATAATTACAGCCATTGCCTGGTTGCTTCATGGGCAAAAGCTTGATGCGTGGGGCTTTGTAGGTATGGGGCTCATAATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGCCGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTAGCGGACCCTGGTCAGGTTCCGCGAAGGTGGGCGCAGACATGCTGGGCTCGTCAGGATCAAACTGCACTATGAGGCGGCGGTTCATACCGCGCCAGGGGAGCGAATGGACAGCGAGGAGCCTCCGAACGTTCGGGTCGCCTGCTCGGGTGATATCGACGAGGTTGTGCGGCTGATGCACGACGCTGCGGCGTGGATGTCCGCCAAGGGAACGCCCGCCTGGGACGTCGCGCGGATCGACCGGACATTCGCGGAGACCTTCGTCCTGAGATCCGAGCTCCTAGGGATCGCCTCAGAAAACGGAAAATAAAGCACGCTAAGCCGTAAGTAAGCGTGCTCCTGTGAAAGCCACAGCTAAAACTGCGTAGTACACAT	NA	NA	NA	NA
