The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	26454	38972	3150565		Vibrio_phage(91.67%)	15	NA	NA
AVH33077.1|26454_28185_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	1.5e-49
AVH30430.1|28294_29539_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AVH30431.1|29708_30077_-	hypothetical protein	NA	Q858Q3	Vibrio_phage	51.2	5.9e-25
AVH30432.1|30195_30402_+	hypothetical protein	NA	G8IRU4	Vibrio_phage	53.8	6.2e-16
AVH33078.1|30470_31661_+	replication protein	NA	G8IRU5	Vibrio_phage	69.1	6.6e-166
AVH30433.1|31653_31971_+	hypothetical protein	NA	G8IRU6	Vibrio_phage	70.2	2.2e-36
AVH30434.1|31980_32205_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	68.9	1.2e-20
AVH30435.1|32239_32455_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	64.6	3.0e-13
AVH30436.1|32886_34050_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	46.8	3.5e-23
AVH30437.1|34058_34400_+	DUF2523 domain-containing protein	NA	R9TRT6	Vibrio_phage	75.2	1.8e-44
AVH30438.1|34405_35776_+	toxin	NA	R9TQ09	Vibrio_phage	77.5	3.0e-207
AVH30439.1|35855_36035_+	hypothetical protein	NA	NA	NA	NA	NA
AVH30440.1|36544_38020_+	hypothetical protein	NA	A0A2I7RNF1	Vibrio_phage	19.8	2.0e-07
AVH30441.1|38022_38586_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33079.1|38609_38972_-	regulator	NA	A0A1W6UG37	Vibrio_phage	61.5	2.3e-37
>prophage 2
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	848506	855554	3150565		Megavirus(16.67%)	9	NA	NA
AVH31118.1|848506_848938_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	39.8	2.6e-19
AVH31119.1|849007_850300_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	40.7	4.5e-35
AVH31120.1|850476_850671_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVH33121.1|850726_851065_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVH31121.1|851078_852932_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	3.8e-112
AVH31122.1|852953_853469_-	co-chaperone HscB	NA	NA	NA	NA	NA
AVH31123.1|853536_853860_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
AVH31124.1|853919_854303_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	9.1e-53
AVH31125.1|854339_855554_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.4e-30
>prophage 3
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	1066841	1077947	3150565	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AVH31295.1|1066841_1069424_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.2	1.5e-77
AVH31296.1|1069611_1070070_-	recombination regulator RecX	NA	NA	NA	NA	NA
AVH31297.1|1070139_1071192_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	3.7e-112
AVH31298.1|1071364_1071853_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	44.5	1.3e-24
AVH31299.1|1071937_1074499_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.4	5.8e-34
AVH31300.1|1074567_1075554_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
AVH31301.1|1075625_1076561_-	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.0	6.6e-12
AVH31302.1|1076560_1077187_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.3	2.0e-36
AVH31303.1|1077179_1077947_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	9.1e-68
>prophage 4
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	1084079	1092791	3150565	transposase,integrase,tRNA	Vibrio_phage(33.33%)	7	1080822:1080835	1095598:1095611
1080822:1080835	attL	CGCCAGCATGATGA	NA	NA	NA	NA
AVH31313.1|1084079_1085099_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	8.2e-109
AVH31314.1|1085330_1085546_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVH31315.1|1085574_1086018_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	46.5	4.3e-22
AVH31316.1|1086136_1087882_+	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	31.7	4.5e-46
AVH31317.1|1087979_1089857_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.6	5.5e-34
AVH31318.1|1090239_1091481_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.6	9.1e-110
AVH31319.1|1091658_1092791_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	4.2e-53
1095598:1095611	attR	TCATCATGCTGGCG	NA	NA	NA	NA
>prophage 5
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	2252079	2258610	3150565		Staphylococcus_phage(66.67%)	7	NA	NA
AVH32294.1|2252079_2253213_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.1e-64
AVH32295.1|2253224_2254475_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	6.8e-97
AVH32296.1|2254577_2255027_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVH32297.1|2255040_2256150_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.0	6.5e-43
AVH32298.1|2256153_2256807_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.0	5.0e-35
AVH32299.1|2256848_2257958_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	4.8e-62
AVH32300.1|2258139_2258610_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
>prophage 6
CP014033	Vibrio fluvialis strain AK 1296-A2-1 chromosome 1, complete sequence	3150565	2321464	2330817	3150565	capsid,integrase	Vibrio_phage(33.33%)	15	2318650:2318696	2331889:2331935
2318650:2318696	attL	TGGCGCTCCCGACAGGATTCGAACCTGAGACCTGCCCCTTAGGAGGG	NA	NA	NA	NA
AVH32349.1|2321464_2322454_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	47.2	2.3e-76
AVH33181.1|2322450_2323173_-	peptidase	NA	L7TH81	Pseudomonas_virus	24.7	4.2e-06
AVH32350.1|2323279_2323531_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32351.1|2323540_2323801_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32352.1|2323810_2324050_+	hypothetical protein	NA	A0A2I7RNH0	Vibrio_phage	42.4	1.2e-07
AVH32353.1|2324075_2324360_+	hypothetical protein	NA	A0A2I7RNG7	Vibrio_phage	59.8	4.3e-23
AVH32354.1|2324522_2324714_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32355.1|2324772_2325006_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33182.1|2325110_2327003_+	replication protein	NA	F1BUM9	Cronobacter_phage	36.1	1.4e-53
AVH32356.1|2327041_2327233_+	zinc-binding protein	NA	NA	NA	NA	NA
AVH32357.1|2327418_2328228_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32358.1|2328230_2328971_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32359.1|2329362_2329530_+	hypothetical protein	NA	NA	NA	NA	NA
AVH32360.1|2329513_2329777_+	zinc-binding protein	NA	NA	NA	NA	NA
AVH32361.1|2329788_2330817_+|capsid	major capsid protein	capsid	A0A0U4K5I9	Pseudomonas_phage	34.7	4.5e-46
2331889:2331935	attR	TGGCGCTCCCGACAGGATTCGAACCTGAGACCTGCCCCTTAGGAGGG	NA	NA	NA	NA
>prophage 1
CP014032	Vibrio fluvialis strain AK 1296-A2-1 chromosome 2, complete sequence	1716983	224015	259449	1716983	plate,integrase,terminase,tail,capsid,portal	Vibrio_phage(30.0%)	45	213423:213437	253777:253791
213423:213437	attL	TCGTCGGTGCTCTGA	NA	NA	NA	NA
AVH33413.1|224015_225044_-|integrase	integrase	integrase	A0A160DJR8	Vibrio_phage	59.8	2.0e-118
AVH33414.1|225332_227024_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVH33415.1|227016_229350_+	ATP-binding protein	NA	NA	NA	NA	NA
AVH33416.1|229339_230503_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
AVH33417.1|230492_231236_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33418.1|231237_231732_-	hypothetical protein	NA	NA	NA	NA	NA
AVH33419.1|231784_232492_-	Cro/Cl family transcriptional regulator	NA	M4MB93	Vibrio_phage	35.7	2.0e-13
AVH33420.1|232620_232803_+	Cro/Cl family transcriptional regulator	NA	M4R204	Salicola_phage	56.6	9.4e-08
AVH33421.1|232871_233030_+	regulator	NA	U3PFJ1	Vibrio_phage	70.0	5.5e-12
AVH33422.1|233247_233787_+	transcriptional regulator	NA	A0A2I7RNI1	Vibrio_phage	57.0	2.0e-53
AVH33423.1|233796_234129_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33424.1|234201_234498_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33425.1|234494_235037_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	83.4	4.4e-85
AVH33426.1|235053_237684_+	replication protein	NA	A0A166YHE2	Vibrio_phage	59.5	7.7e-300
AVH33427.1|237693_237945_+	zinc-binding protein	NA	NA	NA	NA	NA
AVH34706.1|237969_238194_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33428.1|238190_238553_+	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	35.2	1.8e-10
AVH33429.1|238861_240052_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33430.1|240048_240987_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVH33431.1|240979_241555_+|plate	baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	33.1	1.2e-11
AVH33432.1|241551_241938_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33433.1|241934_242981_+	hypothetical protein	NA	S5FM68	Shigella_phage	24.2	1.5e-12
AVH33434.1|242962_243442_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33435.1|243438_244533_+|tail	phage tail protein	tail	E5FJ29	Escherichia_phage	37.4	3.9e-16
AVH34707.1|244637_245462_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33436.1|245576_246578_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33437.1|246574_246982_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33438.1|247113_247530_+	lysozyme	NA	A0A1Q1PW74	Pseudoalteromonas_phage	51.5	1.4e-27
AVH33439.1|247540_247771_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33440.1|247761_248013_+	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	9.0e-09
AVH33441.1|248093_248792_-	hypothetical protein	NA	NA	NA	NA	NA
AVH33442.1|248890_249415_-	hypothetical protein	NA	NA	NA	NA	NA
AVH33443.1|249534_250002_-	hypothetical protein	NA	NA	NA	NA	NA
AVH33444.1|250468_251434_-|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	40.9	6.3e-58
AVH33445.1|251444_253169_-|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	7.1e-113
AVH33446.1|253339_254152_+|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	37.3	1.7e-19
253777:253791	attR	TCAGAGCACCGACGA	NA	NA	NA	NA
AVH33447.1|254194_255232_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.7	8.2e-64
AVH33448.1|255340_255790_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33449.1|255789_256254_+	hypothetical protein	NA	A0A1S5NPS3	Burkholderia_phage	29.4	5.0e-05
AVH33450.1|256250_256790_+	virion morphogenesis protein	NA	NA	NA	NA	NA
AVH33451.1|256790_256973_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AVH33452.1|256969_258103_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	38.7	1.5e-47
AVH33453.1|258106_258472_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33454.1|258482_259178_+	hypothetical protein	NA	NA	NA	NA	NA
AVH33455.1|259161_259449_+|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	40.4	9.7e-07
>prophage 2
CP014032	Vibrio fluvialis strain AK 1296-A2-1 chromosome 2, complete sequence	1716983	920066	941126	1716983	plate,terminase,tail,capsid,portal	Burkholderia_phage(18.75%)	30	NA	NA
AVH34017.1|920066_920174_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVH34018.1|920209_920497_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	41.6	5.7e-07
AVH34019.1|920480_921188_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34020.1|921198_921564_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34021.1|921567_922701_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	38.7	1.5e-47
AVH34022.1|922697_922880_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	46.4	7.5e-05
AVH34023.1|922880_923420_-	virion morphogenesis protein	NA	NA	NA	NA	NA
AVH34024.1|923416_923881_-	hypothetical protein	NA	A0A1S5NPS3	Burkholderia_phage	29.8	8.6e-05
AVH34025.1|923880_924330_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34026.1|924438_925476_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	42.0	3.7e-64
AVH34027.1|925518_926337_-|capsid	phage capsid protein	capsid	Q94MZ5	Haemophilus_virus	32.4	1.7e-16
AVH34028.1|926507_928232_+|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	1.6e-112
AVH34029.1|928242_929208_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	40.9	6.3e-58
AVH34030.1|929695_930532_+	hypothetical protein	NA	NA	NA	NA	NA
AVH34031.1|930668_931352_+	hypothetical protein	NA	NA	NA	NA	NA
AVH34032.1|931948_932566_-	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	59.8	1.6e-22
AVH34033.1|933082_933442_+	hypothetical protein	NA	NA	NA	NA	NA
AVH34034.1|933590_934130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVH34035.1|934164_934596_+	GFA family protein	NA	NA	NA	NA	NA
AVH34036.1|934740_935181_+	hypothetical protein	NA	NA	NA	NA	NA
AVH34037.1|935257_935509_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	43.8	3.4e-08
AVH34038.1|935499_935730_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34039.1|935740_936157_-	lysozyme	NA	A0A1Q1PW74	Pseudoalteromonas_phage	53.0	2.9e-28
AVH34742.1|936390_936966_+	acyltransferase	NA	A0A1V0SJ47	Klosneuvirus	43.4	2.8e-05
AVH34040.1|937049_937613_-	hypothetical protein	NA	R9TMQ2	Vibrio_phage	59.3	1.5e-56
AVH34041.1|937605_938616_-	hypothetical protein	NA	R9TNR5	Vibrio_phage	72.1	1.4e-71
AVH34042.1|938612_939143_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34043.1|939124_940171_-	hypothetical protein	NA	S5FM68	Shigella_phage	24.2	1.1e-12
AVH34044.1|940167_940554_-	hypothetical protein	NA	NA	NA	NA	NA
AVH34045.1|940550_941126_-|plate	baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	30.5	5.8e-11
