The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	2068336	2081736	4527605	tRNA	Tupanvirus(11.11%)	14	NA	NA
AUX93322.1|2068336_2070265_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
AUX93323.1|2070268_2070811_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.3	6.3e-15
AUX93324.1|2070908_2071106_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUX93325.1|2071147_2071504_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUX93326.1|2071815_2072799_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	3.8e-34
AUX93327.1|2072813_2075201_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.1	5.1e-08
AUX93328.1|2075205_2075505_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
AUX95436.1|2075723_2076137_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AUX93329.1|2076249_2077233_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.7	3.3e-14
AUX93330.1|2077267_2077813_+	glutathione peroxidase	NA	NA	NA	NA	NA
AUX95437.1|2077815_2078562_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	27.6	8.1e-05
AUX93331.1|2078634_2079096_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	37.5	4.2e-12
AUX93332.1|2079479_2080220_+	hypothetical protein	NA	NA	NA	NA	NA
AUX93333.1|2080296_2081736_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	41.0	1.7e-59
>prophage 2
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	2503504	2512777	4527605	lysis	uncultured_Caudovirales_phage(22.22%)	13	NA	NA
AUX95458.1|2503504_2503735_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	82.9	1.6e-28
AUX93664.1|2504288_2505068_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	45.3	3.5e-59
AUX93665.1|2505090_2506107_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	52.9	2.6e-99
AUX93666.1|2506114_2506924_-	DNA-binding protein	NA	S5MC03	Escherichia_phage	71.0	1.8e-103
AUX93667.1|2507843_2508143_-	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	63.5	3.8e-30
AUX93668.1|2508139_2509450_-	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.7	3.5e-96
AUX93669.1|2509565_2509997_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUX93670.1|2510007_2510904_-	transcriptional regulator	NA	A0A248SL49	Klebsiella_phage	53.4	3.3e-37
AUX93671.1|2510900_2511083_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUX93672.1|2511088_2511274_-	hypothetical protein	NA	NA	NA	NA	NA
AUX93673.1|2511337_2511799_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	70.2	9.3e-52
AUX95459.1|2511818_2512034_-	cell division protein	NA	NA	NA	NA	NA
AUX93674.1|2512132_2512777_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	40.2	9.1e-37
>prophage 3
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	2576475	2584712	4527605	integrase	Erwinia_phage(75.0%)	10	2570004:2570018	2588920:2588934
2570004:2570018	attL	GCGCTGGCGCTGATG	NA	NA	NA	NA
AUX95463.1|2576475_2577570_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	57.5	3.7e-107
AUX93731.1|2577919_2578849_-	hypothetical protein	NA	NA	NA	NA	NA
AUX93732.1|2578929_2579772_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	54.3	1.3e-83
AUX93733.1|2579886_2580288_+	hypothetical protein	NA	NA	NA	NA	NA
AUX93734.1|2580319_2580829_+	hypothetical protein	NA	A0A218M4I4	Erwinia_phage	63.1	3.8e-54
AUX93735.1|2580836_2581031_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	64.1	4.8e-18
AUX93736.1|2581023_2581407_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	80.3	3.7e-54
AUX93737.1|2581476_2581704_+	hypothetical protein	NA	F1BUS3	Erwinia_phage	62.7	6.2e-17
AUX93738.1|2581703_2581928_+	hypothetical protein	NA	F1BUS2	Erwinia_phage	62.2	1.7e-19
AUX93739.1|2584229_2584712_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	63.2	4.4e-44
2588920:2588934	attR	GCGCTGGCGCTGATG	NA	NA	NA	NA
>prophage 4
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	3156596	3239977	4527605	head,tRNA,terminase,holin,integrase,tail	Salmonella_phage(25.93%)	99	3157461:3157477	3193655:3193671
AUX94193.1|3156596_3157406_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUX94194.1|3157405_3158416_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
3157461:3157477	attL	CCGCCGAAGCGGATATT	NA	NA	NA	NA
AUX94195.1|3158531_3159665_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.0	6.3e-17
AUX94196.1|3159723_3160512_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUX94197.1|3160633_3161545_+	EamA family transporter	NA	NA	NA	NA	NA
AUX94198.1|3161754_3162792_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUX95497.1|3162947_3163400_-	rhodanese	NA	NA	NA	NA	NA
AUX94199.1|3163486_3164929_+	GntR family transcriptional regulator	NA	A0A1X9I5H2	Streptococcus_phage	25.8	2.9e-14
AUX94200.1|3164925_3166092_-	arabinose transporter	NA	NA	NA	NA	NA
AUX94201.1|3166421_3167639_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUX94202.1|3167797_3169807_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUX94203.1|3170082_3170364_-	YfcL family protein	NA	NA	NA	NA	NA
AUX95498.1|3170393_3170936_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUX95499.1|3171011_3171758_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94204.1|3171819_3172644_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUX94205.1|3172647_3173733_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.7	5.7e-92
AUX95500.1|3173754_3174687_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUX95501.1|3174852_3175401_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUX94206.1|3175413_3175896_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUX94207.1|3176066_3178220_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUX94208.1|3178224_3179535_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUX94209.1|3179784_3180081_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94210.1|3180428_3181763_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUX94211.1|3181877_3182642_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUX94212.1|3182677_3183892_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AUX94213.1|3183888_3184350_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AUX94214.1|3184346_3184904_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUX94215.1|3184900_3186856_-	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
AUX94216.1|3187331_3187559_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AUX94217.1|3187555_3188299_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AUX95502.1|3188338_3188998_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AUX94218.1|3188997_3189615_-	heme ABC transporter ATP-binding protein CcmA	NA	A0A2H4UU96	Bodo_saltans_virus	25.8	3.8e-08
AUX94219.1|3189857_3190781_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	75.0	2.9e-113
AUX94220.1|3191096_3192269_+|integrase	integrase	integrase	C6ZR22	Salmonella_phage	81.5	1.4e-189
AUX94221.1|3193700_3194705_-	hypothetical protein	NA	NA	NA	NA	NA
3193655:3193671	attR	CCGCCGAAGCGGATATT	NA	NA	NA	NA
AUX94222.1|3194704_3197863_-	hypothetical protein	NA	H6WRW4	Salmonella_phage	69.6	0.0e+00
AUX94223.1|3197872_3198397_-|tail	phage tail protein	tail	H6WRW3	Salmonella_phage	56.3	1.6e-44
AUX94224.1|3198339_3199065_-|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	67.9	1.4e-99
AUX94225.1|3199064_3199769_-|tail	phage minor tail protein L	tail	H6WRW1	Salmonella_phage	75.6	1.5e-106
AUX94226.1|3199765_3200119_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	74.4	7.1e-44
AUX94227.1|3200161_3200452_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94228.1|3200659_3203179_-|tail	phage tail tape measure protein	tail	H6WRV7	Salmonella_phage	35.5	1.5e-82
AUX94229.1|3203238_3203577_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	57.7	2.1e-29
AUX94230.1|3204148_3204844_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	61.5	1.0e-73
AUX94231.1|3204893_3205637_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	68.7	1.0e-87
AUX94232.1|3205705_3206665_-	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	47.1	6.1e-37
AUX94233.1|3206739_3207123_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	56.7	3.7e-38
AUX94234.1|3207163_3207706_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	46.0	8.4e-36
AUX94235.1|3207809_3208178_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	70.5	1.1e-44
AUX94236.1|3208180_3208528_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	58.3	3.1e-31
AUX94237.1|3208530_3208701_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUX94238.1|3208700_3209102_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	89.5	3.5e-63
AUX94239.1|3209162_3209459_-	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	91.8	3.2e-45
AUX94240.1|3209469_3210567_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	98.4	1.9e-207
AUX94241.1|3210581_3211034_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	81.8	2.0e-62
AUX94242.1|3211033_3212308_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	88.0	1.1e-214
AUX94243.1|3212324_3213287_-|head	phage head morphogenesis protein	head	G0ZND6	Cronobacter_phage	76.4	2.2e-23
AUX94244.1|3213234_3214575_-	DUF1073 domain-containing protein	NA	G0ZND5	Cronobacter_phage	91.1	7.0e-225
AUX94245.1|3214593_3215847_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.2	1.7e-212
AUX94246.1|3215839_3216256_-	hypothetical protein	NA	B6SCV4	Bacteriophage	63.2	1.1e-35
AUX94247.1|3216957_3217902_-	hypothetical protein	NA	H2DE35	Erwinia_phage	33.2	3.1e-25
AUX94248.1|3218044_3218551_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	54.3	8.4e-46
AUX94249.1|3218895_3219351_-	Rz lytic protein	NA	NA	NA	NA	NA
AUX94250.1|3219338_3219971_-	hypothetical protein	NA	A0A1W6JTC9	Pseudomonas_phage	45.6	1.1e-42
AUX95503.1|3219954_3220308_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AUX94251.1|3220681_3221296_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	39.0	8.6e-37
AUX94252.1|3222044_3222653_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	48.1	6.5e-45
AUX94253.1|3222636_3222789_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94254.1|3222775_3223201_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	72.9	1.4e-54
AUX94255.1|3223197_3223371_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	53.6	1.8e-08
AUX94256.1|3223355_3223571_-	protein ninH	NA	A0A088CC23	Shigella_phage	66.7	1.1e-12
AUX94257.1|3223567_3223849_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94258.1|3223845_3224322_-	HNH endonuclease	NA	W6PP19	Citrobacter_phage	51.4	6.7e-29
AUX94259.1|3224272_3224767_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	57.6	3.8e-43
AUX94260.1|3225159_3225495_-	hypothetical protein	NA	NA	NA	NA	NA
AUX95504.1|3225494_3227849_-	helicase DnaB	NA	G9L681	Escherichia_phage	47.7	7.1e-188
AUX95505.1|3227908_3228667_-	replication of DNA	NA	K7P7N8	Enterobacteria_phage	58.5	2.0e-75
AUX94261.1|3228875_3229172_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	67.8	4.8e-25
AUX94262.1|3229310_3229520_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	56.5	1.1e-15
AUX95506.1|3229625_3230285_+	LexA family transcriptional repressor	NA	A0A2H4J176	uncultured_Caudovirales_phage	62.5	3.2e-69
AUX94263.1|3230434_3230731_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94264.1|3230727_3231042_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	57.8	6.8e-22
AUX94265.1|3231113_3231590_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94266.1|3231785_3232109_+	antitermination protein	NA	A0A0N7C217	Escherichia_phage	55.9	9.5e-11
AUX94267.1|3232341_3233046_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	51.9	1.5e-53
AUX94268.1|3233172_3233451_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94269.1|3233463_3233712_+	hypothetical protein	NA	A0A088F844	Salmonella_phage	60.2	7.5e-24
AUX94270.1|3234026_3234335_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94271.1|3234335_3235271_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	78.0	1.6e-138
AUX95507.1|3235270_3235951_+	exonuclease	NA	V5UT69	Shigella_phage	78.8	8.2e-105
AUX94272.1|3235953_3236250_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94273.1|3236252_3236471_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94274.1|3236467_3236884_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94275.1|3236876_3237167_+	hypothetical protein	NA	NA	NA	NA	NA
AUX94276.1|3237355_3238108_+	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.7	5.3e-28
AUX94277.1|3238146_3238389_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	80.0	1.2e-29
AUX94278.1|3238385_3238637_+	hypothetical protein	NA	NA	NA	NA	NA
AUX95508.1|3238728_3238941_+	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	61.4	3.6e-19
AUX94279.1|3239773_3239977_+	hypothetical protein	NA	E5AGD1	Erwinia_phage	65.6	7.3e-17
>prophage 5
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	3561775	3571151	4527605		Mycobacterium_phage(16.67%)	8	NA	NA
AUX94544.1|3561775_3562846_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	2.0e-113
AUX94545.1|3562940_3563441_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	50.6	5.8e-31
AUX94546.1|3563791_3564679_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUX94547.1|3564712_3565054_-	hypothetical protein	NA	NA	NA	NA	NA
AUX94548.1|3565365_3567909_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.1	1.0e-27
AUX94549.1|3568240_3569233_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-32
AUX95522.1|3569282_3570353_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	1.2e-06
AUX94550.1|3570524_3571151_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	4.1e-34
>prophage 6
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	3873369	3876908	4527605	integrase	Erwinia_phage(57.14%)	8	3863014:3863063	3879029:3879078
3863014:3863063	attL	GACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
AUX94796.1|3873369_3873597_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	61.6	1.7e-19
AUX94797.1|3873596_3873827_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	58.3	4.8e-09
AUX94798.1|3873895_3874237_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	61.1	7.9e-32
AUX94799.1|3874200_3874392_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	66.1	7.1e-14
AUX94800.1|3874399_3874909_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	68.6	3.0e-59
AUX94801.1|3874944_3875181_-	regulator	NA	NA	NA	NA	NA
AUX94802.1|3875270_3875876_+	phage repressor protein	NA	F1BUN8	Cronobacter_phage	40.2	2.0e-30
AUX94803.1|3875885_3876908_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	61.3	3.8e-114
3879029:3879078	attR	GACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
>prophage 7
CP026377	Pantoea gaviniae strain DSM 22758 chromosome, complete genome	4527605	4059127	4071718	4527605		uncultured_Caudovirales_phage(55.56%)	13	NA	NA
AUX94959.1|4059127_4060162_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.2	8.9e-111
AUX95541.1|4060211_4061486_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
AUX94960.1|4061527_4061968_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
AUX94961.1|4062161_4063061_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX94962.1|4063159_4063687_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
AUX94963.1|4063683_4064916_+	MFS transporter	NA	NA	NA	NA	NA
AUX94964.1|4064964_4065300_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUX95542.1|4065305_4066019_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
AUX94965.1|4066075_4066504_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
AUX94966.1|4066553_4067837_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
AUX94967.1|4067933_4068287_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
AUX94968.1|4068549_4069008_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUX95543.1|4069516_4071718_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.9e-134
