The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	73662	94643	4900326	transposase	Escherichia_phage(55.56%)	17	NA	NA
AUW48357.1|73662_74592_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.2	4.6e-66
AUW52774.1|74634_75537_-	EamA family transporter	NA	NA	NA	NA	NA
AUW48358.1|76042_76738_+	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AUW48359.1|76957_79684_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	3.6e-34
AUW48360.1|79705_79798_+	protein MgtR	NA	NA	NA	NA	NA
AUW48361.1|79998_80478_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48362.1|80706_81387_-	hydrolase	NA	NA	NA	NA	NA
AUW48363.1|82004_82118_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48364.1|82170_83028_+	transcriptional regulator	NA	NA	NA	NA	NA
AUW52775.1|83038_83503_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48365.1|85275_85980_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW48366.1|86736_87441_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW48367.1|88176_88881_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUW52776.1|89340_89733_-	cysteine hydrolase	NA	NA	NA	NA	NA
AUW48368.1|92078_92783_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW48369.1|92972_93788_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AUW48370.1|93938_94643_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	505042	589462	4900326	head,integrase,terminase,protease,portal,capsid,tRNA,tail	uncultured_Caudovirales_phage(50.0%)	87	500589:500617	587136:587164
500589:500617	attL	AAAAAACCCGCTTCGGCGGGTTTTTTTAT	NA	NA	NA	NA
AUW48738.1|505042_505990_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
AUW48739.1|506005_506515_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AUW48740.1|506646_507771_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AUW48741.1|507742_508216_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48742.1|508242_508785_+	DNA topoisomerase	NA	NA	NA	NA	NA
AUW48743.1|508789_509362_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
AUW52796.1|509366_510185_+	shikimate dehydrogenase (NADP+)	NA	NA	NA	NA	NA
AUW48744.1|510181_510439_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AUW48745.1|510414_510969_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUW48746.1|511178_511382_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48747.1|517626_517848_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48748.1|518084_521198_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AUW48749.1|521209_522367_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AUW48750.1|522780_523443_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
AUW48751.1|523445_525545_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	8.4e-23
AUW48752.1|525695_525860_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AUW48753.1|525942_526827_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
AUW48754.1|527100_528327_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.4e-150
AUW48755.1|528418_529225_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48756.1|529329_529614_+	transcriptional regulator	NA	NA	NA	NA	NA
AUW48757.1|529624_530404_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AUW52798.1|530527_530722_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUW52797.1|530945_531125_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AUW48758.1|531117_531306_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48759.1|531298_531613_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48760.1|531609_531978_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
AUW48761.1|531974_532340_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48762.1|532339_534469_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	7.1e-187
AUW48763.1|534814_535150_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48764.1|535196_535709_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48765.1|535971_537138_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	1.7e-206
AUW48766.1|537189_537750_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.2	2.1e-98
AUW48767.1|537751_538993_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	3.2e-232
AUW48768.1|538989_539325_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AUW48769.1|539321_539621_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AUW48770.1|539620_540064_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	92.5	1.1e-78
AUW48771.1|540190_540382_+|terminase	terminase	terminase	NA	NA	NA	NA
AUW48772.1|540339_540696_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AUW48773.1|540679_542341_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.4	0.0e+00
AUW48774.1|542491_542800_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
AUW48775.1|542957_543254_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUW48776.1|543279_544245_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUW48777.1|544906_545788_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUW48778.1|545799_547251_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUW48779.1|547240_547483_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48780.1|547591_548941_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUW48781.1|548951_549422_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUW48782.1|549814_550414_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AUW48783.1|550414_551419_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUW48784.1|551531_552506_-	oxidoreductase	NA	NA	NA	NA	NA
AUW48785.1|552709_554650_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AUW48786.1|554658_554850_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48787.1|554957_556001_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AUW48788.1|556065_557118_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUW48789.1|557117_557609_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUW48790.1|557617_558211_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUW48791.1|558200_559670_+	ribonuclease G	NA	NA	NA	NA	NA
AUW48792.1|559776_563577_+	TIGR02099 family protein	NA	NA	NA	NA	NA
AUW48793.1|563721_565167_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUW48794.1|565288_566218_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW48795.1|566399_566603_+	protein AaeX	NA	NA	NA	NA	NA
AUW48796.1|566610_567543_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AUW48797.1|567548_569516_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AUW48798.1|569687_569960_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48799.1|570019_570286_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUW48800.1|570389_570653_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUW48801.1|571017_571488_-	arginine repressor	NA	NA	NA	NA	NA
AUW48802.1|571902_572841_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUW48803.1|572960_573590_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUW48804.1|573576_574242_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUW48805.1|574452_575721_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
AUW48806.1|575753_576653_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
AUW48807.1|576652_577270_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
AUW48808.1|577425_577668_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
AUW48809.1|577684_579463_+	oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
AUW48810.1|579475_580777_+	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
AUW48811.1|580829_581528_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48812.1|581561_582632_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
AUW48813.1|582724_584092_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
AUW52799.1|584248_584647_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48814.1|584839_585964_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUW48815.1|586266_586695_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUW48816.1|586710_587103_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUW48817.1|587102_587303_+	hypothetical protein	NA	NA	NA	NA	NA
587136:587164	attR	AAAAAACCCGCTTCGGCGGGTTTTTTTAT	NA	NA	NA	NA
AUW48818.1|587302_588055_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
AUW48819.1|588317_588956_+	stringent starvation protein A	NA	NA	NA	NA	NA
AUW48820.1|588961_589462_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 3
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	710212	754308	4900326	head,integrase,terminase,holin,portal,capsid,tRNA,tail	Cronobacter_phage(68.42%)	53	712979:712994	755364:755379
AUW48932.1|710212_711781_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	1.7e-12
AUW48933.1|711777_712425_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUW48934.1|712656_713424_+	siderophore-interacting protein	NA	NA	NA	NA	NA
712979:712994	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
AUW48935.1|713663_714452_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48936.1|714448_715471_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	63.7	5.5e-121
AUW48937.1|715474_716041_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
AUW48938.1|716057_716639_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.8	3.7e-29
AUW48939.1|716782_717004_+	regulator	NA	NA	NA	NA	NA
AUW48940.1|717034_717538_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AUW48941.1|717547_717775_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48942.1|717764_718190_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
AUW48943.1|718189_718591_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
AUW48944.1|718658_718889_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AUW48945.1|718879_719740_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
AUW48946.1|719736_721764_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	73.2	1.8e-293
AUW48947.1|721883_722090_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48948.1|722063_722387_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AUW48949.1|722383_723445_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
AUW48950.1|723441_725217_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	2.6e-291
AUW48951.1|725377_726181_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.7	4.5e-78
AUW48952.1|726242_727265_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AUW48953.1|727268_727970_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AUW48954.1|728015_728519_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	82.7	1.8e-64
AUW48955.1|728515_729022_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
AUW48956.1|729018_729726_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
AUW48957.1|729722_730850_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
AUW48958.1|730846_731302_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AUW48959.1|731311_731605_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AUW48960.1|731601_731943_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AUW48961.1|731942_732275_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
AUW48962.1|732246_732435_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AUW48963.1|732421_732679_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	2.8e-21
AUW48964.1|732866_734834_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	4.6e-273
AUW48965.1|734830_735160_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AUW48966.1|735156_736341_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	3.9e-179
AUW48967.1|736327_736921_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
AUW48968.1|736929_739170_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	82.7	6.5e-207
AUW48969.1|739139_739745_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	4.4e-102
AUW48970.1|739734_740460_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	6.6e-68
AUW48971.1|740431_740977_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	4.2e-59
AUW48972.1|740976_742680_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	7.6e-224
AUW48973.1|743431_743617_+	hypothetical protein	NA	NA	NA	NA	NA
AUW48974.1|743724_744351_+	reverse transcriptase	NA	NA	NA	NA	NA
AUW48975.1|744674_745181_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AUW48976.1|745304_747287_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AUW48977.1|747301_749044_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.5	8.1e-72
AUW48978.1|749279_749495_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUW48979.1|749722_750736_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
AUW48980.1|750639_750942_-	hypothetical protein	NA	NA	NA	NA	NA
AUW48981.1|750959_751577_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AUW48982.1|751683_752043_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AUW48983.1|752140_752962_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUW48984.1|753066_754308_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
755364:755379	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 4
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	1512654	1556198	4900326	lysis,terminase,portal,protease,coat,tail	Salmonella_phage(69.23%)	68	NA	NA
AUW49664.1|1512654_1513593_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUW49665.1|1513614_1513845_-	hypothetical protein	NA	I6S1L3	Salmonella_phage	84.1	7.5e-10
AUW49666.1|1513854_1514058_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	100.0	5.5e-33
AUW49667.1|1514154_1514529_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	100.0	2.0e-65
AUW49668.1|1514771_1515038_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
AUW49669.1|1515114_1515828_-	hypothetical protein	NA	A0A220NQU1	Salmonella_phage	66.4	4.8e-39
AUW49670.1|1515831_1516050_-	sugar acetyltransferase inhibitor	NA	B9UDM3	Salmonella_phage	100.0	2.4e-34
AUW49671.1|1516432_1516810_-	Eae protein	NA	I6R9B7	Salmonella_phage	96.0	1.8e-61
AUW49672.1|1516806_1516977_-	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AUW49673.1|1516987_1517281_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	95.9	1.3e-46
AUW49674.1|1517327_1517612_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AUW49675.1|1517611_1518319_-	recombinase	NA	A0A2H4FN95	Salmonella_phage	97.4	2.5e-136
AUW49676.1|1518327_1518516_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	95.2	1.4e-27
AUW49677.1|1518512_1518626_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AUW49678.1|1518618_1518759_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.6e-18
AUW49679.1|1518958_1520077_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	71.5	1.1e-66
AUW49680.1|1520265_1520760_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	62.8	4.3e-55
AUW49681.1|1520760_1521123_-	antitermination protein	NA	C6ZR44	Salmonella_phage	90.8	7.1e-55
AUW49682.1|1521490_1521694_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	1.0e-26
AUW49683.1|1521729_1522653_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
AUW52833.1|1522737_1523412_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	81.2	5.5e-101
AUW49684.1|1523555_1523780_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	89.0	6.8e-32
AUW49685.1|1523910_1524204_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	92.8	1.0e-40
AUW49686.1|1524384_1525233_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	1.7e-152
AUW49687.1|1525343_1527224_+	bifunctional DNA primase/helicase	NA	A0A0M4R313	Salmonella_phage	99.5	0.0e+00
AUW49688.1|1527224_1527503_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
AUW49689.1|1527575_1527902_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
AUW49690.1|1527898_1528099_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
AUW49691.1|1528110_1528440_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
AUW49692.1|1528396_1528843_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	7.8e-80
AUW49693.1|1528839_1529016_+	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
AUW49694.1|1529012_1529192_+	NinF family protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
AUW49695.1|1529166_1529775_+	protein NinG	NA	I6S604	Salmonella_phage	98.0	5.6e-97
AUW49696.1|1529771_1529996_+	protein ninY	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
AUW49697.1|1529992_1530196_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
AUW49698.1|1530176_1530356_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	7.8e-23
AUW49699.1|1530352_1530859_+	DUF1133 domain-containing protein	NA	A0A1R3Y5U9	Salmonella_virus	97.0	5.5e-90
AUW49700.1|1531065_1531578_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	100.0	4.7e-97
AUW49701.1|1532033_1532237_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	1.5e-33
AUW52834.1|1532214_1532712_+	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	2.4e-90
AUW49702.1|1532800_1533268_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	91.0	3.4e-70
AUW49703.1|1533302_1533494_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	93.7	3.3e-27
AUW49704.1|1533480_1534167_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
AUW49705.1|1534527_1534770_+	DUF2560 domain-containing protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
AUW49706.1|1534772_1535177_+	Decoration protein	NA	C6ZR73	Salmonella_phage	100.0	3.1e-67
AUW49707.1|1535180_1535669_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AUW49708.1|1535646_1537146_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	99.8	4.8e-307
AUW49709.1|1537145_1539323_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.0	0.0e+00
AUW49710.1|1539336_1540248_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	2.4e-160
AUW49711.1|1540247_1541543_+|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.8	2.2e-244
AUW49712.1|1541583_1542144_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	100.0	1.7e-103
AUW49713.1|1542127_1542628_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	8.7e-88
AUW49714.1|1542587_1544006_+	hypothetical protein	NA	B9UDK6	Salmonella_phage	96.2	4.4e-270
AUW49715.1|1544009_1544648_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	96.7	9.5e-87
AUW49716.1|1544647_1545103_+	hypothetical protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
AUW49717.1|1545105_1545798_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
AUW49718.1|1545808_1547173_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	72.0	7.0e-172
AUW49719.1|1547172_1549038_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	100.0	0.0e+00
AUW49720.1|1549055_1549244_-	hypothetical protein	NA	NA	NA	NA	NA
AUW52835.1|1549313_1549598_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	100.0	2.0e-41
AUW49721.1|1549766_1550036_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	100.0	2.9e-45
AUW49722.1|1550028_1550286_-	Arc family DNA-binding protein	NA	A0A2H4FVY6	Salmonella_phage	97.6	2.0e-40
AUW49723.1|1550376_1550535_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	92.3	9.3e-20
AUW49724.1|1550531_1550801_+	hypothetical protein	NA	NA	NA	NA	NA
AUW49725.1|1550863_1551754_+	phage antirepressor Ant	NA	I6R977	Salmonella_phage	98.3	1.3e-166
AUW49726.1|1551854_1553711_+|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	99.0	0.0e+00
AUW49727.1|1553773_1554943_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	100.0	3.7e-230
AUW49728.1|1555256_1556198_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 5
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	1796606	1805777	4900326	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AUW49947.1|1796606_1797554_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	2.2e-23
AUW49948.1|1797537_1798269_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUW49949.1|1798249_1798357_-	hypothetical protein	NA	NA	NA	NA	NA
AUW49950.1|1798416_1799148_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.4	5.9e-101
AUW49951.1|1799370_1801056_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AUW49952.1|1801052_1801772_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUW49953.1|1801818_1802286_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AUW49954.1|1802342_1802873_-	hypothetical protein	NA	NA	NA	NA	NA
AUW49955.1|1803044_1803503_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AUW49956.1|1803743_1805777_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	1879972	1890479	4900326		Enterobacteria_phage(37.5%)	10	NA	NA
AUW50015.1|1879972_1881376_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AUW50016.1|1881553_1882447_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AUW50017.1|1882823_1883909_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AUW50018.1|1883908_1884808_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AUW52844.1|1884855_1885734_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.0e-107
AUW50019.1|1885734_1886286_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	7.7e-53
AUW50020.1|1886291_1887266_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AUW50021.1|1887281_1888055_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AUW50022.1|1888059_1889139_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AUW50023.1|1889165_1890479_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 7
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	1999925	2007159	4900326		Morganella_phage(33.33%)	8	NA	NA
AUW50130.1|1999925_2000345_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AUW50131.1|2000347_2001616_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
AUW50132.1|2002070_2002283_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AUW52852.1|2002293_2002482_+	cold-shock protein	NA	NA	NA	NA	NA
AUW50133.1|2002740_2003919_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	1.1e-109
AUW50134.1|2004568_2004880_+	hypothetical protein	NA	NA	NA	NA	NA
AUW50135.1|2004959_2005655_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
AUW50136.1|2005728_2007159_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
CP026327	Salmonella enterica subsp. enterica serovar Kentucky strain PU131 chromosome, complete genome	4900326	4459552	4506628	4900326	tRNA,tail,plate	Burkholderia_phage(40.91%)	49	NA	NA
AUW52388.1|4459552_4460551_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUW52389.1|4460638_4461949_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUW52390.1|4462195_4462711_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AUW52391.1|4462810_4463020_-	CsbD family protein	NA	NA	NA	NA	NA
AUW52948.1|4463041_4463155_-	hypothetical protein	NA	NA	NA	NA	NA
AUW52392.1|4463151_4464477_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AUW52393.1|4464655_4465264_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AUW52394.1|4465372_4465741_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AUW52395.1|4465911_4468332_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUW52396.1|4468430_4469303_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUW52397.1|4469316_4469814_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUW52398.1|4469994_4470912_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AUW52399.1|4471075_4472434_-	maltoporin	NA	NA	NA	NA	NA
AUW52400.1|4472521_4473631_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AUW52401.1|4473992_4475183_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AUW52402.1|4475314_4476859_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AUW52403.1|4476873_4477764_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AUW52404.1|4477929_4478340_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AUW52405.1|4478482_4480579_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AUW52406.1|4480578_4481316_-	hypothetical protein	NA	NA	NA	NA	NA
AUW52407.1|4481312_4481951_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AUW52408.1|4482014_4482257_-	outer membrane protein	NA	NA	NA	NA	NA
AUW52409.1|4482700_4484350_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AUW52410.1|4484694_4486044_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AUW52411.1|4486174_4486522_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AUW52412.1|4487098_4487386_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AUW52413.1|4487388_4487994_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	4.2e-60
AUW52414.1|4488006_4488321_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
AUW52415.1|4488479_4488935_+	hypothetical protein	NA	NA	NA	NA	NA
AUW52416.1|4488931_4489129_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
AUW52417.1|4489118_4490546_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
AUW52418.1|4490545_4491070_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	9.5e-69
AUW52419.1|4491121_4491439_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AUW52420.1|4491398_4491527_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AUW52421.1|4491623_4493978_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.1e-67
AUW52422.1|4493977_4494931_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AUW52423.1|4494930_4495140_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AUW52424.1|4495127_4496171_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	5.5e-76
AUW52425.1|4496180_4496903_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AUW52426.1|4497230_4497593_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AUW52427.1|4497589_4498519_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AUW52428.1|4498529_4500077_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
AUW52429.1|4500240_4500600_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AUW52430.1|4500590_4501706_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.2	5.0e-99
AUW52431.1|4501698_4502331_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AUW52432.1|4502333_4504103_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	4.2e-52
AUW52433.1|4504107_4504713_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AUW52434.1|4504709_4505165_+	hypothetical protein	NA	NA	NA	NA	NA
AUW52435.1|4505899_4506628_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
