The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024072	Helicobacter pylori strain 7.13_R1b chromosome, complete genome	1674010	488978	527503	1674010	integrase,transposase,protease	Helicobacter_phage(40.0%)	36	496016:496035	527339:527358
AVG88195.1|488978_490127_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG88196.1|490095_490563_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG88197.1|493325_494393_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG88198.1|494709_495513_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88199.1|495484_495736_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88200.1|495873_496554_-|protease	CAAX protease	protease	NA	NA	NA	NA
496016:496035	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG88201.1|496774_497788_+	hypothetical protein	NA	NA	NA	NA	NA
AVG88202.1|497792_499070_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88203.1|499066_500323_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG88204.1|500319_501753_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88205.1|501762_503790_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88206.1|503789_504842_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG88207.1|505643_506312_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG88208.1|506358_506736_+	hypothetical protein	NA	NA	NA	NA	NA
AVG88209.1|506713_507379_+	hypothetical protein	NA	NA	NA	NA	NA
AVG88210.1|507452_508256_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG88211.1|508225_508711_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88212.1|508750_510811_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG88213.1|510831_512961_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG88214.1|512957_513476_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG88215.1|513472_514417_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG88216.1|514421_514697_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88217.1|514713_515676_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88218.1|515688_517929_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG88219.1|517912_519121_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88220.1|519117_520773_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG88221.1|520769_521906_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88222.1|521898_522039_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG88223.1|522035_524612_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG88224.1|524611_524848_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88225.1|524859_525123_-	competence protein ComB	NA	NA	NA	NA	NA
AVG88226.1|525134_525419_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88227.1|525396_525774_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88228.1|525766_525997_-	hypothetical protein	NA	NA	NA	NA	NA
AVG88229.1|525999_526824_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG88230.1|526837_527503_+|protease	CAAX protease	protease	NA	NA	NA	NA
527339:527358	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
