The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024073	Helicobacter pylori strain 7.13_R1c chromosome, complete genome	1674009	488979	527504	1674009	integrase,transposase,protease	Helicobacter_phage(40.0%)	36	496017:496036	527340:527359
AVG89679.1|488979_490128_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG89680.1|490096_490564_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG89681.1|493326_494394_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG89682.1|494710_495514_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89683.1|495485_495737_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89684.1|495874_496555_-|protease	CAAX protease	protease	NA	NA	NA	NA
496017:496036	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG89685.1|496775_497789_+	hypothetical protein	NA	NA	NA	NA	NA
AVG89686.1|497793_499071_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89687.1|499067_500324_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG89688.1|500320_501754_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89689.1|501763_503791_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89690.1|503790_504843_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG89691.1|505644_506313_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG89692.1|506359_506737_+	hypothetical protein	NA	NA	NA	NA	NA
AVG89693.1|506714_507380_+	hypothetical protein	NA	NA	NA	NA	NA
AVG89694.1|507453_508257_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG89695.1|508226_508712_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89696.1|508751_510812_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG89697.1|510832_512962_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG89698.1|512958_513477_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG89699.1|513473_514418_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG89700.1|514422_514698_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89701.1|514714_515677_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89702.1|515689_517930_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG89703.1|517913_519122_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89704.1|519118_520774_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG89705.1|520770_521907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89706.1|521899_522040_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG89707.1|522036_524613_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG89708.1|524612_524849_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89709.1|524860_525124_-	competence protein ComB	NA	NA	NA	NA	NA
AVG89710.1|525135_525420_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89711.1|525397_525775_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89712.1|525767_525998_-	hypothetical protein	NA	NA	NA	NA	NA
AVG89713.1|526000_526825_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG89714.1|526838_527504_+|protease	CAAX protease	protease	NA	NA	NA	NA
527340:527359	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
