The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024076	Helicobacter pylori strain 7.13_R2c chromosome, complete genome	1674009	488985	527510	1674009	transposase,protease,integrase	Helicobacter_phage(40.0%)	36	496023:496042	527346:527365
AVG94132.1|488985_490134_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG94133.1|490102_490570_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG94134.1|493332_494400_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG94135.1|494716_495520_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94136.1|495491_495743_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94137.1|495880_496561_-|protease	CAAX protease	protease	NA	NA	NA	NA
496023:496042	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG94138.1|496781_497795_+	hypothetical protein	NA	NA	NA	NA	NA
AVG94139.1|497799_499077_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94140.1|499073_500330_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG94141.1|500326_501760_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94142.1|501769_503797_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94143.1|503796_504849_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG94144.1|505650_506319_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG94145.1|506365_506743_+	hypothetical protein	NA	NA	NA	NA	NA
AVG94146.1|506720_507386_+	hypothetical protein	NA	NA	NA	NA	NA
AVG94147.1|507459_508263_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG94148.1|508232_508718_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94149.1|508757_510818_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG94150.1|510838_512968_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG94151.1|512964_513483_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG94152.1|513479_514424_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG94153.1|514428_514704_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94154.1|514720_515683_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94155.1|515695_517936_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG94156.1|517919_519128_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94157.1|519124_520780_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG94158.1|520776_521913_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94159.1|521905_522046_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG94160.1|522042_524619_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG94161.1|524618_524855_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94162.1|524866_525130_-	competence protein ComB	NA	NA	NA	NA	NA
AVG94163.1|525141_525426_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94164.1|525403_525781_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94165.1|525773_526004_-	hypothetical protein	NA	NA	NA	NA	NA
AVG94166.1|526006_526831_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG94167.1|526844_527510_+|protease	CAAX protease	protease	NA	NA	NA	NA
527346:527365	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
