The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024079	Helicobacter pylori strain 7.13_R3c chromosome, complete genome	1674018	488987	527512	1674018	integrase,protease,transposase	Helicobacter_phage(40.0%)	36	496025:496044	527348:527367
AVG98584.1|488987_490136_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG98585.1|490104_490572_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG98586.1|493334_494402_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG98587.1|494718_495522_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98588.1|495493_495745_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98589.1|495882_496563_-|protease	CAAX protease	protease	NA	NA	NA	NA
496025:496044	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG98590.1|496783_497797_+	hypothetical protein	NA	NA	NA	NA	NA
AVG98591.1|497801_499079_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98592.1|499075_500332_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG98593.1|500328_501762_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98594.1|501771_503799_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98595.1|503798_504851_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG98596.1|505652_506321_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG98597.1|506367_506745_+	hypothetical protein	NA	NA	NA	NA	NA
AVG98598.1|506722_507388_+	hypothetical protein	NA	NA	NA	NA	NA
AVG98599.1|507461_508265_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG98600.1|508234_508720_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98601.1|508759_510820_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG98602.1|510840_512970_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG98603.1|512966_513485_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG98604.1|513481_514426_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG98605.1|514430_514706_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98606.1|514722_515685_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98607.1|515697_517938_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG98608.1|517921_519130_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98609.1|519126_520782_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG98610.1|520778_521915_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98611.1|521907_522048_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG98612.1|522044_524621_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG98613.1|524620_524857_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98614.1|524868_525132_-	competence protein ComB	NA	NA	NA	NA	NA
AVG98615.1|525143_525428_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98616.1|525405_525783_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98617.1|525775_526006_-	hypothetical protein	NA	NA	NA	NA	NA
AVG98618.1|526008_526833_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG98619.1|526846_527512_+|protease	CAAX protease	protease	NA	NA	NA	NA
527348:527367	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
