The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024017	Helicobacter pylori strain 7.13_D1c chromosome, complete genome	1674163	488992	527517	1674163	integrase,protease,transposase	Helicobacter_phage(40.0%)	36	496030:496049	527353:527372
AVH02932.1|488992_490141_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVH02933.1|490109_490577_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVH02934.1|493339_494407_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVH02935.1|494723_495527_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02936.1|495498_495750_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02937.1|495887_496568_-|protease	CAAX protease	protease	NA	NA	NA	NA
496030:496049	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVH02938.1|496788_497802_+	hypothetical protein	NA	NA	NA	NA	NA
AVH02939.1|497806_499084_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02940.1|499080_500337_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVH02941.1|500333_501767_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02942.1|501776_503804_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02943.1|503803_504856_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVH02944.1|505657_506326_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVH02945.1|506372_506750_+	hypothetical protein	NA	NA	NA	NA	NA
AVH02946.1|506727_507393_+	hypothetical protein	NA	NA	NA	NA	NA
AVH02947.1|507466_508270_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVH02948.1|508239_508725_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02949.1|508764_510825_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVH02950.1|510845_512975_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVH02951.1|512971_513490_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVH02952.1|513486_514431_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVH02953.1|514435_514711_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02954.1|514727_515690_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02955.1|515702_517943_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVH02956.1|517926_519135_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02957.1|519131_520787_-	type VI secretion protein	NA	NA	NA	NA	NA
AVH02958.1|520783_521920_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02959.1|521912_522053_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVH02960.1|522049_524626_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVH02961.1|524625_524862_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02962.1|524873_525137_-	competence protein ComB	NA	NA	NA	NA	NA
AVH02963.1|525148_525433_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02964.1|525410_525788_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02965.1|525780_526011_-	hypothetical protein	NA	NA	NA	NA	NA
AVH02966.1|526013_526838_-|integrase	integrase	integrase	NA	NA	NA	NA
AVH02967.1|526851_527517_+|protease	CAAX protease	protease	NA	NA	NA	NA
527353:527372	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
