The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024015	Helicobacter pylori strain 7.13_D1a chromosome, complete genome	1674120	488983	527512	1674120	transposase,protease,integrase	Helicobacter_phage(40.0%)	34	496021:496040	527348:527367
AVH00069.1|488983_490132_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVH00070.1|490100_490568_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVH00071.1|493330_494398_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVH00072.1|494714_495518_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00073.1|495489_495741_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00074.1|495878_496559_-|protease	CAAX protease	protease	NA	NA	NA	NA
496021:496040	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVH00075.1|496779_497133_+	hypothetical protein	NA	NA	NA	NA	NA
AVH01018.1|497164_497794_+	hypothetical protein	NA	NA	NA	NA	NA
AVH00076.1|497798_499076_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00077.1|499072_500329_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVH00078.1|500325_501759_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00079.1|503796_504849_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVH00080.1|505650_506319_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVH00081.1|506365_506743_+	hypothetical protein	NA	NA	NA	NA	NA
AVH00082.1|506720_507386_+	hypothetical protein	NA	NA	NA	NA	NA
AVH00083.1|507459_508263_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVH00084.1|508232_508718_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00085.1|508757_510818_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVH00086.1|512965_513484_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVH00087.1|513480_514425_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVH00088.1|514429_514705_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00089.1|514721_515684_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00090.1|515696_517937_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVH00091.1|517920_519129_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00092.1|519125_520781_-	type VI secretion protein	NA	NA	NA	NA	NA
AVH00093.1|520777_521914_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00094.1|521906_522047_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVH00095.1|524620_524857_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00096.1|524868_525132_-	competence protein ComB	NA	NA	NA	NA	NA
AVH00097.1|525143_525428_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00098.1|525405_525783_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00099.1|525775_526006_-	hypothetical protein	NA	NA	NA	NA	NA
AVH00100.1|526008_526833_-|integrase	integrase	integrase	NA	NA	NA	NA
AVH00101.1|526846_527512_+|protease	CAAX protease	protease	NA	NA	NA	NA
527348:527367	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
