The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	106871	118581	4268596	transposase	Paenibacillus_phage(50.0%)	13	NA	NA
AVF29140.1|106871_108341_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.6	6.5e-123
AVF29141.1|108380_109904_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.3e-123
AVF29142.1|110161_111343_+	flagellin	NA	NA	NA	NA	NA
AVF29143.1|111494_111869_+	flagellar protein FlaG	NA	NA	NA	NA	NA
AVF29144.1|111895_113452_+	flagellar hook-associated protein	NA	NA	NA	NA	NA
AVF29145.1|113474_113876_+	flagellar protein FliS	NA	NA	NA	NA	NA
AVF29146.1|113859_114198_+	flagellar protein FliT	NA	NA	NA	NA	NA
AVF29147.1|114288_114972_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29148.1|115142_115862_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29149.1|116269_116467_+	cold shock-like protein CspC	NA	Q9AZD3	Lactococcus_phage	66.1	4.9e-18
AVF29150.1|116788_117337_+	SigL modulation protein	NA	NA	NA	NA	NA
AVF29151.1|117702_118179_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF29152.1|118206_118581_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
>prophage 2
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	242584	307309	4268596	tRNA,transposase,bacteriocin,protease	Paenibacillus_phage(17.65%)	59	NA	NA
AVF29264.1|242584_243601_+|tRNA	putative tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AVF29265.1|243868_244351_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVF29266.1|244477_245974_+|tRNA	lysine--tRNA ligase LysS	tRNA	A0A1V0SAC0	Catovirus	40.7	3.2e-93
AVF29267.1|252885_253203_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29268.1|253290_254868_-	putative glucose dehydrogenase	NA	NA	NA	NA	NA
AVF29269.1|254860_255457_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29270.1|255462_255855_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29271.1|256043_256994_+	putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase TagO	NA	NA	NA	NA	NA
AVF29272.1|257075_258182_+	lipoyl synthase-like protein	NA	NA	NA	NA	NA
AVF29273.1|258280_259402_+	maltodextrin import ATP-binding protein MsmX	NA	Q6GZ03	Mycoplasma_phage	32.3	2.7e-20
AVF29274.1|259528_260464_+	HPr kinase/phosphorylase HprK	NA	NA	NA	NA	NA
AVF29275.1|260502_261513_+	prolipoprotein diacylglyceryl transferase Lgt	NA	NA	NA	NA	NA
AVF29276.1|261509_262175_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AVF29277.1|262158_262683_+	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF29278.1|262799_263552_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	99.2	3.8e-135
AVF29279.1|263685_264369_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF29280.1|264718_265945_+	ATP phosphoribosyltransferase regulatory subunit HisZ	NA	NA	NA	NA	NA
AVF29281.1|265937_266573_+	ATP phosphoribosyltransferase HisG	NA	NA	NA	NA	NA
AVF29282.1|266595_267882_+	histidinol dehydrogenase HisD	NA	NA	NA	NA	NA
AVF29283.1|267878_268478_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
AVF29284.1|268481_269087_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AVF29285.1|269215_269950_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase HisA	NA	NA	NA	NA	NA
AVF29286.1|270036_270795_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AVF29287.1|270791_271520_+	histidine biosynthesis bifunctional protein HisIE	NA	NA	NA	NA	NA
AVF29288.1|271589_272396_+	putative histidinol-phosphatase HisK	NA	NA	NA	NA	NA
AVF29289.1|272601_273552_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	32.7	7.8e-37
AVF29290.1|273632_275399_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVF29291.1|275415_276363_+	thioredoxin reductase TrxB	NA	A0A2I2L5E1	Orpheovirus	49.4	1.5e-72
AVF29292.1|276554_277502_+	putative glucokinase	NA	NA	NA	NA	NA
AVF29293.1|277562_278444_+	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	30.3	2.3e-06
AVF29294.1|278455_279433_+	putative membrane protein	NA	A1IMD5	Streptococcus_phage	39.2	5.4e-57
AVF29295.1|279438_280374_+	putative sporulation transcription regulator WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	8.2e-55
AVF29296.1|280646_280916_+	HPr-like protein Crh	NA	NA	NA	NA	NA
AVF29297.1|281025_281259_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29298.1|281285_281909_-	Yip1 domain protein	NA	NA	NA	NA	NA
AVF29299.1|281942_282527_-	integral membrane protein	NA	NA	NA	NA	NA
AVF29300.1|282513_283233_-	ATP-binding transport protein NatA	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	1.9e-22
AVF29301.1|283229_284885_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29302.1|284942_285167_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF29303.1|285387_285969_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	57.6	7.4e-54
AVF29304.1|286504_287533_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
AVF29305.1|287589_288594_+	glyceraldehyde-3-phosphate dehydrogenase Gap	NA	NA	NA	NA	NA
AVF29306.1|288731_289913_+	phosphoglycerate kinase Pgk	NA	NA	NA	NA	NA
AVF29307.1|289934_290687_+	triosephosphate isomerase TpiA	NA	NA	NA	NA	NA
AVF29308.1|290688_292227_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF29309.1|292383_293676_+	enolase Eno	NA	W6LP63	Streptococcus_phage	71.7	2.5e-171
AVF29310.1|293744_294458_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29311.1|294590_294827_+	Preprotein translocase band 1 subunit	NA	NA	NA	NA	NA
AVF29312.1|295106_297611_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.7	4.5e-92
AVF29313.1|297863_298343_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	8.2e-43
AVF29314.1|299811_300129_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29315.1|300811_302689_+	Excinuclease ABC subunit B	NA	A0A097BY72	Enterococcus_phage	22.8	2.8e-22
AVF29316.1|302678_302993_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29317.1|303088_303448_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29318.1|303394_304615_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF29319.1|304737_305508_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29320.1|306259_306628_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29321.1|306783_306873_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29322.1|307027_307309_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
>prophage 3
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	381229	412156	4268596	tRNA,transposase,integrase,protease	Paenibacillus_phage(36.36%)	37	382303:382319	405433:405449
AVF29390.1|381229_381598_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF29391.1|381618_381942_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	97.2	2.8e-55
AVF29392.1|381964_382915_-	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
382303:382319	attL	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
AVF29393.1|383111_384851_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	NA	NA	NA	NA
AVF29394.1|384876_385134_-	HPr-like protein	NA	NA	NA	NA	NA
AVF29395.1|385286_385739_-	PTS system, fructose subfamily, IIA component	NA	NA	NA	NA	NA
AVF29396.1|385757_387197_-	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF29397.1|387614_388094_+	ATP-binding protein YdiB	NA	NA	NA	NA	NA
AVF29398.1|388090_388969_+|protease	chaperone-like protein/protease-like protein	protease	NA	NA	NA	NA
AVF29399.1|388984_389494_+	putative ribosomal-protein-alanine acetyltransferase RimI	NA	NA	NA	NA	NA
AVF29400.1|389515_390535_+|tRNA	putative tRNA threonylcarbamoyladenosine biosynthesis protein Gcp	tRNA	A0A0R6PI74	Moraxella_phage	40.0	4.3e-65
AVF29401.1|390666_391806_-	Glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.2	8.8e-51
AVF29402.1|392244_392586_-	carbohydrate diacid transcriptional activator CdaR	NA	NA	NA	NA	NA
AVF29403.1|392545_392659_-	Sugar diacid regulator	NA	NA	NA	NA	NA
AVF29404.1|392874_393024_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29405.1|393291_394308_+	peptidase U61 LD-carboxypeptidase A	NA	NA	NA	NA	NA
AVF29406.1|394403_396335_-	putative ABC transporter ATP-binding protein YdiF	NA	A0A2K9L3Z8	Tupanvirus	30.7	8.7e-59
AVF29407.1|396610_397246_+	5-formyltetrahydrofolate cyclo-ligase-like protein	NA	NA	NA	NA	NA
AVF29408.1|397304_397757_+	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AVF29409.1|397775_398267_+	molybdopterin adenylyltransferase Mog	NA	NA	NA	NA	NA
AVF29410.1|398263_399274_+	molybdene to molybdopterin ligation enzyme-like protein	NA	NA	NA	NA	NA
AVF29411.1|399305_399569_+	twin-arginine translocation protein, TatA/E family subunit	NA	NA	NA	NA	NA
AVF29412.1|399568_400375_+	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.5e-12
AVF29413.1|400367_400622_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29414.1|400696_400978_+	10 kDa chaperonin	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
AVF29415.1|401067_402696_+	60 kDa chaperonin	NA	A0A219YK78	uncultured_virus	59.1	8.1e-159
AVF29416.1|402784_403009_-|integrase	integrase	integrase	A0A0C5AN64	Paenibacillus_phage	69.9	2.0e-20
AVF29417.1|403230_403434_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29418.1|403348_403822_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29419.1|405106_405232_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29420.1|405443_405845_+	YmaF family protein	NA	NA	NA	NA	NA
405433:405449	attR	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
AVF29421.1|406664_406916_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29422.1|407110_407293_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29423.1|407302_407518_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF29424.1|408266_410042_+	GlcNAc-binding protein A	NA	NA	NA	NA	NA
AVF29425.1|410283_410955_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	96.9	2.5e-130
AVF29426.1|411340_412156_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
>prophage 4
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	417727	511415	4268596	coat,transposase,protease,tRNA,integrase	Paenibacillus_phage(51.16%)	105	407669:407697	506979:507007
407669:407697	attL	TAAAAATAACCTGCCGCTAAGACAGGTTA	NA	NA	NA	NA
AVF29432.1|417727_419362_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.8	1.0e-76
AVF29433.1|419466_420690_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF29434.1|420722_420917_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29435.1|420876_422139_+	toxin-like protein	NA	R9VWV6	Paenibacillus_phage	58.2	1.9e-14
AVF29436.1|422277_422889_+	toxin-like protein	NA	NA	NA	NA	NA
AVF29437.1|422966_423395_+	putative lethal factor domain protein	NA	NA	NA	NA	NA
AVF29438.1|423480_423705_+	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
AVF29439.1|423706_423805_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29440.1|423816_424632_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF29441.1|424679_424967_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF29442.1|425123_425375_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7QIN4	Bacillus_phage	52.0	2.8e-10
AVF29443.1|425332_425485_+	N-acetylmuramoyl-l-alanine amidase	NA	NA	NA	NA	NA
AVF29444.1|425511_425754_+	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
AVF29445.1|425902_426121_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29446.1|426092_426632_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29447.1|428233_428383_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29448.1|429112_430033_+	DNA polymerase IV 2	NA	O64031	Bacillus_phage	37.6	1.3e-44
AVF29449.1|430099_430240_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29450.1|430215_431346_+	Fic/DOC family protein	NA	NA	NA	NA	NA
AVF29451.1|431426_431564_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29452.1|431846_432467_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29453.1|432878_433874_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF29454.1|434346_434523_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29455.1|434569_434812_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29456.1|435570_437022_+	amino acid antiporter	NA	NA	NA	NA	NA
AVF29457.1|437033_438902_+	decarboxylase	NA	NA	NA	NA	NA
AVF29458.1|438972_440361_+	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF29459.1|440910_442173_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.2e-87
AVF29460.1|442204_442906_+	Replication protein	NA	NA	NA	NA	NA
AVF29461.1|443860_445309_+	putative transporter	NA	NA	NA	NA	NA
AVF29462.1|445366_447229_+	decarboxylase	NA	NA	NA	NA	NA
AVF29463.1|447338_448154_+	pyridoxine kinase PdxK	NA	NA	NA	NA	NA
AVF29464.1|448245_449631_+	putative tyrosine permease, NhaC family	NA	NA	NA	NA	NA
AVF29465.1|449917_450214_+	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVF29466.1|450469_451174_+	putative membrane protein	NA	NA	NA	NA	NA
AVF29467.1|451402_452218_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	D6QWP2	uncultured_phage	52.9	1.7e-40
AVF29468.1|452457_453288_+	Chitinase D precursor	NA	NA	NA	NA	NA
AVF29469.1|453782_454340_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.4	5.4e-38
AVF29470.1|454336_455296_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.7	6.6e-76
AVF29471.1|455292_456147_+|coat	spore coat polysaccharide biosynthesis protein SpsK	coat	NA	NA	NA	NA
AVF29472.1|456390_456972_+	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF29473.1|457262_457895_-	transporter-like protein	NA	NA	NA	NA	NA
AVF29474.1|458430_458754_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29475.1|458811_460176_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF29476.1|460162_460339_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29477.1|460503_461010_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29478.1|461028_461355_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29479.1|462018_462252_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29480.1|462270_463152_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29481.1|463174_464107_+	CRISPR-associated RAMP Cmr1 family protein	NA	NA	NA	NA	NA
AVF29482.1|464106_465780_+	CRISPR-associated RAMP Crm2 family protein	NA	NA	NA	NA	NA
AVF29483.1|465782_466904_+	CRISPR-associated protein, Cmr3 family	NA	NA	NA	NA	NA
AVF29484.1|466896_467814_+	CRISPR-associated RAMP protein, Cmr4 family	NA	NA	NA	NA	NA
AVF29485.1|467797_468202_+	CRISPR-associated protein, Cmr5 family	NA	NA	NA	NA	NA
AVF29486.1|468164_469034_+	CRISPR-associated RAMP Cmr6 family protein	NA	NA	NA	NA	NA
AVF29487.1|469329_469494_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	54.5	2.5e-07
AVF29488.1|469490_470219_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	68.3	4.9e-15
AVF29489.1|470469_470775_-	oxygen regulatory protein NreC	NA	NA	NA	NA	NA
AVF29490.1|470934_471606_+	ABC-transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
AVF29491.1|471602_471773_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29492.1|471792_472086_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	3.7e-14
AVF29493.1|472181_472556_-|transposase	putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	69.7	5.1e-48
AVF29494.1|473736_474225_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29495.1|474242_474611_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF29496.1|474631_475006_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.0	1.3e-64
AVF29497.1|475676_476933_+	sporulation protein YdcC	NA	NA	NA	NA	NA
AVF29498.1|477100_478288_+	alanine racemase Alr	NA	NA	NA	NA	NA
AVF29499.1|478522_478804_+	putative transcriptional regulator, CopG family	NA	NA	NA	NA	NA
AVF29500.1|478807_479158_+	mRNA interferase NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
AVF29501.1|479245_481534_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29502.1|481735_482284_-	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF29503.1|482699_483158_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29504.1|483190_483292_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29505.1|483242_483470_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29506.1|483725_484925_+|protease	minor extracellular protease Epr	protease	A0A217EQY2	Bacillus_phage	38.8	3.4e-45
AVF29507.1|485502_485859_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29508.1|485957_486428_+	SprT-like protein	NA	NA	NA	NA	NA
AVF29509.1|487150_487849_-|integrase	phage integrase-like protein	integrase	A0A2I7SC08	Paenibacillus_phage	58.4	1.9e-72
AVF29510.1|487836_488127_-|integrase	phage integrase family protein	integrase	S5MNZ2	Brevibacillus_phage	53.4	1.2e-15
AVF29511.1|488139_488904_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF29512.1|489203_489794_+	phage structural protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
AVF29513.1|489805_490096_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
AVF29514.1|490095_490254_+	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	60.9	4.3e-09
AVF29515.1|490409_490646_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
AVF29516.1|490642_491314_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	96.4	1.2e-129
AVF29517.1|491323_491569_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
AVF29518.1|492317_492476_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29519.1|493054_493501_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29520.1|493688_494441_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	8.4e-135
AVF29521.1|494578_495262_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
AVF29522.1|496190_496835_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
AVF29523.1|496811_497642_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	1.5e-153
AVF29524.1|497647_497929_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
AVF29525.1|497953_499351_+	1-phosphatidylinositol phosphodiesterase precursor	NA	NA	NA	NA	NA
AVF29526.1|499712_500396_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29527.1|500533_501286_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF29528.1|501871_503146_+	toxin-like protein	NA	NA	NA	NA	NA
AVF29529.1|503216_505829_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	33.4	2.6e-98
AVF29530.1|506354_506960_+	putative ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	9.7e-33
AVF29531.1|507314_508286_+	toxin-like protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
506979:507007	attR	TAACCTGTCTTAGCGGCAGGTTATTTTTA	NA	NA	NA	NA
AVF29532.1|508345_509365_+	toxin-like protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
AVF29533.1|509381_509789_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29534.1|510145_510427_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
AVF29535.1|510432_511263_+|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	1.5e-153
AVF29536.1|511316_511415_+	hypothetical protein	NA	A0A2I7SCT3	Paenibacillus_phage	96.9	2.3e-08
>prophage 5
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	595355	638314	4268596	bacteriocin,transposase	Paenibacillus_phage(36.36%)	47	NA	NA
AVF29633.1|595355_595691_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF29634.1|595982_596297_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29635.1|596648_597737_+	3-isopropylmalate dehydrogenase LeuB	NA	NA	NA	NA	NA
AVF29636.1|597961_598507_+	thioredoxin-like protein YkuU	NA	NA	NA	NA	NA
AVF29637.1|598651_599047_+	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVF29638.1|599084_601055_-	glycosyl hydrolase, family 15	NA	NA	NA	NA	NA
AVF29639.1|601101_601302_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29640.1|601489_601915_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29641.1|602215_602899_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29642.1|603069_603789_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29643.1|603895_604855_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29644.1|605073_605892_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
AVF29645.1|605884_606997_+	sigmaI modulating factor-like protein	NA	NA	NA	NA	NA
AVF29646.1|607209_608115_+	sporulation kinase A	NA	NA	NA	NA	NA
AVF29647.1|608186_608906_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29648.1|609076_609760_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29649.1|609873_610329_+	sporulation kinase A	NA	NA	NA	NA	NA
AVF29650.1|610469_611009_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29651.1|611369_612836_-	putative glycine dehydrogenase [decarboxylating] subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	1.8e-80
AVF29652.1|612832_614188_-	putative glycine dehydrogenase [decarboxylating] subunit 1	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
AVF29653.1|614228_615335_-	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVF29654.1|615951_616341_+	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVF29655.1|616562_616997_+	UspA domain-containing protein	NA	NA	NA	NA	NA
AVF29656.1|617311_617581_+	ribokinase-like protein	NA	NA	NA	NA	NA
AVF29657.1|617610_618567_+	thymidylate synthase ThyA	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
AVF29658.1|618621_619107_+	dihydrofolate reductase DfrA	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
AVF29659.1|619051_619192_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29660.1|619175_619484_+	Copper-sensitive operon repressor	NA	NA	NA	NA	NA
AVF29661.1|619504_619705_+	copper insertion chaperone and transporter component-like protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
AVF29662.1|619799_622226_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
AVF29663.1|622282_622906_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29664.1|622995_623673_-	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVF29665.1|623669_624476_-	histidine kinase	NA	NA	NA	NA	NA
AVF29666.1|624765_625008_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29667.1|625731_626016_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29668.1|626188_627874_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AVF29669.1|628183_628540_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29670.1|628766_629429_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29671.1|630336_631038_-	nitric oxide-dependent regulator	NA	NA	NA	NA	NA
AVF29672.1|631395_632628_+	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
AVF29673.1|632652_633891_+	nitrite reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVF29674.1|634028_634193_+	Rubredoxin-2	NA	NA	NA	NA	NA
AVF29675.1|634264_634972_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVF29676.1|635247_635901_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29677.1|636017_637199_-	putative membrane protein	NA	NA	NA	NA	NA
AVF29678.1|637384_637549_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29679.1|638095_638314_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.2	2.5e-07
>prophage 6
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	706687	749573	4268596	tRNA,transposase,protease	Bacillus_phage(27.78%)	38	NA	NA
AVF29744.1|706687_708637_+|tRNA	threonine--tRNA ligase ThrS	tRNA	A0A2K9L6B6	Tupanvirus	36.2	6.0e-124
AVF29745.1|708779_709463_+	3D domain protein	NA	L0LBX4	Bacillus_phage	35.9	6.7e-14
AVF29746.1|709584_709947_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29747.1|710171_711206_+	putative membrane protein	NA	NA	NA	NA	NA
AVF29748.1|711209_712244_+	sensor histidine kinase LiaS	NA	NA	NA	NA	NA
AVF29749.1|713167_714676_+|protease	putative serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.1	1.9e-21
AVF29750.1|714837_715527_+	response regulator MprA	NA	W8CYM9	Bacillus_phage	40.1	5.1e-38
AVF29751.1|715527_717033_+	sensory transduction histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	1.9e-24
AVF29752.1|717104_718058_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase IspH	NA	NA	NA	NA	NA
AVF29753.1|718368_719337_+	deoxyribonucleoside regulator	NA	NA	NA	NA	NA
AVF29754.1|719798_720983_+	pyrimidine nucleoside transport protein NupC	NA	NA	NA	NA	NA
AVF29755.1|721026_722331_+	pyrimidine-nucleoside phosphorylase Pdp	NA	A0A0H3UZD4	Geobacillus_virus	57.4	3.1e-137
AVF29756.1|722413_723091_+	deoxyribose-phosphate aldolase DeoC	NA	NA	NA	NA	NA
AVF29757.1|723382_723553_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.8e-22
AVF29758.1|723598_724606_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.4	1.8e-185
AVF29759.1|725061_726486_+	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVF29760.1|726585_727257_-	putative transporter protein	NA	G3MA03	Bacillus_virus	48.5	3.3e-21
AVF29761.1|727451_728060_-	2'-5' RNA-ligase-like protein	NA	NA	NA	NA	NA
AVF29762.1|728233_729322_+	phosphoserine aminotransferase SerC	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-89
AVF29763.1|729492_729957_+|tRNA	putative tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AVF29764.1|730162_730420_+	transcriptional regulator-like protein	NA	S5MA41	Brevibacillus_phage	48.0	3.6e-13
AVF29765.1|730793_731738_-	molybdate binding regulator-like protein	NA	NA	NA	NA	NA
AVF29766.1|731984_732812_+	molybdate-binding lipoprotein-like protein	NA	NA	NA	NA	NA
AVF29767.1|732814_733474_+	molybdenum transport permease-like protein	NA	NA	NA	NA	NA
AVF29768.1|733513_734497_+	thioredoxin reductase	NA	NA	NA	NA	NA
AVF29769.1|734551_735292_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29770.1|735498_737394_+	putative serine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	1.3e-102
AVF29771.1|737511_740082_-	Phosphatidylglycerol lysyltransferase	NA	NA	NA	NA	NA
AVF29772.1|740488_740686_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29773.1|741006_742938_+	zinc-transporting ATPase ZosA	NA	E4ZFI9	Streptococcus_phage	40.6	1.3e-126
AVF29774.1|743066_743273_+	putative conjugation protein	NA	NA	NA	NA	NA
AVF29775.1|743533_743734_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	3.7e-05
AVF29776.1|743873_745040_-	putative transporter protein	NA	NA	NA	NA	NA
AVF29777.1|745066_746632_-	putative ABC transporter ATP-binding protein YdiF	NA	A0A2K9L3Z8	Tupanvirus	31.0	8.3e-52
AVF29778.1|746799_746967_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29779.1|747734_748022_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF29780.1|748069_748885_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF29781.1|749105_749573_+|transposase	transposase	transposase	A0A142F192	Bacillus_phage	77.4	4.6e-06
>prophage 7
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	763737	849233	4268596	head,transposase,protease,integrase,terminase,capsid,tail,portal	Paenibacillus_phage(65.33%)	113	768921:768980	830684:832406
AVF29796.1|763737_764961_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF29797.1|765360_765624_+	site-specific recombinase XerD	NA	NA	NA	NA	NA
AVF29798.1|765936_766221_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF29799.1|766735_767107_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29800.1|767183_768695_+	sporulation kinase	NA	NA	NA	NA	NA
AVF29801.1|768718_768943_+	hypothetical protein	NA	NA	NA	NA	NA
768921:768980	attL	ATGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGA	NA	NA	NA	NA
AVF29802.1|768990_769674_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29803.1|769844_770564_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29804.1|770763_771180_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29805.1|771444_771756_+	RNA binding-like protein	NA	NA	NA	NA	NA
AVF29806.1|771841_772108_+	Two component transcriptional regulator, AraC family	NA	NA	NA	NA	NA
AVF29807.1|772154_772796_-	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
AVF29808.1|772931_774038_-	methylthioribose-1-phosphate isomerase 1	NA	NA	NA	NA	NA
AVF29809.1|774057_775287_-	methylthioribose kinase MtnK	NA	NA	NA	NA	NA
AVF29810.1|775505_775955_+	DNA protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
AVF29811.1|776126_776699_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29812.1|776879_777713_+	FeS assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
AVF29813.1|777780_779076_+	FeS assembly protein SufD	NA	NA	NA	NA	NA
AVF29814.1|779072_780299_+	putative cysteine desulfurase Csd	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
AVF29815.1|780285_780723_+	SUF system FeS assembly protein, NifU family	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
AVF29816.1|780747_782145_+	FeS cluster assembly protein SufB	NA	NA	NA	NA	NA
AVF29817.1|782226_783435_-|integrase	integrase Int	integrase	S5MBZ0	Brevibacillus_phage	37.2	3.8e-60
AVF29818.1|783475_784108_-	LexA repressor	NA	A0A1B2APZ3	Phage_Wrath	67.6	3.2e-79
AVF29819.1|784260_784509_+	helix-turn-helix protein	NA	A0A1B2APZ4	Phage_Wrath	68.0	4.6e-21
AVF29820.1|784533_784815_+	hypothetical protein	NA	A0A1B1P7U4	Bacillus_phage	56.0	7.2e-23
AVF29821.1|784899_785154_+	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	91.5	1.3e-34
AVF29822.1|785150_785522_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	8.5e-56
AVF29823.1|785518_785743_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
AVF29824.1|785739_785910_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
AVF29825.1|785914_786103_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29826.1|786099_786777_+	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
AVF29827.1|786791_787055_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
AVF29828.1|787057_787228_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29829.1|787224_787401_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29830.1|787489_788380_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
AVF29831.1|788342_789146_+	phage related protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
AVF29832.1|789195_789597_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
AVF29833.1|789621_789954_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
AVF29834.1|790002_790893_+	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
AVF29835.1|790855_791605_+	phage-related protein	NA	A0A0K2CYY7	Paenibacillus_phage	96.8	7.9e-117
AVF29836.1|791722_791953_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	98.6	9.7e-34
AVF29837.1|791933_792455_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	53.5	1.5e-50
AVF29838.1|792636_792867_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	66.2	6.1e-20
AVF29839.1|792879_793338_+	hypothetical protein	NA	A0A0C5AET2	Bacteriophage	98.7	2.1e-88
AVF29840.1|793427_793796_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	1.4e-13
AVF29841.1|793802_794036_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	69.8	1.7e-14
AVF29842.1|794028_794439_+	YopX protein	NA	A8ASP1	Listeria_phage	39.4	8.9e-14
AVF29843.1|794428_794665_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29844.1|794692_795130_+	phage transcriptional regulator, ArpU family	NA	A0A0K2CYZ6	Paenibacillus_phage	95.9	2.5e-70
AVF29845.1|795335_795677_+	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	8.4e-58
AVF29846.1|795687_797151_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
AVF29847.1|797313_797592_+	hypothetical protein	NA	E5DV94	Deep-sea_thermophilic_phage	42.9	5.9e-09
AVF29848.1|797575_797776_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29849.1|797772_798087_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	86.5	8.3e-44
AVF29850.1|798073_798415_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	98.2	4.4e-59
AVF29851.1|798549_798867_+|terminase	putative phage terminase, small subunit, P27 family	terminase	A0A0C5AMZ2	Paenibacillus_phage	89.5	1.7e-44
AVF29852.1|798841_800575_+|terminase	Phage terminase-like protein, large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	63.5	1.1e-214
AVF29853.1|800593_801853_+|portal	phage portal protein, HK97 family	portal	A0A0A7RUE7	Clostridium_phage	22.9	4.9e-18
AVF29854.1|801809_802391_+|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	34.0	4.4e-14
AVF29855.1|802396_803587_+|capsid	phage major capsid protein, HK97 family	capsid	NA	NA	NA	NA
AVF29856.1|803588_803885_+	putative phage protein (possible DNA packaging)	NA	A0A2H4J6E5	uncultured_Caudovirales_phage	40.7	2.9e-14
AVF29857.1|803847_804180_+|head,tail	putative phage head-tail adaptor	head,tail	A0A0C5AE87	Paenibacillus_phage	91.4	6.7e-52
AVF29858.1|804179_804608_+	phage protein, HK97 gp10 family	NA	A0A0C5AJ13	Paenibacillus_phage	94.4	3.0e-68
AVF29859.1|804591_804987_+	hypothetical protein	NA	A0A0C5AEH4	Paenibacillus_phage	84.7	9.1e-56
AVF29860.1|804988_805423_+|tail	phage major tail protein, TP901-1 family	tail	A0A2I7SCY9	Paenibacillus_phage	95.8	2.0e-72
AVF29861.1|805422_805761_+	hypothetical protein	NA	A0A0C5ABB9	Paenibacillus_phage	51.3	1.5e-22
AVF29862.1|805793_806042_+	hypothetical protein	NA	A0A0C5AE91	Paenibacillus_phage	70.4	4.7e-26
AVF29863.1|806096_808733_+|tail	putative phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	95.9	8.0e-249
AVF29864.1|808729_809605_+|tail	Phage tail protein	tail	A0A0C5AEI0	Paenibacillus_phage	46.0	5.0e-70
AVF29865.1|809607_810738_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.8	1.7e-59
AVF29866.1|810757_812710_+	phage structural protein	NA	E2ELJ8	Clostridium_phage	48.5	3.6e-52
AVF29867.1|812722_812908_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29868.1|812925_813108_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29869.1|813100_813256_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29870.1|813296_813536_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
AVF29871.1|813532_814207_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	97.8	1.0e-131
AVF29872.1|814479_814722_+	hypothetical protein	NA	A0A0C5AN23	Paenibacillus_phage	93.8	4.3e-32
AVF29873.1|815984_816737_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF29874.1|816874_817558_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29875.1|817653_817833_-	hypothetical protein	NA	NA	NA	NA	NA
AVF29876.1|818827_819430_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF29877.1|819783_820185_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF29878.1|820461_821331_+	phage structural protein	NA	A0A2I7SC02	Paenibacillus_phage	45.3	1.3e-09
AVF29879.1|821303_821456_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29880.1|821593_821833_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
AVF29881.1|822580_822826_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	88.9	2.8e-31
AVF29882.1|823012_824410_-	Calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
AVF29883.1|825442_828046_+	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.8	4.6e-265
AVF29884.1|828821_830384_+	bacillolysin	NA	NA	NA	NA	NA
AVF29885.1|830560_830659_+	hypothetical protein	NA	A0A2I7SCT3	Paenibacillus_phage	90.6	4.2e-07
AVF29886.1|830753_831437_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29887.1|831607_832327_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29888.1|832791_832956_+	40-residue YVTN family beta-propeller repeat	NA	NA	NA	NA	NA
830684:832406	attR	ATGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAGCATTTTTTCATGTCCCATAAAGCAAAAGTATCAGGATCAGAAAAGATTGCAGCTGTTGAAAAGTATTTACGTGGAGAAGATTCGCTTAATCATTTAGCAGCACTTCTTGATGTACGCCATTCATCCGTTAGGCAATGGCTTCAGACTTACCAGTCGCTAGGCCCAAACGGATTGCTTCAAACATCACAGAATGCATCTTACTCCGCAGAGTTAAAAAGAATAGCTGTCGAGGACTATTTGGCTGGCGGCGGTTCTCACATGGATATTTGTAAAAGATATGGCATTAAGTCAACTTGCCAATTGCGGGATTGGATTCTGAAGTATAATAGTCATGAGAAGTTGAACACTTCCGGAACGGGAGGAGTGCCGATCATGACAAAAGGACGAACAACTACTTACGATGAGAGAGTTGAAATCGTCAGATTCTGCATTGAACATCAACACAATTATGCCCAGACAGCTGATAAATTCCAGGTATCCTATCAGCAAGTTTATTCATGGACAAATAAATACTTAACATCTGGTGTGGATGCACTTCAGGACAGACGCGGGAAAAGAAAATCTGAGGATGAGATGTCCGAAGTGGAGAAACTAAGGGCTCAGAATAAGCTGTTACAGGCTGAGAACAGAAGGAAGCAGATGGAGATCGATTTGCTAAAAAAGTTGGACGAGATCGAAAGGAGGCGGTTCTAAGCCAGGTAAGGTATGAAACGATATACCTTGCAATACGCGGGCTCCGTGAAACGAAGTCATATCCCATATGTCAATTATGTGATCTTATTGGGATCCAACGTTCATCGTATTATAAATGGATCAACCGGAAAGAAAGTATTAATGAGATCTTTAATAAAGCGTTGCTTCCCATGATTAAAGATGCCTACGAGGAAAAGGATGGCATCCTTGGATATCGCCAGATGACCATTAAACTAAACCGGGAACGCCATGTAACTGTCAATCATAAGCGAATATACAGACTTATGGGCATCCTAGGCCTTAAATCGGTATGCCGCAGGAAGCGAAAAAACTACATCCATTCCACACCTGAAATTACGGCGGAAAATATCCTGAACAGAGACTTTGAATCCTCTGAGTTTGGTACGAAATGGCTCACAGATGTGACTGAAATGAAGTATGGCAACCAAAACAAGGCTTATCTTAGTGCAATCCTTGATTTGTCGGATAAAAGCATTGTTTCTTTTGTGGTAGGGCATTCCAACAACAATGAACTTGTATTTAAAACTTTTGATATCGCCCATATGACTTATCCTGACGCTACACCCCTCTTTCACAGTGACCGGGGTTTCCAATATACATGTAAAATCTTCAAGAAAAAACTAGACGATGCAGGTATGATCCAAAGCATGTCCAGGGTATCCAGATGTATAGATAATGGCCCAATGGAATCATTCTGGGGAATGATGAAATCCGAAATGTATTATCTTCGTAAGTTCTATACATATGAGGAACTGGAAGCAGCCGTGATAGAATACATCGATTACTACAATACTCGTCGATACCAGAAAAGACTTAATTGTATGACGCCGTTGGAATATAGGCAATACCTTCTAAGTTCAGCAGCATAGAAAATGGCACCAACCATGTATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCA	NA	NA	NA	NA
AVF29889.1|832980_833796_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF29890.1|833843_834131_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF29891.1|834248_834869_+	40-residue YVTN family beta-propeller repeat	NA	NA	NA	NA	NA
AVF29892.1|835008_836292_+	ATPase, AAA family	NA	D0R099	Streptococcus_phage	22.5	1.2e-08
AVF29893.1|836266_836419_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29894.1|836669_837227_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF29895.1|837244_837580_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF29896.1|837979_838612_+	toxin-like protein	NA	NA	NA	NA	NA
AVF29897.1|838854_840075_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF29898.1|840307_840766_-	HNH endonuclease	NA	NA	NA	NA	NA
AVF29899.1|841727_842015_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF29900.1|842062_842878_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF29901.1|842847_843885_+	amidinotransferase family protein	NA	NA	NA	NA	NA
AVF29902.1|844311_844512_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29903.1|845376_845550_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
AVF29904.1|845994_846402_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
AVF29905.1|846746_847967_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF29906.1|848085_848460_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF29907.1|848480_848849_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF29908.1|849044_849233_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
>prophage 8
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	853870	915999	4268596	transposase,coat	Paenibacillus_phage(50.0%)	60	NA	NA
AVF29912.1|853870_854197_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF29913.1|854670_854859_+	cell wall-associated hydrolase	NA	NA	NA	NA	NA
AVF29914.1|854942_855986_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29915.1|856005_856311_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29916.1|856673_857069_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29917.1|857264_858311_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF29918.1|858389_858722_-	putative membrane protein	NA	NA	NA	NA	NA
AVF29919.1|858914_859883_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29920.1|860067_861483_+	putative metallophosphoesterase YunD	NA	NA	NA	NA	NA
AVF29921.1|861627_862479_+	undecaprenyl-diphosphatase UppP	NA	NA	NA	NA	NA
AVF29922.1|862845_863970_+	radical SAM domain protein	NA	NA	NA	NA	NA
AVF29923.1|864022_865393_+	Magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVF29924.1|865555_866308_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.4e-134
AVF29925.1|866441_867125_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF29926.1|867305_867518_+|coat	Spore coat associated protein JA (CotJA)	coat	NA	NA	NA	NA
AVF29927.1|867790_868057_+|coat	spore coat peptide assembly protein	coat	NA	NA	NA	NA
AVF29928.1|868098_868668_+	protein CotJC	NA	NA	NA	NA	NA
AVF29929.1|869060_869357_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
AVF29930.1|869586_870492_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVF29931.1|871695_871893_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29932.1|872588_873065_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	53.4	3.8e-40
AVF29933.1|873326_873821_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29934.1|874058_874448_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29935.1|874612_875296_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF29936.1|875466_876186_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF29937.1|876577_877126_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29938.1|877152_877407_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29939.1|877811_880127_+	magnesium-transporting ATPase, P-type 1	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
AVF29940.1|880904_881573_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF29941.1|881858_883511_+	Polyol:NADP oxidoreductase	NA	NA	NA	NA	NA
AVF29942.1|883501_884572_+	Mannonate dehydratase	NA	NA	NA	NA	NA
AVF29943.1|884688_885894_+	Glucuronide permease	NA	NA	NA	NA	NA
AVF29944.1|885859_886177_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29945.1|886197_887592_+	Uronate isomerase	NA	NA	NA	NA	NA
AVF29946.1|887657_888308_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AVF29947.1|888309_889314_+	5-dehydro-2-deoxygluconokinase IolC	NA	NA	NA	NA	NA
AVF29948.1|889517_891350_+	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
AVF29949.1|891369_892248_+	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF29950.1|892275_894159_+	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF29951.1|894187_894652_+	PTS system, fructose subfamily, IIA component	NA	NA	NA	NA	NA
AVF29952.1|894648_894996_+	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF29953.1|895010_896105_+	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF29954.1|896485_898015_-	glycosyltransferase-like protein	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	5.9e-42
AVF29955.1|898232_899099_+	glycosyltransferase-like protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
AVF29956.1|899214_900354_+	pleiotropic regulatory protein DegT	NA	NA	NA	NA	NA
AVF29957.1|900350_900992_+	bacterial transferase hexapeptide repeat protein	NA	NA	NA	NA	NA
AVF29958.1|901009_901732_+	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
AVF29959.1|902127_902766_-	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF29960.1|902887_903397_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF29961.1|903414_903972_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF29962.1|904966_905245_-	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF29963.1|905345_905552_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF29964.1|906265_906457_-|transposase	transposase-like protein	transposase	A0A0C5AEB1	Paenibacillus_phage	64.8	4.3e-11
AVF29965.1|907338_908880_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29966.1|908740_909394_-	Collagen triple helix repeat (20 copies)	NA	NA	NA	NA	NA
AVF29967.1|910603_911434_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	1.8e-154
AVF29968.1|911439_911721_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF29969.1|913038_913479_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29970.1|914260_915280_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	36.4	4.7e-56
AVF29971.1|915276_915999_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	H9NC64	Sphingomonas_phage	40.6	7.8e-45
>prophage 9
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	920838	962915	4268596	transposase,lysis,coat,holin	Paenibacillus_phage(20.0%)	45	NA	NA
AVF29975.1|920838_921237_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
AVF29976.1|921339_921858_-	putative oxidoreductase YusZ	NA	NA	NA	NA	NA
AVF29977.1|921848_922223_-	short chain dehydrogenase	NA	NA	NA	NA	NA
AVF29978.1|922461_923631_-	N-acetylglucosamine-6-phosphate deacetylase NagA	NA	NA	NA	NA	NA
AVF29979.1|923627_924356_-	glucosamine-6-phosphate deaminase NagB	NA	NA	NA	NA	NA
AVF29980.1|924359_925217_-	transcriptional regulator, RpiR family	NA	NA	NA	NA	NA
AVF29981.1|925404_926073_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AVF29982.1|926121_927327_+	putative membrane protein	NA	NA	NA	NA	NA
AVF29983.1|927345_929310_+	Alkyl hydroperoxide reductase, large subunit	NA	NA	NA	NA	NA
AVF29984.1|929519_931019_-	Inner membrane protein YqiK	NA	A0A2I2L4B2	Orpheovirus	27.2	1.6e-07
AVF29985.1|931059_931581_-	membrane integrity-associated integral inner membrane protein	NA	NA	NA	NA	NA
AVF29986.1|931702_932611_-	putative phosphatase	NA	NA	NA	NA	NA
AVF29987.1|932759_933455_+	glycosyltransferase, group 2 family protein	NA	A8CG95	Salmonella_phage	28.0	1.4e-06
AVF29988.1|933470_933860_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29989.1|933863_934235_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
AVF29990.1|934275_935502_+	putative membrane protein	NA	NA	NA	NA	NA
AVF29991.1|935524_936961_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF29992.1|936966_938085_-|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
AVF29993.1|938084_939455_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF29994.1|939467_940667_-|coat	endospore coat-associated protein YheC	coat	NA	NA	NA	NA
AVF29995.1|940675_942049_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF29996.1|942178_943345_+	putative membrane protein	NA	NA	NA	NA	NA
AVF29997.1|943393_943753_+	hypothetical protein	NA	NA	NA	NA	NA
AVF29998.1|943936_944932_+	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF29999.1|945127_945868_-	ABC-transporter ATP-binding protein	NA	NA	NA	NA	NA
AVF30000.1|946168_946525_+	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	NA	NA	NA	NA
AVF30001.1|946546_946675_+	putative transaldolase Tal	NA	NA	NA	NA	NA
AVF30002.1|946637_946799_-|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVF30003.1|946903_948715_-	oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
AVF30004.1|948921_949164_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30005.1|949282_949570_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30006.1|949724_951062_+	inosine-5'-monophosphate dehydrogenase GuaB	NA	NA	NA	NA	NA
AVF30007.1|951045_951351_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30008.1|951527_951680_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30009.1|951899_952082_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30010.1|952180_954502_+	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF30011.1|954498_955128_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVF30012.1|955149_956124_+	isoprenyl transferase-like protein	NA	NA	NA	NA	NA
AVF30013.1|956650_956857_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30014.1|956822_957365_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30015.1|957808_958060_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF30016.1|959525_960668_+	gamma-D-glutamate-meso-diaminopimelate muropeptidase-like protein	NA	A0A1W6DXV0	Rhodococcus_phage	40.2	6.2e-12
AVF30017.1|961116_961695_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30018.1|961691_962024_-	Sporulation membrane protein YtrH	NA	NA	NA	NA	NA
AVF30019.1|962543_962915_+|transposase	transposase, IS605 OrfB family protein	transposase	A0A288TXV8	Enterococcus_phage	85.2	3.1e-50
>prophage 10
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1042406	1088875	4268596	transposase,coat,capsid,tail	Brevibacillus_phage(42.11%)	58	NA	NA
AVF30098.1|1042406_1043741_+	phage protein	NA	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
AVF30099.1|1043742_1044204_+	putative phage protein	NA	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
AVF30100.1|1044223_1044646_+	phage protein	NA	X5JAB6	Clostridium_phage	41.8	4.4e-24
AVF30101.1|1045017_1047063_+|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	41.7	3.0e-134
AVF30102.1|1047062_1047704_+	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	46.3	4.6e-49
AVF30103.1|1047708_1048677_+	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
AVF30104.1|1048676_1048964_+	hypothetical protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
AVF30105.1|1048966_1049389_+	phage protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
AVF30106.1|1049366_1050443_+|capsid	phage capsid assembly-like protein	capsid	S5MUH6	Brevibacillus_phage	50.6	4.8e-99
AVF30107.1|1050435_1051017_+	putative phage protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
AVF30108.1|1051013_1051292_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30109.1|1051295_1053068_+	phage structural protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
AVF30110.1|1053080_1053476_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30111.1|1053468_1053627_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30112.1|1053665_1053905_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
AVF30113.1|1053901_1054573_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	95.1	2.3e-128
AVF30114.1|1054825_1055056_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
AVF30115.1|1055202_1055370_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
AVF30116.1|1055721_1056780_+	auxin efflux carrier	NA	NA	NA	NA	NA
AVF30117.1|1056816_1057839_+	D-3-phosphoglycerate dehydrogenase SerA	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
AVF30118.1|1058356_1059577_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF30119.1|1059789_1061061_-	putative bifunctional chitinase/lysozyme precursor	NA	NA	NA	NA	NA
AVF30120.1|1061742_1062090_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30121.1|1062140_1062488_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30122.1|1062669_1062873_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
AVF30123.1|1062891_1063194_+|coat	Spore coat protein F precursor	coat	NA	NA	NA	NA
AVF30124.1|1064020_1065160_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF30125.1|1065344_1065698_+	putative propanediol utilization protein	NA	NA	NA	NA	NA
AVF30126.1|1065709_1066141_+	putative ethanolamine/propanediol utilization protein	NA	NA	NA	NA	NA
AVF30127.1|1066375_1066948_+	response regulator-like protein	NA	NA	NA	NA	NA
AVF30128.1|1066940_1068365_+	putative sensor histidine kinase	NA	NA	NA	NA	NA
AVF30129.1|1068506_1069937_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AVF30130.1|1069966_1071331_+	ethanolamine ammonia-lyase heavy chain EutB	NA	NA	NA	NA	NA
AVF30131.1|1071352_1072303_+	ethanolamine ammonia-lyase light chain EutC	NA	NA	NA	NA	NA
AVF30132.1|1072321_1072975_+	ethanolamine utilization protein EutL	NA	NA	NA	NA	NA
AVF30133.1|1072986_1073727_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF30134.1|1073877_1075341_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF30135.1|1075390_1075678_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF30136.1|1075822_1076650_+	ethanolamine utilization cobalamin adenosyltransferase EutT	NA	NA	NA	NA	NA
AVF30137.1|1076661_1077300_+	phosphate propanoyltransferase PduL	NA	NA	NA	NA	NA
AVF30138.1|1077318_1078002_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF30139.1|1078014_1078287_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AVF30140.1|1078279_1078825_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF30141.1|1078844_1079960_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
AVF30142.1|1079962_1080073_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30143.1|1080298_1081150_+	methyltransferase type 11	NA	NA	NA	NA	NA
AVF30144.1|1081277_1081442_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30145.1|1081489_1081651_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30146.1|1082586_1082781_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF30147.1|1082803_1083016_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30148.1|1083114_1083582_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
AVF30149.1|1083571_1083703_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30150.1|1084507_1084810_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30151.1|1084826_1085351_+	putative integral membrane protein	NA	NA	NA	NA	NA
AVF30152.1|1085420_1085834_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30153.1|1086106_1086409_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30154.1|1086793_1087231_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30155.1|1087819_1088875_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
>prophage 11
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1242898	1296431	4268596	transposase,integrase,protease	Paenibacillus_phage(30.77%)	52	1263808:1263823	1290274:1290289
AVF30324.1|1242898_1243402_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	29.8	1.1e-10
AVF30325.1|1243738_1244134_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30326.1|1245864_1248108_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVF30327.1|1248150_1249137_+	metal-dependent phosphohydrolase-like protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	25.7	1.7e-05
AVF30328.1|1249702_1250926_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF30329.1|1251109_1252306_+	ATPase, AAA family	NA	NA	NA	NA	NA
AVF30330.1|1252297_1252666_-	putative chloramphenical resistance permease RarD	NA	NA	NA	NA	NA
AVF30331.1|1252706_1253024_-	putative chloramphenical resistance permease RarD	NA	NA	NA	NA	NA
AVF30332.1|1253208_1253913_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF30333.1|1254108_1255062_+	site-specific tyrosine recombinase XerD-like protein	NA	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
AVF30334.1|1255946_1256099_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30335.1|1256481_1256808_+	aminopeptidase AmpS	NA	NA	NA	NA	NA
AVF30336.1|1257187_1258420_+	putative membrane protein	NA	NA	NA	NA	NA
AVF30337.1|1258460_1259024_-	signal peptidase I	NA	NA	NA	NA	NA
AVF30338.1|1259223_1260144_+	purine nucleosidase	NA	NA	NA	NA	NA
AVF30339.1|1260369_1262580_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.5	3.5e-11
AVF30340.1|1263065_1263980_+	proline dehydrogenase 1	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
1263808:1263823	attL	AATTTCAAATGCTTTA	NA	NA	NA	NA
AVF30341.1|1264006_1265575_+	1-pyrroline-5-carboxylate dehydrogenase RocA	NA	NA	NA	NA	NA
AVF30342.1|1265799_1266723_+	hydrolase, alpha/beta fold family	NA	NA	NA	NA	NA
AVF30343.1|1266908_1267904_+	HTH-type transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVF30344.1|1268217_1268763_+	integral membrane protein, YccS/YhfK family	NA	NA	NA	NA	NA
AVF30345.1|1268861_1269440_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF30346.1|1269592_1271026_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30347.1|1271055_1272045_-	putative glycosyltransferase YkoT	NA	B9UDL7	Salmonella_phage	40.0	2.4e-49
AVF30348.1|1272296_1272824_+|protease	CAAX amino terminal protease self- immunity	protease	NA	NA	NA	NA
AVF30349.1|1273068_1273593_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30350.1|1273589_1274648_+	luciferase family protein	NA	NA	NA	NA	NA
AVF30351.1|1274704_1275643_+	daunorubicin/doxorubicin resistance ATP-binding protein DrrA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
AVF30352.1|1275635_1276415_+	ABC transporter, efflux permease protein	NA	NA	NA	NA	NA
AVF30353.1|1276602_1277952_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	3.1e-71
AVF30354.1|1277955_1278096_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30355.1|1278382_1278910_+	putative acetyltransferase	NA	NA	NA	NA	NA
AVF30356.1|1279351_1281310_+	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
AVF30357.1|1281302_1282445_+	Dihydroorotase	NA	NA	NA	NA	NA
AVF30358.1|1282423_1282786_+	dihydroorotase	NA	NA	NA	NA	NA
AVF30359.1|1282825_1283182_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30360.1|1283185_1283524_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30361.1|1283544_1284330_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF30362.1|1284332_1284998_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF30363.1|1285039_1286146_+	pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVF30364.1|1286149_1286884_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30365.1|1287636_1287999_-|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	73.6	7.6e-33
AVF30366.1|1288013_1288160_+	hypothetical protein	NA	A0A0K2CYN9	Paenibacillus_phage	100.0	4.0e-09
AVF30367.1|1288986_1290207_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF30368.1|1290614_1290851_-	hypothetical protein	NA	NA	NA	NA	NA
1290274:1290289	attR	TAAAGCATTTGAAATT	NA	NA	NA	NA
AVF30369.1|1291340_1291937_-	putative ABC transporter permease YknZ	NA	NA	NA	NA	NA
AVF30370.1|1291979_1292870_-	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AVF30371.1|1293015_1293180_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30372.1|1293293_1293476_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30373.1|1293673_1294411_+	1D-myo-inositol 2-acetamido-2-deoxy-alpha-D-glucopyranoside deacetylase	NA	NA	NA	NA	NA
AVF30374.1|1294477_1295527_-	putative lipoprotein	NA	NA	NA	NA	NA
AVF30375.1|1295747_1296431_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
>prophage 12
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1415079	1421834	4268596		Staphylococcus_phage(57.14%)	7	NA	NA
AVF30500.1|1415079_1415517_+	peptidyl-prolyl cis-trans isomerase B	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
AVF30501.1|1416440_1417574_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.6e-52
AVF30502.1|1417577_1418243_+	riboflavin synthase alpha chain RibE	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
AVF30503.1|1418277_1419510_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
AVF30504.1|1419541_1420012_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
AVF30505.1|1420441_1421224_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
AVF30506.1|1421189_1421834_+	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 13
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1581054	1600163	4268596	transposase	Paenibacillus_phage(75.0%)	21	NA	NA
AVF30665.1|1581054_1582278_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF30666.1|1582342_1583308_+	putative phage DNA-binding protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
AVF30667.1|1583378_1584005_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30668.1|1584271_1584667_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30669.1|1584761_1585220_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30670.1|1585232_1585538_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30671.1|1585778_1587002_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF30672.1|1587029_1587818_+|transposase	transposase	transposase	A0A2I7SCM7	Paenibacillus_phage	96.9	3.6e-11
AVF30673.1|1587836_1588529_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30674.1|1588568_1589612_+	Cell wall-associated polypeptide	NA	S5W9C6	Leptospira_phage	37.2	4.8e-11
AVF30675.1|1589671_1589935_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30676.1|1589903_1590434_+	CRISPR-associated protein Cas4/endonuclease Cas1 fusion	NA	NA	NA	NA	NA
AVF30677.1|1592806_1593112_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30678.1|1593462_1594686_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF30679.1|1594750_1594957_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF30680.1|1595286_1595691_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF30681.1|1595701_1596433_-	pseudouridine synthase, RluA family	NA	NA	NA	NA	NA
AVF30682.1|1596436_1597303_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVF30683.1|1597506_1598523_+	1,4-alpha-glucan-branching enzyme	NA	NA	NA	NA	NA
AVF30684.1|1598589_1599273_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF30685.1|1599443_1600163_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
>prophage 14
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1605775	1655791	4268596	transposase,bacteriocin	Paenibacillus_phage(60.0%)	54	NA	NA
AVF30691.1|1605775_1606231_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF30692.1|1606566_1607142_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30693.1|1607271_1607457_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30694.1|1607719_1608007_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF30695.1|1608054_1608870_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF30696.1|1608993_1610598_-	Alpha-galactosidase	NA	NA	NA	NA	NA
AVF30697.1|1610858_1612082_+	Nitric oxide dioxygenase	NA	NA	NA	NA	NA
AVF30698.1|1612417_1613659_+	arginine deiminase ArcA	NA	NA	NA	NA	NA
AVF30699.1|1613676_1614675_+	ornithine carbamoyltransferase, catabolic	NA	NA	NA	NA	NA
AVF30700.1|1614770_1616186_+	arginine/ornithine antiporter ArcD	NA	NA	NA	NA	NA
AVF30701.1|1616202_1617156_+	carbamate kinase ArcC	NA	NA	NA	NA	NA
AVF30702.1|1617194_1617881_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVF30703.1|1617936_1618434_-	cAMP-binding protein	NA	NA	NA	NA	NA
AVF30704.1|1618591_1618990_+	putative amino acid aldolase or racemase	NA	NA	NA	NA	NA
AVF30705.1|1619294_1619978_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF30706.1|1620115_1620868_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF30707.1|1620980_1621406_-	putative ribosomal protein	NA	NA	NA	NA	NA
AVF30708.1|1621534_1622398_-	copper amine oxidase-like protein	NA	NA	NA	NA	NA
AVF30709.1|1622739_1623771_-	putative membrane protein	NA	NA	NA	NA	NA
AVF30710.1|1624003_1624438_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30711.1|1624543_1624867_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30712.1|1625660_1625987_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF30713.1|1626093_1627857_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30714.1|1627853_1628393_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30715.1|1628423_1628975_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30716.1|1628964_1629633_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
AVF30717.1|1629632_1629794_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30718.1|1629896_1631516_+	HTH-type transcriptional activator Btr	NA	NA	NA	NA	NA
AVF30719.1|1631612_1632590_+	iron-uptake system-binding protein FeuA	NA	NA	NA	NA	NA
AVF30720.1|1632597_1633608_+	iron-uptake system permease protein FeuB	NA	NA	NA	NA	NA
AVF30721.1|1633600_1634629_+	iron-uptake system permease protein FeuC	NA	NA	NA	NA	NA
AVF30722.1|1634975_1636157_+	GlcNAc-binding protein A	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
AVF30723.1|1636312_1637143_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	3.4e-153
AVF30724.1|1637148_1637430_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF30725.1|1637542_1638379_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AVF30726.1|1638441_1639317_-	ferri-bacillibactin esterase BesA	NA	NA	NA	NA	NA
AVF30727.1|1639464_1640682_-	cytochrome P450	NA	NA	NA	NA	NA
AVF30728.1|1641144_1643025_+	ATP-dependent OLD family endonuclease	NA	NA	NA	NA	NA
AVF30729.1|1643111_1643432_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30730.1|1643800_1644601_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVF30731.1|1644723_1645830_+	type-1 restriction enzyme StySJI specificity protein HsdS	NA	NA	NA	NA	NA
AVF30732.1|1646171_1649147_+	putative DNA helicase	NA	NA	NA	NA	NA
AVF30733.1|1649180_1649408_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30734.1|1649424_1649604_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF30735.1|1649823_1650330_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF30736.1|1650719_1651394_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30737.1|1651535_1651661_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF30738.1|1651687_1651846_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF30739.1|1651884_1652649_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF30740.1|1653009_1653444_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30741.1|1653825_1654044_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30742.1|1654015_1654315_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30743.1|1655027_1655396_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF30744.1|1655416_1655791_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.0	1.7e-64
>prophage 15
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1680057	1716966	4268596	tRNA,transposase,integrase,coat	Bacillus_virus(18.18%)	37	1679571:1679585	1716830:1716844
1679571:1679585	attL	CTTTTAAGTAACCTC	NA	NA	NA	NA
AVF30765.1|1680057_1681146_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF30766.1|1681457_1681844_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF30767.1|1682126_1682369_+	ABC transporter, ATP-binding protein	NA	NA	NA	NA	NA
AVF30768.1|1682369_1682921_+	ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	2.5e-19
AVF30769.1|1682910_1683201_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30770.1|1683640_1684603_+	putative lipoprotein	NA	NA	NA	NA	NA
AVF30771.1|1684700_1685270_+|coat	spore coat protein E	coat	NA	NA	NA	NA
AVF30772.1|1685371_1686727_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30773.1|1686850_1689532_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	3.8e-28
AVF30774.1|1689562_1691611_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	3.5e-66
AVF30775.1|1691680_1692511_+	methyltransferase-like protein	NA	NA	NA	NA	NA
AVF30776.1|1692498_1693461_+|tRNA	tRNA dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVF30777.1|1693538_1693778_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVF30778.1|1693926_1696359_+	penicillin-binding protein 1F	NA	NA	NA	NA	NA
AVF30779.1|1696542_1697217_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	48.8	5.6e-21
AVF30780.1|1697267_1697654_+	carboxylesterase	NA	NA	NA	NA	NA
AVF30781.1|1697843_1698545_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AVF30782.1|1698541_1699588_+	lipoate-protein ligase LplJ	NA	NA	NA	NA	NA
AVF30783.1|1699714_1700704_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.5	3.4e-51
AVF30784.1|1700729_1702019_+	GTP-binding protein HflX	NA	NA	NA	NA	NA
AVF30785.1|1702061_1703312_+	aluminum resistance protein	NA	NA	NA	NA	NA
AVF30786.1|1703482_1703890_+	HTH-type transcriptional regulator GlnR	NA	NA	NA	NA	NA
AVF30787.1|1703926_1705258_+	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVF30788.1|1705552_1705840_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	35.6	6.9e-05
AVF30789.1|1705887_1706703_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF30790.1|1706971_1707115_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF30791.1|1707111_1707642_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF30792.1|1708112_1708487_+	toxin-like protein	NA	NA	NA	NA	NA
AVF30793.1|1708447_1709239_+	toxin-like protein	NA	NA	NA	NA	NA
AVF30794.1|1709304_1712661_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	38.0	8.2e-89
AVF30795.1|1712893_1714114_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF30796.1|1714733_1715054_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF30797.1|1715098_1715425_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF30798.1|1715493_1715733_-|integrase	phage integrase-like protein	integrase	A0A0S2SXP1	Bacillus_phage	71.8	5.5e-24
AVF30799.1|1715992_1716343_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30800.1|1716182_1716515_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30801.1|1716504_1716966_-|transposase	putative transposase for insertion sequence element IS3 family protein	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.7	4.2e-20
1716830:1716844	attR	CTTTTAAGTAACCTC	NA	NA	NA	NA
>prophage 16
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1855210	1902156	4268596	transposase,protease	Paenibacillus_phage(18.18%)	56	NA	NA
AVF30935.1|1855210_1855456_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.5e-11
AVF30936.1|1856170_1856395_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF30937.1|1856542_1857742_+	putative MFS-type transporter	NA	NA	NA	NA	NA
AVF30938.1|1857995_1858142_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30939.1|1858116_1858452_-	Transposase	NA	NA	NA	NA	NA
AVF30940.1|1858663_1859305_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30941.1|1859583_1861851_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	30.1	1.1e-44
AVF30942.1|1861825_1862506_+	Uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	41.8	4.7e-44
AVF30943.1|1862636_1863578_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30944.1|1863703_1864066_+	sporulation kinase E	NA	NA	NA	NA	NA
AVF30945.1|1864108_1865077_+	ROK family protein	NA	NA	NA	NA	NA
AVF30946.1|1865018_1865222_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30947.1|1865171_1865402_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30948.1|1865597_1866662_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30949.1|1866708_1867824_-|protease	thermophilic metalloprotease, M29 family	protease	NA	NA	NA	NA
AVF30950.1|1868369_1869581_+	transporter, major facilitator family protein	NA	NA	NA	NA	NA
AVF30951.1|1869676_1870396_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF30952.1|1870566_1871250_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF30953.1|1871388_1872015_-	uridine kinase Udk	NA	A0A1V0SAA3	Catovirus	40.4	8.0e-38
AVF30954.1|1872193_1872511_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30955.1|1872592_1872880_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30956.1|1872988_1873918_+	phospholipase, patatin family	NA	NA	NA	NA	NA
AVF30957.1|1874190_1875222_+	ABC transporter, substrate-binding protein, putative	NA	NA	NA	NA	NA
AVF30958.1|1875264_1875555_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30959.1|1875551_1876319_+	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF30960.1|1876330_1877113_+	ABC transporter, ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-16
AVF30961.1|1877117_1877903_+	TatD-related deoxyribonuclease	NA	NA	NA	NA	NA
AVF30962.1|1877931_1878510_+	DNA-3-methyladenine glycosylase 1	NA	NA	NA	NA	NA
AVF30963.1|1878564_1878864_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30964.1|1879003_1879165_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30965.1|1879302_1880130_-	putative D-methionine-binding lipoprotein MetQ	NA	NA	NA	NA	NA
AVF30966.1|1880198_1880858_-	D-methionine transport system permease protein MetI	NA	NA	NA	NA	NA
AVF30967.1|1880861_1881866_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.8	4.0e-31
AVF30968.1|1881871_1882039_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30969.1|1882255_1882966_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30970.1|1882972_1883947_-	FAD-dependent disulfide oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF30971.1|1884164_1884593_+	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVF30972.1|1884826_1885153_+	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	2.9e-07
AVF30973.1|1885256_1886942_+	dihydroxy-acid dehydratase IlvD	NA	NA	NA	NA	NA
AVF30974.1|1887145_1887385_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30975.1|1887658_1887895_+	redoxin-like protein	NA	NA	NA	NA	NA
AVF30976.1|1888017_1888971_+	thioredoxin reductase TrxB	NA	A0A2I2L5E1	Orpheovirus	48.1	1.6e-69
AVF30977.1|1889324_1890143_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVF30978.1|1890321_1891053_-	magnesium transporter MgtE	NA	NA	NA	NA	NA
AVF30979.1|1891203_1891347_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30980.1|1891343_1892333_-	catabolite control protein A	NA	NA	NA	NA	NA
AVF30981.1|1892569_1893382_+	putative hydrolase	NA	NA	NA	NA	NA
AVF30982.1|1894025_1894433_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30983.1|1894445_1894646_+	hypothetical protein	NA	NA	NA	NA	NA
AVF30984.1|1894884_1895406_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30985.1|1895605_1895749_-	hypothetical protein	NA	NA	NA	NA	NA
AVF30986.1|1896047_1896947_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF30987.1|1896990_1898607_+	putative MFS-type transporter YusP	NA	NA	NA	NA	NA
AVF30988.1|1898789_1899335_-	DNA-binding protein	NA	NA	NA	NA	NA
AVF30989.1|1899487_1900849_+	putative D-serine dehydratase DsdA	NA	NA	NA	NA	NA
AVF30990.1|1900935_1902156_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
>prophage 17
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1916045	1964912	4268596	coat,transposase,tRNA,integrase,bacteriocin	Paenibacillus_phage(33.33%)	51	1924246:1924272	1970022:1970048
AVF31001.1|1916045_1917335_-|tRNA	seryl-tRNA ligase SerS	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
AVF31002.1|1918272_1919715_+	lysine-specific permease LysP	NA	NA	NA	NA	NA
AVF31003.1|1919906_1920320_+|coat	inner spore coat-like protein	coat	NA	NA	NA	NA
AVF31004.1|1920405_1921536_+	spore germination protein (amino acid permease)	NA	NA	NA	NA	NA
AVF31005.1|1921550_1923077_+	spore germination protein KA	NA	NA	NA	NA	NA
AVF31006.1|1923079_1924231_+	Spore germination protein A3 precursor	NA	NA	NA	NA	NA
1924246:1924272	attL	CCCCTGTCAAGTAGACAGTGTAAAAAA	NA	NA	NA	NA
AVF31007.1|1924343_1925048_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	3.0e-57
AVF31008.1|1925221_1925911_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF31009.1|1926201_1927098_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF31010.1|1927257_1928463_+	efflux transporter-like protein	NA	A0A2H4PQR6	Staphylococcus_phage	45.1	3.1e-99
AVF31011.1|1928593_1928749_-	integral membrane protein	NA	NA	NA	NA	NA
AVF31012.1|1928948_1929143_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31013.1|1929143_1929896_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.9e-23
AVF31014.1|1929883_1931572_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31015.1|1931697_1931913_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF31016.1|1932336_1932771_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31017.1|1932843_1933491_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31018.1|1933646_1934153_+	uridylate kinase-like protein	NA	NA	NA	NA	NA
AVF31019.1|1934267_1935005_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31020.1|1935290_1936580_+	Hemolysin C	NA	NA	NA	NA	NA
AVF31021.1|1937011_1937923_+	phenazine biosynthesis protein PhzF	NA	NA	NA	NA	NA
AVF31022.1|1938110_1938713_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31023.1|1938797_1939250_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF31024.1|1939380_1940067_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF31025.1|1940155_1940989_+	HAD-superfamily hydrolase	NA	NA	NA	NA	NA
AVF31026.1|1941137_1941383_+	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
AVF31027.1|1941565_1942597_-	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
AVF31028.1|1942996_1944280_+	maltose/maltodextrin-binding protein MalX	NA	NA	NA	NA	NA
AVF31029.1|1944362_1945676_+	putative arabinogalactan oligomer transport system permease protein GanP	NA	NA	NA	NA	NA
AVF31030.1|1945672_1946518_+	putative arabinogalactan oligomer transport system permease protein GanQ	NA	NA	NA	NA	NA
AVF31031.1|1946583_1947000_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31032.1|1947184_1947679_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
AVF31033.1|1947745_1948819_+	putative nitronate monooxygenase	NA	NA	NA	NA	NA
AVF31034.1|1949049_1950339_+	hydroxylamine reductase Hcp	NA	NA	NA	NA	NA
AVF31035.1|1950455_1951382_-	UDP-N-acetylenolpyruvoylglucosamine reductase MurB	NA	NA	NA	NA	NA
AVF31036.1|1951594_1951819_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31037.1|1952152_1952515_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31038.1|1952551_1954027_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AVF31039.1|1954217_1955171_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	29.9	7.4e-11
AVF31040.1|1955249_1955423_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31041.1|1955534_1956413_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF31042.1|1956470_1957904_-	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF31043.1|1957903_1958833_-	1-phosphofructokinase FruK	NA	NA	NA	NA	NA
AVF31044.1|1959003_1959786_+	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF31045.1|1959865_1960423_+	MutX-like protein	NA	NA	NA	NA	NA
AVF31046.1|1960417_1960822_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF31047.1|1960814_1961147_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF31048.1|1961152_1961692_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF31049.1|1962017_1962368_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31050.1|1962729_1963488_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF31051.1|1964219_1964912_-|integrase	putative integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	57.3	4.1e-59
1970022:1970048	attR	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
>prophage 18
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1968403	2107853	4268596	coat,transposase,lysis,integrase,holin,tail,portal	Paenibacillus_phage(79.57%)	173	1984912:1984971	2086634:2086648
AVF31055.1|1968403_1969087_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF31056.1|1969257_1969977_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF31057.1|1970787_1970928_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31058.1|1970874_1972095_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF31059.1|1972786_1972990_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.6	2.7e-27
AVF31060.1|1973006_1973450_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	56.6	1.7e-42
AVF31061.1|1973731_1974865_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	NA	NA	NA	NA
AVF31062.1|1975935_1976184_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31063.1|1976222_1976330_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31064.1|1976631_1976877_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AVF31065.1|1977378_1977960_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31066.1|1978054_1978921_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AVF31067.1|1978957_1979602_+	polar amino acid ABC transporter, inner membrane subunit	NA	NA	NA	NA	NA
AVF31068.1|1979623_1980370_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.6	1.5e-35
AVF31069.1|1980413_1980836_+	peroxiredoxin, OsmC subfamily	NA	NA	NA	NA	NA
AVF31070.1|1980972_1981416_+	cyanate hydratase CynS	NA	NA	NA	NA	NA
AVF31071.1|1982547_1983270_+|coat	spore coat protein, CotS family	coat	NA	NA	NA	NA
AVF31072.1|1983995_1984421_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31073.1|1984449_1984644_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31074.1|1984766_1984994_+	hypothetical protein	NA	NA	NA	NA	NA
1984912:1984971	attL	GTATTTCCCCCGAGGGGGAAATCGTGTTTCTAGCGCAAGTGGTGGCCAACTCGATCCGGG	NA	NA	NA	NA
AVF31075.1|1984940_1986161_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
1984912:1984971	attL	GTATTTCCCCCGAGGGGGAAATCGTGTTTCTAGCGCAAGTGGTGGCCAACTCGATCCGGG	NA	NA	NA	NA
AVF31076.1|1986433_1987519_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31077.1|1987515_1987692_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31078.1|1987688_1988348_+	ATP-binding transport protein NatA	NA	A0A2K9L0W2	Tupanvirus	24.6	1.4e-05
AVF31079.1|1988553_1988904_-	acyl-CoA O-methyltransferase-like protein	NA	W8CYT3	Bacillus_phage	53.5	4.3e-25
AVF31080.1|1989069_1989186_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31081.1|1989276_1989651_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF31082.1|1989671_1990040_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	98.4	1.3e-64
AVF31083.1|1992973_1993117_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31084.1|1995013_1995130_+|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVF31085.1|1995101_1996109_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	47.7	7.4e-70
AVF31086.1|1996320_1998768_+	CRISPR-associated nuclease/helicase Cas3	NA	NA	NA	NA	NA
AVF31087.1|1999005_1999632_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AVF31088.1|1999696_2000920_-|integrase	integrase Int	integrase	A0A0C5AN64	Paenibacillus_phage	86.0	9.3e-200
AVF31089.1|2000945_2001644_-	LexA repressor	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	2.1e-47
AVF31090.1|2001780_2001981_+	transcriptional regulator, y4mF family	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
AVF31091.1|2002046_2002274_+	DNA binding domain, excisionase family	NA	A0A0C5AN65	Paenibacillus_phage	77.1	9.0e-24
AVF31092.1|2002299_2002713_+	phage regulatory protein, Rha family	NA	A0A0N9SSV8	Paenibacillus_phage	60.0	2.5e-24
AVF31093.1|2002692_2003001_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31094.1|2003120_2003759_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	99.1	6.5e-128
AVF31095.1|2003781_2004576_+	putative prophage antirepressor	NA	A0A0N9SJU0	Paenibacillus_phage	87.3	2.0e-126
AVF31096.1|2004572_2004749_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31097.1|2004745_2004919_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.6e-20
AVF31098.1|2004915_2005218_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
AVF31099.1|2005233_2005560_+	hypothetical protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
AVF31100.1|2005812_2006187_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	45.2	7.6e-20
AVF31101.1|2006244_2006616_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	92.7	3.4e-60
AVF31102.1|2006599_2006977_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
AVF31103.1|2006995_2007262_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
AVF31104.1|2007269_2008040_+	putative DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
AVF31105.1|2008036_2009413_+	replicative DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
AVF31106.1|2009425_2010376_+	DNA primase	NA	A0A0N9S7Y2	Paenibacillus_phage	82.9	1.5e-152
AVF31107.1|2010435_2011014_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
AVF31108.1|2011079_2011607_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	8.4e-81
AVF31109.1|2011691_2012414_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
AVF31110.1|2012589_2012931_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
AVF31111.1|2012927_2013047_+	hypothetical protein	NA	A0A0N7GFF1	Paenibacillus_phage	74.4	1.8e-07
AVF31112.1|2013075_2013489_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
AVF31113.1|2013476_2013686_+	hypothetical protein	NA	A0A0N9SJW4	Paenibacillus_phage	95.7	2.8e-32
AVF31114.1|2013700_2014297_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	67.8	1.3e-61
AVF31115.1|2014372_2016094_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.2	9.1e-310
AVF31116.1|2016095_2016413_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	61.7	7.3e-32
AVF31117.1|2016406_2017534_+	DNA-directed DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
AVF31118.1|2017534_2017732_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
AVF31119.1|2017728_2018343_+	DNA polymerase III PolC-like protein	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
AVF31120.1|2018375_2019347_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.4e-136
AVF31121.1|2019372_2019855_+	crossover junction endodeoxyribonuclease	NA	A0A0N9ST03	Paenibacillus_phage	85.5	6.1e-30
AVF31122.1|2019851_2020034_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31123.1|2020101_2022318_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.6	3.1e-278
AVF31124.1|2022331_2023363_+	ribonucleoside-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
AVF31125.1|2023374_2023902_+	deoxyuridine 5'-triphosphate nucleotidohydrolase Dut	NA	D2XR49	Bacillus_phage	54.3	1.9e-40
AVF31126.1|2023894_2024191_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31127.1|2024187_2024526_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31128.1|2024526_2024853_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31129.1|2024866_2024986_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	94.9	1.6e-16
AVF31130.1|2024994_2025195_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
AVF31131.1|2025191_2025422_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31132.1|2025423_2025741_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
AVF31133.1|2025734_2026205_+	putative prophage protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
AVF31134.1|2026201_2026570_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31135.1|2026613_2027693_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
AVF31136.1|2027676_2028237_+	deoxynucleoside monophosphate kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	85.8	1.6e-85
AVF31137.1|2028193_2028577_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	77.2	4.7e-57
AVF31138.1|2028655_2029063_+	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.1	2.0e-58
AVF31139.1|2029052_2029505_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
AVF31140.1|2029891_2029987_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31141.1|2029996_2030227_+	hypothetical protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	34.7	2.2e-06
AVF31142.1|2030426_2030672_+	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	97.8	4.5e-13
AVF31143.1|2030655_2031495_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.8	2.6e-153
AVF31144.1|2031837_2032032_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
AVF31145.1|2032053_2032473_+	putative phage-associated protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
AVF31146.1|2032462_2032861_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
AVF31147.1|2033516_2033729_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31148.1|2034050_2034227_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
AVF31149.1|2034223_2034379_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31150.1|2034492_2034792_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31151.1|2034923_2036690_+	phage protein	NA	A0A0N9RZA7	Paenibacillus_phage	97.7	0.0e+00
AVF31152.1|2036842_2038198_+|portal	phage portal protein, SPP1 family	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	1.4e-241
AVF31153.1|2038194_2039055_+	putative phage protein	NA	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
AVF31154.1|2039146_2039782_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	74.4	3.0e-61
AVF31155.1|2039837_2040773_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
AVF31156.1|2040787_2041171_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
AVF31157.1|2041171_2041504_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.4	1.7e-55
AVF31158.1|2041500_2041926_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	92.2	3.5e-69
AVF31159.1|2041922_2042297_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	94.4	4.7e-62
AVF31160.1|2042309_2042858_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
AVF31161.1|2042908_2043286_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.0	5.1e-56
AVF31162.1|2043471_2043636_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	74.1	7.9e-14
AVF31163.1|2043663_2046558_+|tail	putative phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	56.2	5.2e-249
AVF31164.1|2046557_2048015_+|tail	phage tail component	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
AVF31165.1|2048017_2050339_+	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
AVF31166.1|2050335_2050773_+	phage-related protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	1.1e-67
AVF31167.1|2050760_2051177_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
AVF31168.1|2051169_2052039_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
AVF31169.1|2052326_2052620_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31170.1|2052758_2052971_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31171.1|2052973_2053357_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31172.1|2054044_2054686_-	hypothetical protein	NA	A0A142F168	Bacillus_phage	46.7	1.4e-16
AVF31173.1|2055071_2055440_-	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	83.2	2.6e-52
AVF31174.1|2055442_2055793_-	phage protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
AVF31175.1|2055837_2056263_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31176.1|2056427_2057054_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
AVF31177.1|2057126_2057513_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	94.5	3.4e-63
AVF31178.1|2057908_2059813_+	CRISPR-associated protein Cas8c/Csd1, subtype I-C/DVULG	NA	NA	NA	NA	NA
AVF31179.1|2059827_2060688_+	CRISPR-associated protein Cas7/Csd2, subtype I-C/DVULG	NA	NA	NA	NA	NA
AVF31180.1|2060677_2061337_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AVF31181.1|2061333_2062365_+	CRISPR-associated protein Cas4/endonuclease Cas1 fusion	NA	NA	NA	NA	NA
AVF31182.1|2062437_2062665_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AVF31183.1|2064035_2064194_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF31184.1|2065328_2065475_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31185.1|2065492_2066545_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31186.1|2066726_2067254_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31187.1|2067820_2068048_+|transposase	transposase-like protein	transposase	A0A0C5AEA5	Paenibacillus_phage	50.0	1.8e-08
AVF31188.1|2068111_2069332_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF31189.1|2069471_2070959_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
2069302:2070624	attR	CCCGGATCGAGTTGGCCACCACTTGCGCTAGAAACACGATTTCCCCCTCGGGGGAAATACAGACTGTCGACAAAGTCCTGTCGACAGTCTTTTTTACGAAAATACACCAACCATTCACCGCATTCATATAGTATCATATAGGTAAATAACTAGTGCGGGAGTGCTTGAATATGTTGCGAAAAACCGGTTACGAAGGACGTTCTCAAATTTCCATGGTCTCCTTGGACGAGCTTGTACCTATAGATCATTTGGTCCGCAAAATCGAATACGCCATCGATTTTAGTTTCATCTATGACTTGGTTCGGGATGTTTACTGTGAGGATAACGGCCGCCCTAGCATTGATCCGGTTGTTCTTATTAAAATTGCGCTTATTCAATGCCTTTTTGGTATTCGCTCCATGCGTCAGACCATCAAAGAGATTGAAACCAACGTCGCGTACCGTTGGTTTATTGGCTATGACTTCAGTCAGCCCATTCCTCATTTCTCCACGCTGGGTAAAAATTATGTGCGCCGTTTTCGGGATACTGGACTGTTTGAGGGAATCTTTCATCGCATCCTCGAAGAAGCTGCCCGGCATGGTTTCATTGAACCTGACGTACTCTTCATCGACGCGACACATGTTAAAGCAAGCGCGAACAAAAACAAATATGTAAAACAGATCGTTCAGGAGCAAAGTCGAAAGTACCAGGATCAGCTTGATGAAGAGATCAATCAAGATCGGGCTCTACATGGAAAGAAACCGTTCGAAAAAAAGCCCAATGTCACGCAGAAGGAGGTGAAGGTGAGCACGACTGACCCGGAGTGTGGTTTGTTCGTGAAGGGAGAGAAAGAACGTGTTTTCGCCTACAGCTTCCATACCGCGTGTGATCGGAACGGGTTTGTACTCGGCGTCAAAGTAACCCCTGGAAATATCCACGACAGCCAAGTATTTGAAGATGTTCTACACGAGGTTACTCGCGTAGTTCCGGCTCCACAAGCGGTTGCCGCGGATGCAGGTTATAAAACACCAGCCATCTGCAAAATGCTGCAAGAACAAGAGATTCGTCCCGTCCTGCCGTATACCCGTCCCAAGACGAAAGAAGAATTCTTTAAAAAGCATGATTACGTTTACGATGAGCACTACGACTGCTACCTGTGTCCGGCAAATGCCATACTGTCTTACGAAACAACGAACCGTGCTGGTTATAAAATGTATCGCTCGAATCCGGCAATCTGCCAAGCCTGTCCTTTCCGGACACAATGTACAGAGAGTAAAGAGGCAGTGAAGCGTATTAGTCGTCATGTTTGGGCTGAATGTGTGGAAGAGGCGGACCACCTTCGCC	NA	NA	NA	NA
AVF31190.1|2071323_2071926_-|transposase	transposase	transposase	NA	NA	NA	NA
2069302:2070624	attR	CCCGGATCGAGTTGGCCACCACTTGCGCTAGAAACACGATTTCCCCCTCGGGGGAAATACAGACTGTCGACAAAGTCCTGTCGACAGTCTTTTTTACGAAAATACACCAACCATTCACCGCATTCATATAGTATCATATAGGTAAATAACTAGTGCGGGAGTGCTTGAATATGTTGCGAAAAACCGGTTACGAAGGACGTTCTCAAATTTCCATGGTCTCCTTGGACGAGCTTGTACCTATAGATCATTTGGTCCGCAAAATCGAATACGCCATCGATTTTAGTTTCATCTATGACTTGGTTCGGGATGTTTACTGTGAGGATAACGGCCGCCCTAGCATTGATCCGGTTGTTCTTATTAAAATTGCGCTTATTCAATGCCTTTTTGGTATTCGCTCCATGCGTCAGACCATCAAAGAGATTGAAACCAACGTCGCGTACCGTTGGTTTATTGGCTATGACTTCAGTCAGCCCATTCCTCATTTCTCCACGCTGGGTAAAAATTATGTGCGCCGTTTTCGGGATACTGGACTGTTTGAGGGAATCTTTCATCGCATCCTCGAAGAAGCTGCCCGGCATGGTTTCATTGAACCTGACGTACTCTTCATCGACGCGACACATGTTAAAGCAAGCGCGAACAAAAACAAATATGTAAAACAGATCGTTCAGGAGCAAAGTCGAAAGTACCAGGATCAGCTTGATGAAGAGATCAATCAAGATCGGGCTCTACATGGAAAGAAACCGTTCGAAAAAAAGCCCAATGTCACGCAGAAGGAGGTGAAGGTGAGCACGACTGACCCGGAGTGTGGTTTGTTCGTGAAGGGAGAGAAAGAACGTGTTTTCGCCTACAGCTTCCATACCGCGTGTGATCGGAACGGGTTTGTACTCGGCGTCAAAGTAACCCCTGGAAATATCCACGACAGCCAAGTATTTGAAGATGTTCTACACGAGGTTACTCGCGTAGTTCCGGCTCCACAAGCGGTTGCCGCGGATGCAGGTTATAAAACACCAGCCATCTGCAAAATGCTGCAAGAACAAGAGATTCGTCCCGTCCTGCCGTATACCCGTCCCAAGACGAAAGAAGAATTCTTTAAAAAGCATGATTACGTTTACGATGAGCACTACGACTGCTACCTGTGTCCGGCAAATGCCATACTGTCTTACGAAACAACGAACCGTGCTGGTTATAAAATGTATCGCTCGAATCCGGCAATCTGCCAAGCCTGTCCTTTCCGGACACAATGTACAGAGAGTAAAGAGGCAGTGAAGCGTATTAGTCGTCATGTTTGGGCTGAATGTGTGGAAGAGGCGGACCACCTTCGCC	NA	NA	NA	NA
AVF31191.1|2072406_2072916_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31192.1|2072933_2073491_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31193.1|2073788_2074307_+|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF31194.1|2074303_2074585_+	pyridoxamine 5'-phosphate oxidase, FMN-binding family	NA	NA	NA	NA	NA
AVF31195.1|2075404_2075905_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF31196.1|2075894_2076461_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	34.1	1.0e-15
AVF31197.1|2077859_2078486_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31198.1|2078898_2079255_-	group I intron endonuclease	NA	NA	NA	NA	NA
AVF31199.1|2079275_2080034_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31200.1|2082299_2085248_+	formate dehydrogenase, alpha subunit	NA	NA	NA	NA	NA
AVF31201.1|2085250_2085742_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31202.1|2085758_2086553_+	FdhD-like protein	NA	NA	NA	NA	NA
AVF31203.1|2086866_2087820_+	iron-siderophore ABC transporter-like protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
AVF31204.1|2087809_2088763_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVF31205.1|2088756_2089515_+	iron-siderophore ABC transporter-like protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
AVF31206.1|2089606_2090560_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVF31207.1|2090561_2090675_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31208.1|2091069_2091327_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31209.1|2091348_2092497_+	6-phosphogluconolactonase-like protein	NA	NA	NA	NA	NA
AVF31210.1|2093053_2093368_+	MIP18 family protein YitW	NA	NA	NA	NA	NA
AVF31211.1|2093526_2093976_+	Cysteine dioxygenase	NA	NA	NA	NA	NA
AVF31212.1|2094163_2094925_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF31213.1|2094977_2095133_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31214.1|2095150_2095816_+	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
AVF31215.1|2095961_2096375_+	penicillinase repressor	NA	NA	NA	NA	NA
AVF31216.1|2096377_2097223_+	peptidase, M56 family	NA	NA	NA	NA	NA
AVF31217.1|2097310_2098027_+	disulfide bond formation protein D	NA	NA	NA	NA	NA
AVF31218.1|2098035_2098470_+	thiol-disulfide oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF31219.1|2098512_2099235_-	oxidoreductase, short chain dehydrogenase/reductase family protein	NA	A0A0M4JSW6	Mollivirus	25.9	5.8e-08
AVF31220.1|2099619_2100075_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF31221.1|2100256_2101090_+	putative permease	NA	NA	NA	NA	NA
AVF31222.1|2101086_2101482_+	putative membrane protein	NA	NA	NA	NA	NA
AVF31223.1|2101663_2103595_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AVF31224.1|2103670_2105179_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AVF31225.1|2105165_2106344_+	aminoacyltransferase FemX	NA	NA	NA	NA	NA
AVF31226.1|2106768_2107278_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31227.1|2107295_2107853_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2234568	2281515	4268596	transposase,protease	Paenibacillus_phage(40.0%)	45	NA	NA
AVF31320.1|2234568_2235033_-|protease	putative serine protease HtrA	protease	W5SAB9	Pithovirus	41.1	3.4e-09
AVF31321.1|2235350_2236535_+	Purine efflux pump PbuE	NA	NA	NA	NA	NA
AVF31322.1|2236557_2237316_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF31323.1|2237494_2238226_+	exodeoxyribonuclease III (xth)	NA	NA	NA	NA	NA
AVF31324.1|2238263_2239721_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF31325.1|2239805_2240369_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31326.1|2240493_2241390_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF31327.1|2242173_2242377_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31328.1|2242373_2242742_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31329.1|2242932_2243667_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF31330.1|2243722_2244508_-	N-acetylmuramic acid deacetylase-like protein	NA	NA	NA	NA	NA
AVF31331.1|2244621_2246139_-	membrane protein	NA	NA	NA	NA	NA
AVF31332.1|2246218_2247337_-	two-component response regulator	NA	NA	NA	NA	NA
AVF31333.1|2247811_2248084_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
AVF31334.1|2248104_2248524_-	ribonuclease	NA	NA	NA	NA	NA
AVF31335.1|2249046_2250477_-	hydrolase-like protein	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
AVF31336.1|2250551_2251751_-	NAD(FAD)-dependent dehydrogenase	NA	NA	NA	NA	NA
AVF31337.1|2252233_2252464_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31338.1|2252727_2253786_+	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF31339.1|2253900_2254917_+	glucose-1-phosphate thymidylyltransferase StrD	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
AVF31340.1|2255530_2255716_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF31341.1|2255860_2256106_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31342.1|2256176_2256950_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AVF31343.1|2257567_2257726_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31344.1|2258200_2260624_-	Acyl-homoserine lactone acylase QuiP precursor	NA	NA	NA	NA	NA
AVF31345.1|2261120_2261912_-	transcriptional regulator, RpiR family	NA	NA	NA	NA	NA
AVF31346.1|2261947_2262628_-	putative N-acetylmannosamine-6-phosphate 2-epimerase NanE	NA	NA	NA	NA	NA
AVF31347.1|2262632_2264165_-	PTS system glucose-specific EIICBA component PtsG	NA	NA	NA	NA	NA
AVF31348.1|2264538_2265657_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF31349.1|2265833_2266661_+	metallophosphoesterase-like protein	NA	NA	NA	NA	NA
AVF31350.1|2267107_2268670_-	gluconokinase GntK	NA	NA	NA	NA	NA
AVF31351.1|2268704_2270066_-	gluconate permease GnuT	NA	NA	NA	NA	NA
AVF31352.1|2270176_2270854_-	gluconate operon transcriptional repressor	NA	NA	NA	NA	NA
AVF31353.1|2270967_2271642_-	6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	38.3	3.5e-47
AVF31354.1|2271676_2271850_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31355.1|2272029_2272347_-	hypothetical protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
AVF31356.1|2272935_2273247_-	hypothetical protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
AVF31357.1|2273442_2273547_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31358.1|2273696_2274206_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31359.1|2274223_2274781_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31360.1|2276039_2276723_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF31361.1|2276893_2277613_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF31362.1|2277786_2278176_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31363.1|2278664_2281220_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
AVF31364.1|2281245_2281515_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	2.5e-41
>prophage 20
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2288117	2315590	4268596	transposase,bacteriocin	Paenibacillus_phage(58.33%)	31	NA	NA
AVF31367.1|2288117_2288339_-	putative transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.1e-13
AVF31368.1|2288794_2288986_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	3.4e-24
AVF31369.1|2288982_2289255_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
AVF31370.1|2289258_2289471_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
AVF31371.1|2289822_2290371_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
AVF31372.1|2290622_2291342_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF31373.1|2291512_2292196_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF31374.1|2292453_2292663_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31375.1|2292866_2293550_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF31376.1|2293720_2294440_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF31377.1|2294729_2295017_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF31378.1|2295064_2295880_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF31379.1|2296283_2297084_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SCE7	Paenibacillus_phage	55.3	3.1e-18
AVF31380.1|2297947_2300155_-	phage-related pre-neck appendage-like protein	NA	A0A142IG93	Bacillus_phage	39.9	2.6e-19
AVF31381.1|2300494_2300812_-	hypothetical protein	NA	J7KJ12	Streptococcus_phage	46.2	1.1e-11
AVF31382.1|2300962_2302186_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF31383.1|2302331_2303102_-	hypothetical protein	NA	Q38196	Clostridium_botulinum_phage	30.3	1.2e-06
AVF31384.1|2303139_2303514_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF31385.1|2303534_2303903_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF31386.1|2303867_2304950_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31387.1|2305286_2306510_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF31388.1|2306987_2307617_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31389.1|2307609_2308236_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31390.1|2308386_2308674_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF31391.1|2308721_2309537_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF31392.1|2309493_2310000_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	80.6	5.4e-77
AVF31393.1|2309962_2310235_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
AVF31394.1|2310262_2310439_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31395.1|2310438_2311893_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF31396.1|2312035_2313628_-	SagB-type dehydrogenase domain protein	NA	NA	NA	NA	NA
AVF31397.1|2313652_2315590_-|bacteriocin	bacteriocin biosynthesis docking scaffold, SagD family	bacteriocin	NA	NA	NA	NA
>prophage 21
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2448573	2508870	4268596	tRNA,transposase,protease	Paenibacillus_phage(47.37%)	57	NA	NA
AVF31513.1|2448573_2449263_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF31514.1|2449545_2450139_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	52.6	2.5e-49
AVF31515.1|2450288_2452016_-	glycine betaine transport system permease protein OpuAB	NA	NA	NA	NA	NA
AVF31516.1|2452012_2453212_-	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	39.5	1.8e-30
AVF31517.1|2453511_2454090_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31518.1|2454356_2455841_+	putative aldehyde dehydrogenase DhaS	NA	NA	NA	NA	NA
AVF31519.1|2455890_2457063_-	spore autolysin-like protein	NA	NA	NA	NA	NA
AVF31520.1|2457078_2457258_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31521.1|2457308_2457419_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31522.1|2458229_2459744_-	carbohydrate kinase, YjeF related protein	NA	NA	NA	NA	NA
AVF31523.1|2459759_2460719_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
AVF31524.1|2460928_2462017_-	putative dipeptidase YkvY	NA	NA	NA	NA	NA
AVF31525.1|2462212_2463211_-	Phosphate/sulfate permease	NA	NA	NA	NA	NA
AVF31526.1|2463544_2463712_+	thioredoxin-disulfide reductase	NA	NA	NA	NA	NA
AVF31527.1|2463756_2464047_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AVF31528.1|2464360_2464549_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	93.0	3.7e-23
AVF31529.1|2464538_2464736_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	66.2	1.9e-17
AVF31530.1|2464877_2465210_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31531.1|2465206_2465383_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.7	8.5e-22
AVF31532.1|2465601_2466843_-	putative lethal factor domain protein	NA	A0A1V0E017	Clostridioides_phage	25.6	1.4e-06
AVF31533.1|2467173_2468103_-	toxin-like protein	NA	A0A0K2CYN4	Paenibacillus_phage	30.5	1.0e-09
AVF31534.1|2468273_2469497_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF31535.1|2469517_2471641_-	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	36.7	8.3e-95
AVF31536.1|2471711_2472575_-	toxin-like protein	NA	NA	NA	NA	NA
AVF31537.1|2472723_2473896_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.2	1.8e-216
AVF31538.1|2475760_2476192_+	UspA domain-containing protein	NA	NA	NA	NA	NA
AVF31539.1|2476194_2477715_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	3.6e-124
AVF31540.1|2478007_2479309_-	cell envelope-like function transcriptional attenuator common domain protein	NA	NA	NA	NA	NA
AVF31541.1|2479796_2480219_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31542.1|2480250_2481732_-|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AVF31543.1|2481863_2482433_-	phosphate propanoyltransferase PduL	NA	NA	NA	NA	NA
AVF31544.1|2482556_2483423_-	2-oxoglutarate synthase subunit KorB	NA	NA	NA	NA	NA
AVF31545.1|2483410_2485159_-	2-oxoglutarate synthase subunit KorA	NA	NA	NA	NA	NA
AVF31546.1|2485363_2486299_-	renal dipeptidase family protein	NA	NA	NA	NA	NA
AVF31547.1|2486455_2486716_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	42.2	1.4e-09
AVF31548.1|2486828_2487560_-	putative metallophosphoesterase	NA	NA	NA	NA	NA
AVF31549.1|2487730_2489275_-	ribonuclease Y	NA	NA	NA	NA	NA
AVF31550.1|2489767_2490424_-	regulatory protein RecX	NA	NA	NA	NA	NA
AVF31551.1|2490522_2491566_-	protein RecA	NA	A0A0S2MVG1	Bacillus_phage	72.3	6.0e-131
AVF31552.1|2491755_2493012_-	putative competence-damage inducible protein CinA	NA	NA	NA	NA	NA
AVF31553.1|2493141_2493720_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase PgsA	NA	NA	NA	NA	NA
AVF31554.1|2493716_2495045_-	ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AVF31555.1|2495187_2495679_-	putative nucleotide-binding protein	NA	NA	NA	NA	NA
AVF31556.1|2495707_2496715_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVF31557.1|2496767_2497532_-	amino acid-binding ACT domain protein	NA	NA	NA	NA	NA
AVF31558.1|2497634_2498498_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31559.1|2498601_2498853_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31560.1|2498985_2499738_-	oxidoreductase, short chain dehydrogenase/reductase family protein	NA	NA	NA	NA	NA
AVF31561.1|2499737_2501024_-|protease	processing protease-like protein	protease	A0A2H4UVM3	Bodo_saltans_virus	30.5	1.4e-09
AVF31562.1|2501020_2502307_-	peptidase M16 domain protein	NA	A0A1X9I714	Streptococcus_phage	29.0	1.2e-43
AVF31563.1|2502473_2503274_-	spore cortex-lytic enzyme SleB	NA	A0A172JHR8	Bacillus_phage	42.9	1.9e-23
AVF31564.1|2503522_2506024_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.2	1.4e-85
AVF31565.1|2506116_2506353_-	YlzJ-like protein	NA	NA	NA	NA	NA
AVF31566.1|2506349_2507096_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
AVF31567.1|2507092_2507188_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31568.1|2507296_2508016_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF31569.1|2508186_2508870_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
>prophage 22
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2575662	2687572	4268596	tRNA,transposase,integrase,protease	Paenibacillus_phage(24.24%)	117	2626174:2626190	2657827:2657843
AVF31637.1|2575662_2577057_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
AVF31638.1|2577226_2577769_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AVF31639.1|2577947_2579276_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil-5-)- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVF31640.1|2579288_2581379_-	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
AVF31641.1|2581526_2582636_-	DNA processing Smf single strand binding protein-like protein	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
AVF31642.1|2582739_2583675_-	succinyl-CoA ligase [ADP-forming] subunit alpha	NA	NA	NA	NA	NA
AVF31643.1|2583731_2584892_-	succinyl-CoA ligase [ADP-forming] subunit beta	NA	NA	NA	NA	NA
AVF31644.1|2585280_2585541_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31645.1|2585572_2585968_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31646.1|2586182_2587706_+	Mg chelatase-like protein	NA	NA	NA	NA	NA
AVF31647.1|2587803_2588208_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31648.1|2588217_2588550_-	flagellar biosynthesis-like protein	NA	NA	NA	NA	NA
AVF31649.1|2588546_2590358_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF31650.1|2590412_2591096_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
AVF31651.1|2591388_2592270_-	ribosome biogenesis GTPase A	NA	NA	NA	NA	NA
AVF31652.1|2592378_2592963_-	signal peptidase I	NA	NA	NA	NA	NA
AVF31653.1|2593074_2593416_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVF31654.1|2593558_2594311_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVF31655.1|2594307_2594829_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVF31656.1|2595054_2595285_-	RNA binding-like protein	NA	NA	NA	NA	NA
AVF31657.1|2595307_2595580_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVF31658.1|2595621_2596989_-	signal recognition particle protein Ffh	NA	NA	NA	NA	NA
AVF31659.1|2597018_2597381_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF31660.1|2597514_2598522_-	cell division protein, FtsY-like protein	NA	NA	NA	NA	NA
AVF31661.1|2598606_2602185_-	chromosome partition protein SMC	NA	NA	NA	NA	NA
AVF31662.1|2602353_2603055_-	ribonuclease 3	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
AVF31663.1|2603234_2604470_-	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVF31664.1|2604559_2604793_-	acyl carrier protein AcpP	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
AVF31665.1|2604911_2605652_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
AVF31666.1|2605751_2606687_-	malonyl CoA-acyl carrier protein transacylase FabD	NA	NA	NA	NA	NA
AVF31667.1|2606718_2607705_-	3-oxoacyl-[acyl-carrier-protein] synthase 3	NA	NA	NA	NA	NA
AVF31668.1|2607715_2608702_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AVF31669.1|2608703_2609294_-	transcription factor FapR	NA	NA	NA	NA	NA
AVF31670.1|2609469_2609643_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVF31671.1|2609761_2610274_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31672.1|2610361_2611480_-	peptidase Do	NA	NA	NA	NA	NA
AVF31673.1|2611619_2612969_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVF31674.1|2612979_2613489_-	phosphopantetheine adenylyltransferase CoaD	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
AVF31675.1|2613506_2614064_-	putative rRNA methyltransferase YlbH	NA	NA	NA	NA	NA
AVF31676.1|2614613_2614811_-	Helix-turn-helix domain protein	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
AVF31677.1|2614875_2615289_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
AVF31678.1|2615436_2615826_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31679.1|2616111_2616387_-	amidinotransferase family protein	NA	NA	NA	NA	NA
AVF31680.1|2616925_2618257_-	GlcNAc-binding protein A	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
AVF31681.1|2618664_2619222_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF31682.1|2619239_2619749_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF31683.1|2619813_2620056_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
AVF31684.1|2620065_2620737_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	96.0	1.4e-128
AVF31685.1|2620733_2620973_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
AVF31686.1|2621000_2621129_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31687.1|2621385_2621697_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF31688.1|2621735_2622602_+|transposase	putative transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.7	4.7e-12
AVF31689.1|2623944_2624295_-	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
AVF31690.1|2624551_2624842_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	6.5e-35
AVF31691.1|2624981_2625497_+	hypothetical protein	NA	NA	NA	NA	NA
2626174:2626190	attL	TTTCTATAATGTTTTCA	NA	NA	NA	NA
AVF31692.1|2626268_2626379_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31693.1|2626378_2626603_-	helix-turn-helix protein	NA	NA	NA	NA	NA
AVF31694.1|2626749_2627460_+	LexA repressor-like protein	NA	R9VW28	Paenibacillus_phage	39.8	1.0e-41
AVF31695.1|2627479_2628037_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.0e-28
AVF31696.1|2629281_2629485_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31697.1|2629721_2630462_-	FMN reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVF31698.1|2630612_2631884_-	NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AVF31699.1|2632018_2633356_-	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF31700.1|2633760_2634078_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF31701.1|2634079_2634283_-	putative ABC transporter ATP-binding protein YdiF	NA	NA	NA	NA	NA
AVF31702.1|2634509_2634848_-	YolD-like protein	NA	NA	NA	NA	NA
AVF31703.1|2634844_2636092_-	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF31704.1|2636646_2637702_-	arsenite resistance protein ArsB	NA	NA	NA	NA	NA
AVF31705.1|2637730_2638078_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31706.1|2638740_2639103_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF31707.1|2639312_2641445_+	putative cadmium-transporting ATPase CadA	NA	E4ZFI9	Streptococcus_phage	44.6	1.0e-164
AVF31708.1|2641670_2641907_+	alkaline phosphatase synthesis sensor protein PhoR	NA	W8CYF6	Bacillus_phage	37.7	3.0e-06
AVF31709.1|2641985_2643092_+	acidobacterial duplicated orphan permease	NA	NA	NA	NA	NA
AVF31710.1|2643091_2643775_+	putative ABC transporter ATP-binding protein YvrO	NA	G9BWD6	Planktothrix_phage	39.0	2.4e-35
AVF31711.1|2644022_2644256_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31712.1|2644171_2644459_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31713.1|2644479_2644767_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF31714.1|2644814_2645630_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF31715.1|2645654_2645843_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31716.1|2646141_2646303_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31717.1|2646325_2646835_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31718.1|2646852_2647410_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF31719.1|2647508_2648135_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AVF31720.1|2648382_2649018_-	NAD-dependent epimerase/dehydratase	NA	NA	NA	NA	NA
AVF31721.1|2649302_2650622_-	Magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVF31722.1|2651344_2651632_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31723.1|2651816_2652407_+	DNA alkylation repair enzyme	NA	NA	NA	NA	NA
AVF31724.1|2652538_2654587_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AVF31725.1|2654583_2655444_-	EDD domain protein, DegV family	NA	A0A0N9SI50	Staphylococcus_phage	37.4	1.2e-15
AVF31726.1|2655485_2657246_-	dihydroxyacetone-like protein/glyceraldehyde kinase-like protein	NA	NA	NA	NA	NA
AVF31727.1|2657264_2657624_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31728.1|2657915_2658104_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
2657827:2657843	attR	TGAAAACATTATAGAAA	NA	NA	NA	NA
AVF31729.1|2658912_2659575_-	ribulose-phosphate 3-epimerase Rpe	NA	NA	NA	NA	NA
AVF31730.1|2659577_2660477_-	putative ribosome biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AVF31731.1|2660476_2662546_-	serine/threonine-protein kinase PrkC	NA	A0A0H4Y184	Salmon_gill_poxvirus	31.9	4.0e-25
AVF31732.1|2662552_2663272_-	protein phosphatase PrpC	NA	NA	NA	NA	NA
AVF31733.1|2663330_2664374_-	ribosomal RNA large subunit methyltransferase N	NA	NA	NA	NA	NA
AVF31734.1|2664491_2665877_-	ribosomal RNA small subunit methyltransferase B	NA	NA	NA	NA	NA
AVF31735.1|2665973_2666912_-|tRNA	methionyl-tRNA formyltransferase Fmt	tRNA	E3SNR5	Prochlorococcus_phage	37.1	1.9e-14
AVF31736.1|2666933_2667410_-	peptide deformylase Def	NA	E3SLL2	Synechococcus_phage	45.5	3.3e-20
AVF31737.1|2667461_2669948_-	primosomal protein N'	NA	NA	NA	NA	NA
AVF31738.1|2669947_2671159_-	putative coenzyme A biosynthesis bifunctional protein CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.0	6.0e-50
AVF31739.1|2671221_2671422_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVF31740.1|2671423_2672065_-	guanylate kinase Gmk	NA	A0A143DIC6	Abalone_herpesvirus	33.7	5.1e-24
AVF31741.1|2672054_2672315_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31742.1|2672347_2673232_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31743.1|2673268_2675167_-	bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AVF31744.1|2675519_2676362_-	diaminopimelate epimerase DapF	NA	NA	NA	NA	NA
AVF31745.1|2676482_2679260_-	calcium-transporting ATPase YloB	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.7	2.6e-88
AVF31746.1|2679462_2681250_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31747.1|2681457_2682330_-	UTP--glucose-1-phosphate uridylyltransferase GtaB	NA	A0A127AW70	Bacillus_phage	54.4	5.6e-82
AVF31748.1|2682331_2683174_-	DNA polymerase III PolC	NA	NA	NA	NA	NA
AVF31749.1|2684199_2684637_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31750.1|2684856_2685120_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31751.1|2685178_2686186_+	L-asparaginase II	NA	NA	NA	NA	NA
AVF31752.1|2686197_2686833_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31753.1|2686852_2687572_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
>prophage 23
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2780054	2792905	4268596	transposase,integrase	Paenibacillus_phage(60.0%)	21	2789627:2789640	2794587:2794600
AVF31853.1|2780054_2781428_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	4.8e-27
AVF31854.1|2781535_2781664_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31855.1|2782304_2782988_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF31856.1|2783158_2783878_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF31857.1|2783949_2784195_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	6.3e-31
AVF31858.1|2784344_2784734_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
AVF31859.1|2784923_2785127_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
AVF31860.1|2785203_2785323_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31861.1|2785369_2785489_-	hypothetical protein	NA	NA	NA	NA	NA
AVF31862.1|2785751_2786396_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31863.1|2786431_2786545_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31864.1|2787282_2787504_-	putative transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
AVF31865.1|2787602_2787794_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
AVF31866.1|2787797_2787950_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
AVF31867.1|2788092_2788353_-	hypothetical protein	NA	A0A0C5AJ69	Bacteriophage	95.3	6.2e-37
AVF31868.1|2788364_2788856_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.9	1.7e-72
AVF31869.1|2789245_2789746_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
2789627:2789640	attL	GTGGTTACTTTCAA	NA	NA	NA	NA
AVF31870.1|2790325_2790508_+	hypothetical protein	NA	NA	NA	NA	NA
AVF31871.1|2790803_2791214_+	helix-turn-helix family protein	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
AVF31872.1|2791245_2791662_+	Metallopeptidase ImmA	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
AVF31873.1|2791783_2792905_+|integrase	phage integrase-like protein	integrase	A0A1B0T6A8	Bacillus_phage	45.3	4.4e-87
2794587:2794600	attR	TTGAAAGTAACCAC	NA	NA	NA	NA
>prophage 24
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2972085	3029158	4268596	transposase,protease	Bacillus_phage(14.29%)	57	NA	NA
AVF32036.1|2972085_2974314_-|protease	protease, transglutaminase superfamily	protease	NA	NA	NA	NA
AVF32037.1|2974306_2975563_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32038.1|2975559_2976525_-	recombination factor protein RarA	NA	NA	NA	NA	NA
AVF32039.1|2976745_2977102_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
AVF32040.1|2977108_2978122_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
AVF32041.1|2978124_2978601_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
AVF32042.1|2978632_2979496_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32043.1|2979661_2979868_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32044.1|2980142_2980688_+	RNA polymerase sigma-28 factor SigK	NA	S6ANS0	Bacillus_phage	31.8	2.1e-10
AVF32045.1|2980777_2982388_-	putative DNA recombinase CisA	NA	Q38184	Lactococcus_phage	23.9	4.2e-22
AVF32046.1|2982420_2982567_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32047.1|2982630_2983932_-	PASTA domain protein	NA	NA	NA	NA	NA
AVF32048.1|2984171_2985512_+	Ktr system potassium uptake protein B	NA	NA	NA	NA	NA
AVF32049.1|2986079_2986457_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32050.1|2986471_2988166_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32051.1|2988760_2989591_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
AVF32052.1|2989766_2990198_-	Fluoroacetyl-CoA thioesterase	NA	NA	NA	NA	NA
AVF32053.1|2990260_2991460_-	beta-ketoadipyl-CoA thiolase PcaF	NA	NA	NA	NA	NA
AVF32054.1|2991464_2992208_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVF32055.1|2992197_2993058_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVF32056.1|2993061_2993853_-	putative enoyl-CoA hydratase PaaG	NA	NA	NA	NA	NA
AVF32057.1|2993865_2994639_-	short chain enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVF32058.1|2994635_2995991_-	phenylacetate-coenzyme A ligase PaaK	NA	NA	NA	NA	NA
AVF32059.1|2996002_2996788_-	enoyl-CoA hydratase/carnithine racemase	NA	NA	NA	NA	NA
AVF32060.1|2996824_2997223_-	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVF32061.1|2997219_2997522_-	EthD protein	NA	NA	NA	NA	NA
AVF32062.1|2997556_2999017_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVF32063.1|2999095_2999587_-	phenylacetic acid degradation protein PaaD	NA	NA	NA	NA	NA
AVF32064.1|2999600_3000434_-	putative phenylacetate degradation protein PaaC	NA	NA	NA	NA	NA
AVF32065.1|3000440_3000782_-	putative phenylacetate degradation protein PaaB	NA	NA	NA	NA	NA
AVF32066.1|3000778_3001765_-	phenylacetic acid degradation protein PaaA	NA	NA	NA	NA	NA
AVF32067.1|3001757_3003200_-	dihydrolipoyl dehydrogenase PdhD	NA	NA	NA	NA	NA
AVF32068.1|3004559_3005543_-	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVF32069.1|3005539_3006628_-	pyruvate dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AVF32070.1|3006726_3007035_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF32071.1|3007021_3007651_-	ABC-type uncharacterized transport system, permease component	NA	NA	NA	NA	NA
AVF32072.1|3008388_3009006_-	ABC-type uncharacterized transport system, periplasmic component	NA	NA	NA	NA	NA
AVF32073.1|3010109_3010880_-|transposase	putative transposase	transposase	A0A068A1P5	Thermus_phage	50.0	1.4e-39
AVF32074.1|3011192_3011402_-	RNA polymerase sigma-E factor SigE	NA	NA	NA	NA	NA
AVF32075.1|3011631_3012057_-	GtrA family protein	NA	NA	NA	NA	NA
AVF32076.1|3012134_3013397_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AVF32077.1|3014133_3014862_-	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVF32078.1|3015018_3015528_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF32079.1|3015545_3016103_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF32080.1|3016214_3016739_+	efflux transporter-like protein	NA	NA	NA	NA	NA
AVF32081.1|3016723_3017170_+	multidrug resistance protein	NA	NA	NA	NA	NA
AVF32082.1|3017316_3017820_-	anaerobic ribonucleotide reductase activating-like protein	NA	A0A2D0YLR2	Vibrio_phage	45.0	6.6e-27
AVF32083.1|3017768_3019616_-	ribonucleoside-triphosphate reductase class III catalytic subunit	NA	A0A0A8WEK0	Clostridium_phage	46.6	1.1e-159
AVF32084.1|3019939_3021409_-	nicotinate phosphoribosyltransferase PncB	NA	G3MA18	Bacillus_virus	50.3	2.2e-123
AVF32085.1|3021492_3022413_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32086.1|3022527_3023274_-	putative lipoprotein	NA	NA	NA	NA	NA
AVF32087.1|3023614_3023758_+	Sporulation inhibitor A	NA	NA	NA	NA	NA
AVF32088.1|3023873_3025484_-	putative beta-hexosaminidase A	NA	NA	NA	NA	NA
AVF32089.1|3025731_3025857_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF32090.1|3025864_3027151_-	HAMP domain protein	NA	NA	NA	NA	NA
AVF32091.1|3027314_3027767_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	1.8e-76
AVF32092.1|3028600_3029158_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3126799	3266000	4268596	coat,transposase,protease,plate,tRNA,integrase,capsid,tail,portal	Bacteriophage(39.78%)	155	3176429:3176445	3198566:3198582
AVF32184.1|3126799_3129466_-|tRNA	valine--tRNA ligase ValS	tRNA	A0A1V0SK04	Klosneuvirus	41.4	4.1e-168
AVF32185.1|3130030_3130195_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32186.1|3130258_3131410_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
AVF32187.1|3131514_3132438_-	putative RNA pseudouridine synthase YhcT	NA	NA	NA	NA	NA
AVF32188.1|3132685_3133819_+	exopolysaccharide biosynthesis protein	NA	A0A1P8CWN9	Bacillus_phage	30.9	1.4e-11
AVF32189.1|3134093_3135050_-	pantothenate kinase CoaA	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
AVF32190.1|3135194_3136496_-	glutamate-1-semialdehyde 2,1-aminomutase 2	NA	NA	NA	NA	NA
AVF32191.1|3136558_3137998_-	protoporphyrinogen oxidase HemY	NA	NA	NA	NA	NA
AVF32192.1|3138038_3138968_-	ferrochelatase HemH	NA	NA	NA	NA	NA
AVF32193.1|3138964_3140038_-	uroporphyrinogen decarboxylase HemE	NA	NA	NA	NA	NA
AVF32194.1|3140230_3141226_-	delta-aminolevulinic acid dehydratase HemB	NA	NA	NA	NA	NA
AVF32195.1|3141246_3142797_-	porphyrin biosynthesis protein HemD	NA	NA	NA	NA	NA
AVF32196.1|3142813_3143758_-	porphobilinogen deaminase HemC	NA	NA	NA	NA	NA
AVF32197.1|3143806_3144544_-	precorrin-2 dehydrogenase SirC	NA	NA	NA	NA	NA
AVF32198.1|3144540_3145383_-	protein HemX	NA	NA	NA	NA	NA
AVF32199.1|3145414_3146815_-|tRNA	glutamyl-tRNA reductase HemA	tRNA	NA	NA	NA	NA
AVF32200.1|3146986_3147520_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32201.1|3147657_3148059_-	S-adenosylmethionine decarboxylase proenzyme SpeH	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
AVF32202.1|3148431_3149019_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32203.1|3149409_3150024_-	putative GTP-binding protein EngB	NA	NA	NA	NA	NA
AVF32204.1|3150042_3152376_-|protease	Lon protease Lon	protease	A0A0R6PGP8	Moraxella_phage	41.5	9.5e-169
AVF32205.1|3152525_3154244_-|protease	Lon protease 2	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
AVF32206.1|3154468_3155167_+	N-acetylmuramoyl-L-alanine amidase-like protein	NA	NA	NA	NA	NA
AVF32207.1|3155217_3156339_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase IspG	NA	NA	NA	NA	NA
AVF32208.1|3156443_3157706_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
AVF32209.1|3157721_3158312_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
AVF32210.1|3158476_3159778_-	trigger factor Tig	NA	NA	NA	NA	NA
AVF32211.1|3159957_3160860_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32212.1|3160990_3162211_-	PGA biosynthesis protein CapA	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.2	1.3e-55
AVF32213.1|3162307_3162424_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32214.1|3162437_3162551_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32215.1|3162605_3164111_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF32216.1|3164103_3164580_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF32217.1|3164746_3165292_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32218.1|3165388_3167233_+	asparagine ligase	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
AVF32219.1|3167300_3167933_-	Non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
AVF32220.1|3167919_3168675_-	ribonuclease PH	NA	NA	NA	NA	NA
AVF32221.1|3168985_3170017_-	spore germination protein GerM	NA	NA	NA	NA	NA
AVF32222.1|3170253_3170769_+	phosphatidylglycerophosphatase A-like protein	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
AVF32223.1|3170880_3171690_+	putative membrane protein	NA	NA	NA	NA	NA
AVF32224.1|3171927_3172647_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF32225.1|3172817_3173501_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF32226.1|3173753_3174035_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF32227.1|3174040_3174871_+|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	3.4e-153
AVF32228.1|3175023_3175338_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32229.1|3175337_3175679_-	small multidrug resistance protein	NA	NA	NA	NA	NA
AVF32230.1|3175746_3176328_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
3176429:3176445	attL	CAATCCGTTTTCCCATG	NA	NA	NA	NA
AVF32231.1|3176575_3177559_-	beta-lactamase domain protein	NA	NA	NA	NA	NA
AVF32232.1|3177568_3178210_-	methyltransferase domain protein	NA	NA	NA	NA	NA
AVF32233.1|3178802_3179750_+	L-lactate dehydrogenase P	NA	NA	NA	NA	NA
AVF32234.1|3179997_3180240_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32235.1|3180566_3181010_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF32236.1|3181151_3181511_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF32237.1|3182339_3185936_+	type-F conjugative transfer system pilin assembly protein TraF	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.6	2.8e-42
AVF32238.1|3186008_3186578_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF32239.1|3187086_3187992_+|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.2	3.4e-90
AVF32240.1|3188401_3188608_+	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF32241.1|3188708_3188987_+	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF32242.1|3189651_3190290_+	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF32243.1|3190988_3191453_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	63.6	5.4e-07
AVF32244.1|3191602_3192826_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32245.1|3193634_3195197_-	putative DNA recombinase CisA	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
AVF32246.1|3195135_3195417_-	hypothetical protein	NA	A0A0C5AF76	Paenibacillus_phage	98.9	2.7e-46
AVF32247.1|3195428_3195887_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
AVF32248.1|3195937_3196396_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
AVF32249.1|3196554_3197142_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	94.3	7.3e-102
AVF32250.1|3197138_3197351_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
AVF32251.1|3197340_3197466_-	hypothetical protein	NA	R9W0Q8	Paenibacillus_phage	97.6	5.8e-17
AVF32252.1|3197458_3197650_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
AVF32253.1|3197699_3198065_-	HTH-type transcriptional regulator ImmR	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
AVF32254.1|3198111_3198261_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
AVF32255.1|3198275_3198581_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
AVF32256.1|3198583_3199912_-	replicative DNA helicase DnaC	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.2e-247
3198566:3198582	attR	CAATCCGTTTTCCCATG	NA	NA	NA	NA
AVF32257.1|3199871_3200708_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.9	1.2e-158
AVF32258.1|3200721_3201036_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
AVF32259.1|3201032_3201791_-	putative metallo-hydrolase YycJ	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
AVF32260.1|3201803_3202718_-	phage recombination protein Bet	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
AVF32261.1|3202720_3202918_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
AVF32262.1|3202914_3204435_-	chromosome segregation protein	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
AVF32263.1|3204418_3204712_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
AVF32264.1|3204716_3204977_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
AVF32265.1|3205012_3205423_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32266.1|3205584_3205818_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
AVF32267.1|3205814_3206057_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
AVF32268.1|3206153_3206330_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32269.1|3206313_3206586_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
AVF32270.1|3206612_3207353_-	phage regulatory protein, Rha family	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
AVF32271.1|3207381_3207525_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
AVF32272.1|3207722_3207941_-	phage-associated protein, BcepMu gp16 family	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
AVF32273.1|3208158_3208605_+	HTH-type transcriptional regulator ImmR	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
AVF32274.1|3209178_3209382_+	membrane protein YqaE	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
AVF32275.1|3209478_3209709_-	putative transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
AVF32276.1|3210184_3210376_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
AVF32277.1|3210372_3210639_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	84.3	8.0e-32
AVF32278.1|3210642_3210849_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
AVF32279.1|3210940_3211183_-	hypothetical protein	NA	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
AVF32280.1|3211435_3212110_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC18	Paenibacillus_phage	93.3	2.4e-128
AVF32281.1|3212106_3212346_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
AVF32282.1|3212381_3212540_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32283.1|3212532_3212928_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32284.1|3212940_3214725_-	phage structural protein	NA	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
AVF32285.1|3214725_3215289_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	91.4	1.9e-91
AVF32286.1|3215285_3216410_-|plate	baseplate assembly protein	plate	A0A0C5AEG2	Bacteriophage	100.0	9.4e-207
AVF32287.1|3216406_3216733_-|plate	baseplate wedge subunit	plate	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
AVF32288.1|3216722_3217124_-	Phage protein U	NA	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
AVF32289.1|3217120_3217498_-|plate	phage baseplate assembly protein V	plate	A0A0C5AEP6	Bacteriophage	90.4	1.6e-57
AVF32290.1|3217500_3218529_-|tail	tail protein	tail	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
AVF32291.1|3218525_3218735_-	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	76.1	4.8e-24
AVF32292.1|3218731_3221227_-	tape measure domain protein	NA	A0A0C5ABJ2	Bacteriophage	84.4	0.0e+00
AVF32293.1|3221210_3221354_-	hypothetical protein	NA	A0A0C5AN07	Bacteriophage	66.7	3.3e-08
AVF32294.1|3221386_3221722_-	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
AVF32295.1|3221749_3222268_-|tail	major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
AVF32296.1|3222280_3223723_-|tail	major tail sheath protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
AVF32297.1|3223726_3223999_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
AVF32298.1|3223995_3224463_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
AVF32299.1|3224459_3225011_-|tail	Prophage minor tail protein Z (GPZ)	tail	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
AVF32300.1|3225007_3225319_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
AVF32301.1|3225315_3225465_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
AVF32302.1|3225478_3226507_-|capsid	Phage major capsid protein E	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
AVF32303.1|3226522_3226879_-	hypothetical protein	NA	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
AVF32304.1|3226875_3227997_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A0C5AEN1	Bacteriophage	98.4	6.7e-205
AVF32305.1|3227956_3229516_-|portal	phage portal protein, lambda family	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
AVF32306.1|3229512_3229734_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
AVF32307.1|3229750_3231613_-|tail	Bacteriophage tail assembly protein	tail	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
AVF32308.1|3231596_3232109_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
AVF32309.1|3233256_3233460_+	YcfA-like protein	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
AVF32310.1|3233490_3233901_+	Antitoxin HicB	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
AVF32311.1|3233929_3234133_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
AVF32312.1|3234223_3234463_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	62.8	8.9e-14
AVF32313.1|3234603_3235923_-	putative permease	NA	NA	NA	NA	NA
AVF32314.1|3236052_3236985_-	dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit	NA	NA	NA	NA	NA
AVF32315.1|3236965_3237667_-	dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit	NA	NA	NA	NA	NA
AVF32316.1|3238082_3238610_+	3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2	NA	NA	NA	NA	NA
AVF32317.1|3238693_3239530_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF32318.1|3239516_3240533_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVF32319.1|3240537_3241329_-	glycosyltransferase, group 2 family protein	NA	NA	NA	NA	NA
AVF32320.1|3241482_3242403_+	NAD dependent epimerase/dehydratase family protein WcaG	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.9	1.6e-31
AVF32321.1|3242484_3243204_-	glycosyltransferase-like protein	NA	K7Z8A5	Megavirus	23.6	2.1e-10
AVF32322.1|3243211_3244117_-	UDP-2-acetamido-2,6-dideoxy-hexulose 4-reductase	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
AVF32323.1|3244113_3244944_-	putative reductase	NA	NA	NA	NA	NA
AVF32324.1|3244940_3245927_-	polysaccharide biosynthesis protein CapD	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
AVF32325.1|3245916_3247011_-	UDP-N-acetylglucosamine 2-epimerase WecB	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
AVF32326.1|3247007_3248561_-	extracellular matrix biosynthesis-like protein	NA	NA	NA	NA	NA
AVF32327.1|3248741_3249113_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32328.1|3249112_3250249_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVF32329.1|3250223_3251414_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVF32330.1|3251410_3252133_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	G3MA50	Bacillus_virus	40.9	1.8e-46
AVF32331.1|3252387_3260073_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32332.1|3260194_3260533_-	putative L,D-transpeptidase YkuD	NA	NA	NA	NA	NA
AVF32333.1|3260675_3261842_+	alcohol dehydrogenase GbsB	NA	NA	NA	NA	NA
AVF32334.1|3262181_3262964_+	phosphatidylserine decarboxylase proenzyme Psd	NA	NA	NA	NA	NA
AVF32335.1|3262975_3263491_+	efflux transporter-like protein	NA	NA	NA	NA	NA
AVF32336.1|3263520_3264120_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF32337.1|3264426_3265110_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	99.6	1.8e-123
AVF32338.1|3265280_3266000_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
>prophage 26
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3338781	3416763	4268596	coat,head,transposase,tRNA,integrase,tail,portal	Paenibacillus_phage(58.49%)	98	3358511:3358527	3398933:3398949
AVF32409.1|3338781_3339465_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF32410.1|3339635_3340355_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF32411.1|3340503_3341184_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32412.1|3341180_3341552_-	LrgA family protein	NA	NA	NA	NA	NA
AVF32413.1|3341674_3342568_+	putative HTH-type transcriptional regulator YwbI	NA	NA	NA	NA	NA
AVF32414.1|3342943_3343501_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32415.1|3343611_3344760_-	transglutaminase domain protein	NA	NA	NA	NA	NA
AVF32416.1|3344787_3345027_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32417.1|3345049_3345202_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32418.1|3345320_3346463_+	exporter-like protein	NA	NA	NA	NA	NA
AVF32419.1|3346662_3347013_+	ribonuclease-like protein	NA	NA	NA	NA	NA
AVF32420.1|3347014_3347656_-	BsSco	NA	NA	NA	NA	NA
AVF32421.1|3347746_3348715_-	protoheme IX farnesyltransferase CyoE	NA	NA	NA	NA	NA
AVF32422.1|3348917_3350930_-	methyl-accepting chemotaxis protein McpC	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
AVF32423.1|3351537_3352017_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AVF32424.1|3352055_3352334_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32425.1|3352421_3353405_+	membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
AVF32426.1|3353541_3353766_-	small, acid-soluble spore protein A	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
AVF32427.1|3354270_3355257_-|tRNA	tryptophan--tRNA ligase TrpS	tRNA	NA	NA	NA	NA
AVF32428.1|3355635_3357054_-	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVF32429.1|3357266_3357905_-	ribonuclease H	NA	NA	NA	NA	NA
3358511:3358527	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
AVF32430.1|3358646_3359033_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32431.1|3359426_3359654_-	putative transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	85.1	3.0e-27
AVF32432.1|3360123_3360309_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
AVF32433.1|3360394_3360658_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
AVF32434.1|3360786_3361506_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF32435.1|3361676_3362360_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF32436.1|3362512_3363220_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32437.1|3363182_3363899_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32438.1|3364034_3364277_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
AVF32439.1|3364286_3364958_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	96.4	6.6e-131
AVF32440.1|3364954_3365194_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
AVF32441.1|3365373_3365706_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
AVF32442.1|3365715_3366468_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
AVF32443.1|3366470_3367943_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
AVF32444.1|3367942_3368644_-	Phage-related protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
AVF32445.1|3368646_3370053_-	Phage-related protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.3e-16
AVF32446.1|3370138_3371359_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF32447.1|3371417_3373214_-	tape measure domain protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
AVF32448.1|3373234_3373582_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	46.0	8.3e-21
AVF32449.1|3373647_3373953_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32450.1|3373952_3374471_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
AVF32451.1|3374484_3374895_-	hypothetical protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
AVF32452.1|3374899_3375235_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
AVF32453.1|3375240_3375546_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32454.1|3375542_3375863_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AVF32455.1|3375865_3376414_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
AVF32456.1|3376492_3377713_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF32457.1|3377754_3378120_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
AVF32458.1|3378132_3378723_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32459.1|3378809_3379652_-|head	phage head morphogenesis protein, SPP1 gp7 family	head	S5MTV5	Brevibacillus_phage	35.3	3.1e-37
AVF32460.1|3379611_3381024_-|portal	phage portal protein, SPP1 family	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
AVF32461.1|3381024_3382446_-	hypothetical protein	NA	A0A090EUA8	Clostridium_phage	69.2	3.0e-189
AVF32462.1|3382438_3382936_-	hypothetical protein	NA	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
AVF32463.1|3383151_3383775_-	RNA polymerase sigma factor, sigma-70 family	NA	NA	NA	NA	NA
AVF32464.1|3383740_3383980_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
AVF32465.1|3383976_3384105_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32466.1|3384097_3385216_-	RNA polymerase sigma-F factor SigF	NA	A0A2I7SC33	Paenibacillus_phage	89.4	7.2e-183
AVF32467.1|3385217_3385439_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
AVF32468.1|3385442_3385838_-	Holliday junction resolvase	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
AVF32469.1|3385827_3386181_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	99.1	6.2e-64
AVF32470.1|3386392_3388645_-	Regulatory protein RepA	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
AVF32471.1|3388649_3388979_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
AVF32472.1|3388975_3390565_-	type I restriction enzyme EcoKI subunit R	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
AVF32473.1|3390574_3391075_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
AVF32474.1|3391099_3391798_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	100.0	5.2e-139
AVF32475.1|3391829_3392933_-	hypothetical protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
AVF32476.1|3392932_3394243_-	putative ATP-binding protein involved in virulence	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
AVF32477.1|3394303_3395014_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	5.7e-125
AVF32478.1|3395063_3395435_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
AVF32479.1|3395464_3395749_-	transition state regulatory protein AbrB	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
AVF32480.1|3395752_3395986_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	84.1	4.3e-21
AVF32481.1|3396001_3396256_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
AVF32482.1|3396227_3396449_-	DNA binding domain, excisionase family	NA	NA	NA	NA	NA
AVF32483.1|3396533_3396776_-	anaerobic benzoate catabolism transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
AVF32484.1|3396900_3397233_+	putative phage protein	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
AVF32485.1|3397242_3397704_+	hypothetical protein	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
AVF32486.1|3397785_3398925_+|integrase	phage integrase family protein	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
AVF32487.1|3398977_3399343_-	hypothetical protein	NA	NA	NA	NA	NA
3398933:3398949	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
AVF32488.1|3399932_3401738_-	oligoendopeptidase, pepF/M3 family	NA	NA	NA	NA	NA
AVF32489.1|3402105_3402399_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32490.1|3402526_3403228_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32491.1|3403255_3403639_-	bacterial globin family protein	NA	NA	NA	NA	NA
AVF32492.1|3403694_3403793_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32493.1|3403950_3405201_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVF32494.1|3405344_3406151_+	putative inorganic polyphosphate/ATP-NAD kinase PpnK	NA	NA	NA	NA	NA
AVF32495.1|3406253_3406673_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32496.1|3406710_3407595_-	lipoyl synthase LipA	NA	NA	NA	NA	NA
AVF32497.1|3407783_3408869_+	peptidase, M23 family	NA	A0A7K9	Microcystis_virus	37.0	8.7e-08
AVF32498.1|3408923_3409673_-	spore formation-associated protein	NA	NA	NA	NA	NA
AVF32499.1|3410205_3410310_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32500.1|3410392_3411298_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF32501.1|3411808_3412747_-	O-acetylserine sulfhydrylase CysK	NA	C3U2M1	Lactococcus_phage	55.7	1.7e-84
AVF32502.1|3412770_3413589_-	RNA methyltransferase, TrmH family	NA	NA	NA	NA	NA
AVF32503.1|3413591_3414251_-	Ktr system potassium uptake protein C	NA	NA	NA	NA	NA
AVF32504.1|3414407_3414617_+	small, acid-soluble spore protein I	NA	NA	NA	NA	NA
AVF32505.1|3414877_3415639_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF32506.1|3415635_3416763_-|coat	spore coat protein SA	coat	NA	NA	NA	NA
>prophage 27
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3520735	3614474	4268596	transposase,integrase,protease	Paenibacillus_phage(25.0%)	82	3517515:3517530	3548845:3548860
3517515:3517530	attL	ATATTATAGTAAATAA	NA	NA	NA	NA
AVF32600.1|3520735_3521959_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32601.1|3522114_3523563_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF32602.1|3523697_3524084_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32603.1|3524105_3524564_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32604.1|3525255_3525405_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32605.1|3525394_3526603_-	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
AVF32606.1|3526599_3526743_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF32607.1|3527476_3527629_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32608.1|3529591_3529843_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32609.1|3529919_3530360_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32610.1|3530492_3530864_-	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
AVF32611.1|3531131_3531431_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVF32612.1|3531684_3532035_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32613.1|3532335_3533868_-	NADH dehydrogenase AhpF	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
AVF32614.1|3533876_3534440_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AVF32615.1|3534583_3534751_-	Virus attachment protein p12 family protein	NA	NA	NA	NA	NA
AVF32616.1|3534764_3536753_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVF32617.1|3536749_3536977_-	FeoA family protein	NA	NA	NA	NA	NA
AVF32618.1|3537986_3538445_-	HTH-type transcriptional regulator GltC	NA	NA	NA	NA	NA
AVF32619.1|3538556_3539714_+	putative transporter protein	NA	NA	NA	NA	NA
AVF32620.1|3539972_3540485_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF32621.1|3540481_3540775_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF32622.1|3540918_3541926_-	spermidine/putrescine import ATP-binding protein potA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.5e-30
AVF32623.1|3542356_3542719_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
AVF32624.1|3542733_3543183_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
AVF32625.1|3543763_3544738_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF32626.1|3544911_3545505_+|protease	serine alkaline protease-like protein	protease	A0A127AWU5	Bacillus_phage	37.7	3.3e-25
AVF32627.1|3545749_3547015_-	toxin-like protein	NA	NA	NA	NA	NA
AVF32628.1|3547047_3548271_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32629.1|3548557_3548749_-	toxin-like protein	NA	NA	NA	NA	NA
AVF32630.1|3548801_3549548_-	toxin-like protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
3548845:3548860	attR	TTATTTACTATAATAT	NA	NA	NA	NA
AVF32631.1|3549814_3552262_-	3-oxoacyl-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AVF32632.1|3552273_3553320_-	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVF32633.1|3553322_3556115_-	putative acetyltransferase	NA	NA	NA	NA	NA
AVF32634.1|3556111_3556600_-	(3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AVF32635.1|3556606_3556894_-	acyl carrier protein	NA	NA	NA	NA	NA
AVF32636.1|3557016_3557763_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
AVF32637.1|3557755_3558706_-	malonyl-CoA-[acyl-carrier-protein] transacylase	NA	NA	NA	NA	NA
AVF32638.1|3558702_3559122_-	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVF32639.1|3559127_3560282_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF32640.1|3560457_3561405_-	export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
AVF32641.1|3561743_3562850_+	filamentation induced by cAMP protein Fic	NA	NA	NA	NA	NA
AVF32642.1|3563285_3565169_-	chaperone protein HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
AVF32643.1|3565887_3566685_-	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF32644.1|3566689_3567490_-	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF32645.1|3568542_3569025_-	taurine catabolism dioxygenase TauD/TfdA	NA	NA	NA	NA	NA
AVF32646.1|3570276_3570384_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32647.1|3570336_3571236_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32648.1|3571385_3574550_-	endonuclease subunit	NA	NA	NA	NA	NA
AVF32649.1|3574610_3575372_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32650.1|3575364_3576825_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32651.1|3576809_3578114_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32652.1|3578339_3578477_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32653.1|3578765_3582116_-	type I restriction enzyme EcoKI subunit R	NA	Q5YA94	Bacillus_phage	22.9	2.0e-18
AVF32654.1|3582126_3582591_-|transposase	transposase	transposase	A0A2I7SCM7	Paenibacillus_phage	93.8	2.8e-11
AVF32655.1|3582618_3583842_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32656.1|3583834_3584725_-	EcoKI restriction-modification system protein HsdS	NA	NA	NA	NA	NA
AVF32657.1|3584725_3586183_-	Type I restriction enzyme EcoKI M protein	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
AVF32658.1|3586993_3587503_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32659.1|3588199_3591373_-	type 2 lantibiotic biosynthesis protein LanM	NA	NA	NA	NA	NA
AVF32660.1|3591474_3591696_-	type 2 lantibiotic, mersacidin/lichenicidin family	NA	NA	NA	NA	NA
AVF32661.1|3591796_3592951_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF32662.1|3592956_3593655_-	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
AVF32663.1|3593670_3594681_-|protease	intracellular serine protease	protease	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
AVF32664.1|3594677_3594950_-	transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AVF32665.1|3595625_3597317_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.5e-123
AVF32666.1|3597293_3597530_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32667.1|3597714_3599709_+	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.1e-11
AVF32668.1|3599878_3600070_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32669.1|3600166_3600397_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32670.1|3600323_3600995_-	putative phage antirepressor protein	NA	O48391	Streptococcus_phage	68.8	9.8e-18
AVF32671.1|3602704_3603139_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32672.1|3603139_3604633_+	phage related protein	NA	NA	NA	NA	NA
AVF32673.1|3605069_3606722_-	23S rRNA (uracil-C(5))-methyltransferase RlmCD	NA	A0A2K5B251	Erysipelothrix_phage	40.2	9.6e-107
AVF32674.1|3606718_3607663_-	diacylglycerol kinase DagK	NA	NA	NA	NA	NA
AVF32675.1|3607812_3608601_-	sirohydrochlorin cobaltochelatase CbiX	NA	NA	NA	NA	NA
AVF32676.1|3608768_3609059_-	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVF32677.1|3609632_3609917_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32678.1|3610257_3611331_+	putative lipoprotein YerB	NA	NA	NA	NA	NA
AVF32679.1|3611437_3611917_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32680.1|3612149_3612632_-	NTP pyrophosphohydrolase-like protein	NA	NA	NA	NA	NA
AVF32681.1|3614030_3614474_-|protease	intracellular serine protease	protease	NA	NA	NA	NA
>prophage 28
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3618998	3629655	4268596		Prochlorococcus_phage(25.0%)	9	NA	NA
AVF32688.1|3618998_3620546_-	bifunctional purine biosynthesis protein PurH	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
AVF32689.1|3620756_3621380_-	phosphoribosylglycinamide formyltransferase PurN	NA	M4QRX9	Synechococcus_phage	38.9	1.8e-26
AVF32690.1|3621376_3622423_-	phosphoribosylformylglycinamidine cyclo-ligase PurM	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-68
AVF32691.1|3622516_3624091_-	amidophosphoribosyltransferase PurF	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
AVF32692.1|3624075_3626319_-	phosphoribosylformylglycinamidine synthase 2	NA	A6N228	Microbacterium_phage	44.5	4.5e-168
AVF32693.1|3626296_3626992_-	phosphoribosylformylglycinamidine synthase 1	NA	NA	NA	NA	NA
AVF32694.1|3627064_3627307_-	phosphoribosylformylglycinamidine synthase PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
AVF32695.1|3627401_3628286_-	phosphoribosylaminoimidazole-succinocarboxamide synthase PurC	NA	A0A0M4JBD3	Mollivirus	33.6	9.5e-37
AVF32696.1|3628359_3629655_-	adenylosuccinate lyase PurB	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 29
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3662283	3774915	4268596	transposase,lysis,holin	Paenibacillus_phage(34.78%)	114	NA	NA
AVF32718.1|3662283_3663765_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF32719.1|3663902_3665258_-	putative polysaccharide deacetylase YheN	NA	NA	NA	NA	NA
AVF32720.1|3665549_3666020_-	peroxiredoxin-like protein	NA	NA	NA	NA	NA
AVF32721.1|3666569_3667595_+	transcriptional regulator LytR	NA	NA	NA	NA	NA
AVF32722.1|3667686_3669000_+	glutamate-1-semialdehyde 2,1-aminomutase 1	NA	NA	NA	NA	NA
AVF32723.1|3669526_3674056_+	glutamate synthase [NADPH] large chain GltA	NA	NA	NA	NA	NA
AVF32724.1|3674131_3675136_-	biotin synthase BioB	NA	NA	NA	NA	NA
AVF32725.1|3675296_3675734_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AVF32726.1|3675816_3676671_-	inositol-1-monophosphatase SuhB	NA	NA	NA	NA	NA
AVF32727.1|3677178_3677472_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32728.1|3677605_3678376_-	enoyl-[acyl-carrier-protein] reductase [NADH] FabI	NA	NA	NA	NA	NA
AVF32729.1|3678564_3679593_-	UV DNA damage endonuclease UvsE	NA	A0A2I2L3D9	Orpheovirus	27.5	7.7e-22
AVF32730.1|3680100_3681222_-	D-alanine--D-alanine ligase Ddl	NA	NA	NA	NA	NA
AVF32731.1|3681244_3682264_-	two-component response regulator	NA	NA	NA	NA	NA
AVF32732.1|3682605_3685305_+	aconitate hydratase Acn	NA	NA	NA	NA	NA
AVF32733.1|3685464_3686436_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF32734.1|3686543_3687287_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32735.1|3687624_3688656_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32736.1|3688729_3690010_+	putative superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.8	8.1e-37
AVF32737.1|3690230_3690821_-	GTP cyclohydrolase 1	NA	E7DN69	Pneumococcus_phage	54.4	5.5e-49
AVF32738.1|3691175_3691385_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32739.1|3691485_3692520_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF32740.1|3692590_3693760_-	putative iron-sulfur cluster binding protein	NA	NA	NA	NA	NA
AVF32741.1|3693788_3694376_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32742.1|3694656_3695085_-	Acetyltransferase YpeA	NA	NA	NA	NA	NA
AVF32743.1|3695365_3695995_-|holin	glycine betaine/carnitine/choline transport system permease protein OpuCD	holin	NA	NA	NA	NA
AVF32744.1|3696038_3696932_-|holin	choline-binding protein	holin	NA	NA	NA	NA
AVF32745.1|3696948_3697605_-|holin	choline transport system permease protein OpuBB	holin	NA	NA	NA	NA
AVF32746.1|3697601_3698762_-|holin	glycine betaine/carnitine/choline transport ATP-binding protein OpuCA	holin	G3M9Y6	Bacillus_virus	33.6	9.0e-27
AVF32747.1|3699173_3700475_-	putative 6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVF32748.1|3700480_3701455_-	Glucosamine kinase GspK	NA	NA	NA	NA	NA
AVF32749.1|3701500_3702508_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
AVF32750.1|3702801_3702912_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32751.1|3703172_3703787_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
AVF32752.1|3703904_3706523_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
AVF32753.1|3706583_3707570_-	ABC-2 type transport system permease protein PotC	NA	NA	NA	NA	NA
AVF32754.1|3707566_3708343_-	putative pleiotropic drug resistance protein	NA	NA	NA	NA	NA
AVF32755.1|3708358_3709306_-	spermidine/putrescine import ATP-binding protein potA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
AVF32756.1|3709465_3709675_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32757.1|3710490_3710793_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32758.1|3710901_3712074_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVF32759.1|3712220_3712562_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32760.1|3712786_3713179_-	holo-[acyl-carrier-protein] synthase AcpS	NA	NA	NA	NA	NA
AVF32761.1|3713273_3714188_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32762.1|3714171_3715098_-	putative ABC transporter ATP-binding protein YhcH	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
AVF32763.1|3715302_3716109_-	NH(3)-dependent NAD(+) ligase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
AVF32764.1|3716555_3716987_-	bacillithiol system oxidoreductase, YphP/YqiW family	NA	NA	NA	NA	NA
AVF32765.1|3717128_3717482_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32766.1|3717485_3718352_-	prolipoprotein diacylglyceryl transferase Lgt	NA	NA	NA	NA	NA
AVF32767.1|3718469_3719192_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AVF32768.1|3719194_3719713_-	phage shock protein C, PspC	NA	NA	NA	NA	NA
AVF32769.1|3719719_3720385_-	phage shock protein A, PspA	NA	NA	NA	NA	NA
AVF32770.1|3720439_3720730_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32771.1|3720988_3721675_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32772.1|3721814_3722837_+	Ser/Thr phosphatase family protein	NA	NA	NA	NA	NA
AVF32773.1|3722882_3723371_+	tricarballylate dehydrogenase	NA	NA	NA	NA	NA
AVF32774.1|3723666_3723981_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32775.1|3724000_3724720_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF32776.1|3724890_3725574_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF32777.1|3725640_3725901_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32778.1|3725990_3726476_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32779.1|3726632_3727901_+	tricarballylate dehydrogenase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
AVF32780.1|3727999_3728368_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32781.1|3728757_3729222_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF32782.1|3730222_3730816_+	undecaprenyl-diphosphatase BcrC	NA	NA	NA	NA	NA
AVF32783.1|3730922_3731159_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.6e-26
AVF32784.1|3731223_3732447_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32785.1|3732489_3733071_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.4	5.2e-100
AVF32786.1|3733208_3733892_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF32787.1|3734079_3734781_+	response regulator ArlR	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
AVF32788.1|3734770_3736150_+	sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
AVF32789.1|3736307_3736829_+	putative cell-wall hydrolase	NA	NA	NA	NA	NA
AVF32790.1|3736902_3737385_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32791.1|3737435_3738167_-	glyoxalase family protein	NA	NA	NA	NA	NA
AVF32792.1|3738566_3739358_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32793.1|3739354_3740257_-	carboxylate/amino acid/amine transporter	NA	NA	NA	NA	NA
AVF32794.1|3740588_3741572_-	Homoserine kinase	NA	NA	NA	NA	NA
AVF32795.1|3741829_3743047_-	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVF32796.1|3743112_3743703_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF32797.1|3743827_3744889_-	glyceraldehyde-3-phosphate dehydrogenase 2	NA	NA	NA	NA	NA
AVF32798.1|3745165_3746206_-	putative oxidoreductase YvaA	NA	NA	NA	NA	NA
AVF32799.1|3746290_3746536_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32800.1|3747114_3747597_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32801.1|3748006_3748492_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32802.1|3748888_3749059_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF32803.1|3749073_3749298_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32804.1|3749448_3749766_-	methylated-DNA-protein- cysteinemethyltransferase	NA	NA	NA	NA	NA
AVF32805.1|3750026_3750398_-	transcriptional regulator, ArsR family	NA	NA	NA	NA	NA
AVF32806.1|3750399_3750825_-	putative toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
AVF32807.1|3751181_3751586_-|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
AVF32808.1|3751804_3752053_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32809.1|3752055_3752235_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32810.1|3752207_3752459_-	Sigma-O factor regulatory protein RsoA	NA	NA	NA	NA	NA
AVF32811.1|3752524_3753118_-	RNA polymerase sigma factor SigO	NA	NA	NA	NA	NA
AVF32812.1|3753758_3754967_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF32813.1|3754956_3755184_+	Sulfurtransferase TusA	NA	NA	NA	NA	NA
AVF32814.1|3755533_3756754_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF32815.1|3756795_3757065_-	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVF32816.1|3757067_3757238_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32817.1|3757244_3757670_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF32818.1|3757939_3758203_-	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF32819.1|3758277_3758508_-	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF32820.1|3758991_3760230_-	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVF32821.1|3760357_3761191_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32822.1|3761638_3762445_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF32823.1|3762627_3763806_+	cystathionine beta-lyase PatB	NA	NA	NA	NA	NA
AVF32824.1|3763854_3766215_-	Helicase IV	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.5	2.9e-08
AVF32825.1|3766458_3766914_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF32826.1|3766970_3767909_+	multidrug resistance protein	NA	NA	NA	NA	NA
AVF32827.1|3768057_3769695_-	L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AVF32828.1|3770029_3771298_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32829.1|3771290_3772196_-	ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
AVF32830.1|3772498_3773722_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF32831.1|3774696_3774915_-|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
>prophage 30
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3784522	3828996	4268596	tRNA,transposase,bacteriocin	Pneumococcus_phage(16.67%)	49	NA	NA
AVF32842.1|3784522_3785212_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF32843.1|3785385_3786090_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	5.1e-57
AVF32844.1|3786341_3788315_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32845.1|3788610_3788967_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32846.1|3788963_3789659_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.9	1.2e-18
AVF32847.1|3789652_3789772_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF32848.1|3790516_3790894_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF32849.1|3791128_3791230_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32850.1|3791258_3791426_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVF32851.1|3792231_3792630_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.2	7.6e-10
AVF32852.1|3792658_3792787_-	putative transposon DNA-invertase Bin3	NA	NA	NA	NA	NA
AVF32853.1|3792898_3793081_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32854.1|3793235_3793535_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF32855.1|3793542_3794664_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32856.1|3794660_3794810_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32857.1|3795188_3795803_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	4.8e-11
AVF32858.1|3795781_3796285_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32859.1|3796734_3797415_-	Putative undecaprenyl-diphosphatase YbjG	NA	NA	NA	NA	NA
AVF32860.1|3797502_3799314_-	Phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
AVF32861.1|3799342_3800041_-	regulatory protein TenI	NA	NA	NA	NA	NA
AVF32862.1|3800012_3800936_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ThiD	NA	NA	NA	NA	NA
AVF32863.1|3800932_3801733_-	thiazole synthase ThiG	NA	NA	NA	NA	NA
AVF32864.1|3801734_3801938_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVF32865.1|3801994_3803140_-	FAD-dependent glycine oxidase-like protein	NA	NA	NA	NA	NA
AVF32866.1|3803123_3803756_-	regulatory protein TenI	NA	NA	NA	NA	NA
AVF32867.1|3804167_3804599_-	Double zinc ribbon	NA	NA	NA	NA	NA
AVF32868.1|3804772_3805054_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32869.1|3805616_3806237_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32870.1|3806220_3806769_-	RNA polymerase sigma factor SigW-like protein	NA	NA	NA	NA	NA
AVF32871.1|3807004_3808423_+	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF32872.1|3808528_3808930_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVF32873.1|3809185_3810628_-	putative dipeptidase YtjP	NA	NA	NA	NA	NA
AVF32874.1|3810752_3811799_-	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVF32875.1|3811965_3812457_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.6e-49
AVF32876.1|3812510_3813248_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
AVF32877.1|3813240_3813726_-	queuosine biosynthesis protein QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
AVF32878.1|3813722_3814394_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.3	1.4e-67
AVF32879.1|3814936_3816646_+|tRNA	arginine--tRNA ligase ArgS	tRNA	A0A2I2L3K1	Orpheovirus	32.3	4.1e-76
AVF32880.1|3816875_3817310_-|transposase	transposase, IS605 OrfB family protein	transposase	A0A288TXV8	Enterococcus_phage	74.4	9.7e-43
AVF32881.1|3817678_3819661_+	peptidoglycan-N-acetylmuramate O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.7	2.0e-42
AVF32882.1|3819677_3820181_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32883.1|3820262_3820481_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32884.1|3820522_3821623_-	putative beta-lactamase	NA	NA	NA	NA	NA
AVF32885.1|3822011_3822908_+	Major membrane immunogen, membrane-anchored lipoprotein	NA	NA	NA	NA	NA
AVF32886.1|3823053_3824931_+	NADH dehydrogenase Ndh	NA	NA	NA	NA	NA
AVF32887.1|3825056_3825506_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32888.1|3825521_3826499_+	heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
AVF32889.1|3827220_3827988_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF32890.1|3828201_3828996_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	52.9	1.1e-55
>prophage 31
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3841411	3870709	4268596	transposase	Bacillus_phage(37.5%)	34	NA	NA
AVF32899.1|3841411_3842635_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF32900.1|3843039_3843567_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32901.1|3843662_3843977_+	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVF32902.1|3843951_3844212_+	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVF32903.1|3844208_3844514_+	heavy metal sensor kinase	NA	NA	NA	NA	NA
AVF32904.1|3844523_3844853_+	Two-component sensor histidine kinase YkoG-like protein	NA	NA	NA	NA	NA
AVF32905.1|3845200_3846085_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AVF32906.1|3846056_3847496_-	3-octaprenyl-4hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVF32907.1|3847509_3848784_-	aminotransferase class-III	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.5e-27
AVF32908.1|3848819_3850742_-	peptidase U32	NA	NA	NA	NA	NA
AVF32909.1|3850874_3851678_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVF32910.1|3851693_3852560_-	energy-coupling factor transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
AVF32911.1|3852535_3853369_-	energy-coupling factor transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.4e-21
AVF32912.1|3853404_3853965_-	heptaprenyl diphosphate synthase related protein	NA	NA	NA	NA	NA
AVF32913.1|3853951_3854332_-	putative membrane protein	NA	NA	NA	NA	NA
AVF32914.1|3854631_3855699_+	thiamine biosynthesis lipoprotein ApbE	NA	NA	NA	NA	NA
AVF32915.1|3856146_3857376_+	acetyltransferase	NA	NA	NA	NA	NA
AVF32916.1|3857901_3859500_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVF32917.1|3859573_3859972_-|transposase	putative transposase	transposase	A0A2I7RFB5	Vibrio_phage	34.5	9.9e-10
AVF32918.1|3860393_3860606_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32919.1|3860560_3860905_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32920.1|3861422_3861800_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32921.1|3861796_3862366_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF32922.1|3862938_3863421_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32923.1|3864037_3864352_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	41.6	4.0e-14
AVF32924.1|3864443_3864863_+	site-specific tyrosine recombinase XerC	NA	NA	NA	NA	NA
AVF32925.1|3865401_3865821_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF32926.1|3865827_3866481_+	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVF32927.1|3866600_3866888_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF32928.1|3866905_3867826_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF32929.1|3867891_3868926_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF32930.1|3868909_3869602_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF32931.1|3869558_3870374_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF32932.1|3870421_3870709_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
>prophage 32
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3902116	3926586	4268596	bacteriocin,transposase	Paenibacillus_phage(75.0%)	27	NA	NA
AVF32961.1|3902116_3903598_+|bacteriocin	putative bacteriocin-skfA transport system permease protein SkfF	bacteriocin	NA	NA	NA	NA
AVF32962.1|3903567_3904071_+	hypothetical protein	NA	NA	NA	NA	NA
AVF32963.1|3904085_3904532_+	Thiol-disulfide oxidoreductase YkuV	NA	NA	NA	NA	NA
AVF32964.1|3904627_3905410_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF32965.1|3905654_3906446_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	NA	NA	NA	NA
AVF32966.1|3906774_3907152_-	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
AVF32967.1|3907286_3909047_-	PTS-dependent dihydroxyacetone kinase, dihydroxyacetone-binding subunit DhaK	NA	NA	NA	NA	NA
AVF32968.1|3909048_3910185_-	Glycerol dehydrogenase	NA	NA	NA	NA	NA
AVF32969.1|3910368_3911535_+	Msm operon regulatory protein MsmR	NA	NA	NA	NA	NA
AVF32970.1|3911686_3912118_+	Transposase, TnpA family	NA	NA	NA	NA	NA
AVF32971.1|3912188_3912845_-	putative maltose O-acetyltransferase Maa	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	41.7	3.6e-17
AVF32972.1|3913346_3913475_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32973.1|3913995_3914364_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF32974.1|3914582_3914840_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32975.1|3915326_3917546_+	spore cortex-lytic enzyme	NA	NA	NA	NA	NA
AVF32976.1|3917568_3917892_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	97.2	2.8e-55
AVF32977.1|3917912_3918281_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	98.4	1.3e-64
AVF32978.1|3918374_3918503_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32979.1|3918530_3919385_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32980.1|3919874_3920654_-	Tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AVF32981.1|3920698_3921382_-	Kynurenine formamidase	NA	NA	NA	NA	NA
AVF32982.1|3922456_3922606_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
AVF32983.1|3922731_3924138_+	radical SAM domain protein	NA	NA	NA	NA	NA
AVF32984.1|3924611_3924740_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32985.1|3924757_3924934_-	hypothetical protein	NA	NA	NA	NA	NA
AVF32986.1|3925501_3926059_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF32987.1|3926076_3926586_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 33
CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	4092967	4100145	4268596	transposase	Bacillus_phage(33.33%)	8	NA	NA
AVF33131.1|4092967_4095037_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheH	NA	W8CYL7	Bacillus_phage	29.5	2.4e-46
AVF33132.1|4095033_4096794_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheI	NA	W8CYL7	Bacillus_phage	28.2	1.2e-46
AVF33133.1|4096963_4097107_-	hypothetical protein	NA	NA	NA	NA	NA
AVF33134.1|4097386_4098217_-	putative oxidoreductase YajO	NA	A0A2H4PQR8	Staphylococcus_phage	49.3	7.2e-71
AVF33135.1|4098347_4098722_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF33136.1|4098742_4099111_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF33137.1|4099201_4099480_-	hypothetical protein	NA	NA	NA	NA	NA
AVF33138.1|4099491_4100145_-	ABC-type transporter ATP-binding protein EcsA	NA	A0A076FI99	Aureococcus_anophage	27.6	1.1e-10
>prophage 1
CP019660	Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence	60865	17466	53125	60865	transposase,integrase	Paenibacillus_phage(25.0%)	41	12445:12459	41733:41747
12445:12459	attL	AACATTGATAATTAC	NA	NA	NA	NA
AVF33316.1|17466_17862_+|transposase	transposase IS200-family protein	transposase	Q332K6	Clostridium_botulinum_C_phage	63.6	1.3e-41
AVF33317.1|17866_18922_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
AVF33318.1|19360_19807_+	transition state regulatory protein AbrB	NA	NA	NA	NA	NA
AVF33319.1|20361_21819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33320.1|21856_22531_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33321.1|22691_23009_-	hypothetical protein	NA	NA	NA	NA	NA
AVF33322.1|22950_23097_-	hypothetical protein	NA	NA	NA	NA	NA
AVF33323.1|23546_23816_+	Antitoxin MazE	NA	A0A0N9S804	Paenibacillus_phage	50.0	3.7e-08
AVF33324.1|23812_24142_+	mRNA interferase NdoA	NA	NA	NA	NA	NA
AVF33325.1|24583_25024_-	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF33326.1|25791_26070_-	DNA-binding protein HU 1	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
AVF33327.1|26179_26386_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
AVF33328.1|26742_27426_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
AVF33329.1|27563_28316_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	8.4e-135
AVF33330.1|28430_29348_-|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
AVF33331.1|29494_29746_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33332.1|29711_29972_+	hypothetical protein	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
AVF33333.1|30174_30903_+	DNA topoisomerase 1	NA	NA	NA	NA	NA
AVF33334.1|31003_31624_-	hypothetical protein	NA	NA	NA	NA	NA
AVF33335.1|31955_33536_+	putative DnaQ family exonuclease/DinG family helicase	NA	NA	NA	NA	NA
AVF33336.1|33981_34917_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVF33337.1|35105_35993_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33338.1|36173_36623_+	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	48.2	7.5e-06
AVF33339.1|36930_37032_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33340.1|37255_38143_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	44.5	2.8e-52
AVF33341.1|38575_38959_+|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF33342.1|39046_39907_-	metallo-beta-lactamase domain protein	NA	NA	NA	NA	NA
AVF33343.1|40180_40669_+	Bacterial transcription activator, effector binding domain	NA	NA	NA	NA	NA
AVF33344.1|40748_42800_+	Catalase HPII	NA	A0A2K9L572	Tupanvirus	40.8	1.8e-115
41733:41747	attR	AACATTGATAATTAC	NA	NA	NA	NA
AVF33345.1|43530_44754_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF33346.1|45654_45852_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33347.1|45891_46176_-	YolD-like protein	NA	NA	NA	NA	NA
AVF33348.1|46220_47456_-	DNA polymerase IV 2	NA	M1Q231	Streptococcus_phage	30.1	2.1e-45
AVF33349.1|48190_48664_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	43.0	2.5e-12
AVF33350.1|48653_48824_+	Spo0E like sporulation regulatory protein	NA	NA	NA	NA	NA
AVF33351.1|48900_49026_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33352.1|49015_49354_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33353.1|49408_49816_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33354.1|49882_50386_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33355.1|50538_51501_+	hypothetical protein	NA	NA	NA	NA	NA
AVF33356.1|52069_53125_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
