The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	106870	118580	4489122	transposase	Paenibacillus_phage(50.0%)	13	NA	NA
AVF24379.1|106870_108340_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.6	6.5e-123
AVF24380.1|108379_109903_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.3e-123
AVF24381.1|110160_111342_+	flagellin	NA	NA	NA	NA	NA
AVF24382.1|111493_111868_+	flagellar protein FlaG	NA	NA	NA	NA	NA
AVF24383.1|111894_113451_+	flagellar hook-associated protein	NA	NA	NA	NA	NA
AVF24384.1|113473_113875_+	flagellar protein FliS	NA	NA	NA	NA	NA
AVF24385.1|113858_114197_+	flagellar protein FliT	NA	NA	NA	NA	NA
AVF24386.1|114287_114971_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF24387.1|115141_115861_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF24388.1|116268_116466_+	cold shock-like protein CspC	NA	Q9AZD3	Lactococcus_phage	66.1	4.9e-18
AVF24389.1|116787_117336_+	SigL modulation protein	NA	NA	NA	NA	NA
AVF24390.1|117701_118178_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF24391.1|118205_118580_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
>prophage 2
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	242546	307271	4489122	transposase,tRNA,bacteriocin,protease	Paenibacillus_phage(17.65%)	59	NA	NA
AVF24503.1|242546_243563_+|tRNA	putative tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AVF24504.1|243830_244313_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVF24505.1|244439_245936_+|tRNA	lysine--tRNA ligase LysS	tRNA	A0A1V0SAC0	Catovirus	40.7	3.2e-93
AVF24506.1|252847_253165_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24507.1|253252_254830_-	putative glucose dehydrogenase	NA	NA	NA	NA	NA
AVF24508.1|254822_255419_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24509.1|255424_255817_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24510.1|256005_256956_+	putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase TagO	NA	NA	NA	NA	NA
AVF24511.1|257037_258144_+	lipoyl synthase-like protein	NA	NA	NA	NA	NA
AVF24512.1|258242_259364_+	maltodextrin import ATP-binding protein MsmX	NA	Q6GZ03	Mycoplasma_phage	32.3	2.7e-20
AVF24513.1|259490_260426_+	HPr kinase/phosphorylase HprK	NA	NA	NA	NA	NA
AVF24514.1|260464_261475_+	prolipoprotein diacylglyceryl transferase Lgt	NA	NA	NA	NA	NA
AVF24515.1|261471_262137_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AVF24516.1|262120_262645_+	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF24517.1|262761_263514_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	99.2	3.8e-135
AVF24518.1|263647_264331_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF24519.1|264680_265907_+	ATP phosphoribosyltransferase regulatory subunit HisZ	NA	NA	NA	NA	NA
AVF24520.1|265899_266535_+	ATP phosphoribosyltransferase HisG	NA	NA	NA	NA	NA
AVF24521.1|266557_267844_+	histidinol dehydrogenase HisD	NA	NA	NA	NA	NA
AVF24522.1|267840_268440_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
AVF24523.1|268443_269049_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AVF24524.1|269177_269912_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase HisA	NA	NA	NA	NA	NA
AVF24525.1|269998_270757_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AVF24526.1|270753_271482_+	histidine biosynthesis bifunctional protein HisIE	NA	NA	NA	NA	NA
AVF24527.1|271551_272358_+	putative histidinol-phosphatase HisK	NA	NA	NA	NA	NA
AVF24528.1|272563_273514_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	32.7	7.8e-37
AVF24529.1|273594_275361_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVF24530.1|275377_276325_+	thioredoxin reductase TrxB	NA	A0A2I2L5E1	Orpheovirus	49.4	1.5e-72
AVF24531.1|276516_277464_+	putative glucokinase	NA	NA	NA	NA	NA
AVF24532.1|277524_278406_+	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	30.3	2.3e-06
AVF24533.1|278417_279395_+	putative membrane protein	NA	A1IMD5	Streptococcus_phage	39.2	5.4e-57
AVF24534.1|279400_280336_+	putative sporulation transcription regulator WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	8.2e-55
AVF24535.1|280608_280878_+	HPr-like protein Crh	NA	NA	NA	NA	NA
AVF24536.1|280987_281221_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24537.1|281247_281871_-	Yip1 domain protein	NA	NA	NA	NA	NA
AVF24538.1|281904_282489_-	integral membrane protein	NA	NA	NA	NA	NA
AVF24539.1|282475_283195_-	ATP-binding transport protein NatA	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	1.9e-22
AVF24540.1|283191_284847_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24541.1|284904_285129_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF24542.1|285349_285931_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	57.6	7.4e-54
AVF24543.1|286466_287495_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
AVF24544.1|287551_288556_+	glyceraldehyde-3-phosphate dehydrogenase Gap	NA	NA	NA	NA	NA
AVF24545.1|288693_289875_+	phosphoglycerate kinase Pgk	NA	NA	NA	NA	NA
AVF24546.1|289896_290649_+	triosephosphate isomerase TpiA	NA	NA	NA	NA	NA
AVF24547.1|290650_292189_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF24548.1|292345_293638_+	enolase Eno	NA	W6LP63	Streptococcus_phage	71.7	2.5e-171
AVF24549.1|293706_294420_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24550.1|294552_294789_+	Preprotein translocase band 1 subunit	NA	NA	NA	NA	NA
AVF24551.1|295068_297573_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.7	4.5e-92
AVF24552.1|297825_298305_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	8.2e-43
AVF24553.1|299773_300091_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24554.1|300773_302651_+	Excinuclease ABC subunit B	NA	A0A097BY72	Enterococcus_phage	22.8	2.8e-22
AVF24555.1|302640_302955_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24556.1|303050_303410_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24557.1|303356_304577_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF24558.1|304699_305470_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24559.1|306221_306590_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24560.1|306745_306835_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24561.1|306989_307271_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
>prophage 3
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	381191	412118	4489122	transposase,protease,integrase,tRNA	Paenibacillus_phage(36.36%)	37	382265:382281	405395:405411
AVF24629.1|381191_381560_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF24630.1|381580_381904_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	97.2	2.8e-55
AVF24631.1|381926_382877_-	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
382265:382281	attL	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
AVF24632.1|383073_384813_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	NA	NA	NA	NA
AVF24633.1|384838_385096_-	HPr-like protein	NA	NA	NA	NA	NA
AVF24634.1|385248_385701_-	PTS system, fructose subfamily, IIA component	NA	NA	NA	NA	NA
AVF24635.1|385719_387159_-	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF24636.1|387576_388056_+	ATP-binding protein YdiB	NA	NA	NA	NA	NA
AVF24637.1|388052_388931_+|protease	chaperone-like protein/protease-like protein	protease	NA	NA	NA	NA
AVF24638.1|388946_389456_+	putative ribosomal-protein-alanine acetyltransferase RimI	NA	NA	NA	NA	NA
AVF24639.1|389477_390497_+|tRNA	putative tRNA threonylcarbamoyladenosine biosynthesis protein Gcp	tRNA	A0A0R6PI74	Moraxella_phage	40.0	4.3e-65
AVF24640.1|390628_391768_-	Glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.2	8.8e-51
AVF24641.1|392206_392548_-	carbohydrate diacid transcriptional activator CdaR	NA	NA	NA	NA	NA
AVF24642.1|392507_392621_-	Sugar diacid regulator	NA	NA	NA	NA	NA
AVF24643.1|392836_392986_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24644.1|393253_394270_+	peptidase U61 LD-carboxypeptidase A	NA	NA	NA	NA	NA
AVF24645.1|394365_396297_-	putative ABC transporter ATP-binding protein YdiF	NA	A0A2K9L3Z8	Tupanvirus	30.7	8.7e-59
AVF24646.1|396572_397208_+	5-formyltetrahydrofolate cyclo-ligase-like protein	NA	NA	NA	NA	NA
AVF24647.1|397266_397719_+	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AVF24648.1|397737_398229_+	molybdopterin adenylyltransferase Mog	NA	NA	NA	NA	NA
AVF24649.1|398225_399236_+	molybdene to molybdopterin ligation enzyme-like protein	NA	NA	NA	NA	NA
AVF24650.1|399267_399531_+	twin-arginine translocation protein, TatA/E family subunit	NA	NA	NA	NA	NA
AVF24651.1|399530_400337_+	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.5e-12
AVF24652.1|400329_400584_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24653.1|400658_400940_+	10 kDa chaperonin	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
AVF24654.1|401029_402658_+	60 kDa chaperonin	NA	A0A219YK78	uncultured_virus	59.1	8.1e-159
AVF24655.1|402746_402971_-|integrase	integrase	integrase	A0A0C5AN64	Paenibacillus_phage	69.9	2.0e-20
AVF24656.1|403192_403396_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24657.1|403310_403784_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24658.1|405068_405194_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24659.1|405405_405807_+	YmaF family protein	NA	NA	NA	NA	NA
405395:405411	attR	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
AVF24660.1|406626_406878_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24661.1|407072_407255_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24662.1|407270_407480_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF24663.1|408228_410004_+	GlcNAc-binding protein A	NA	NA	NA	NA	NA
AVF24664.1|410245_410917_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	96.9	2.5e-130
AVF24665.1|411302_412118_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
>prophage 4
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	417689	512774	4489122	coat,tRNA,integrase,transposase,protease	Paenibacillus_phage(52.27%)	106	407631:407659	508338:508366
407631:407659	attL	TAAAAATAACCTGCCGCTAAGACAGGTTA	NA	NA	NA	NA
AVF24671.1|417689_419324_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.8	1.0e-76
AVF24672.1|419428_420652_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF24673.1|420684_420879_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24674.1|420838_422101_+	toxin-like protein	NA	R9VWV6	Paenibacillus_phage	58.2	1.9e-14
AVF24675.1|422239_422851_+	toxin-like protein	NA	NA	NA	NA	NA
AVF24676.1|422928_423357_+	putative lethal factor domain protein	NA	NA	NA	NA	NA
AVF24677.1|423442_423667_+	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
AVF24678.1|423668_423767_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24679.1|423778_424594_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF24680.1|424641_424929_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF24681.1|425085_425337_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7QIN4	Bacillus_phage	52.0	2.8e-10
AVF24682.1|425294_425447_+	N-acetylmuramoyl-l-alanine amidase	NA	NA	NA	NA	NA
AVF24683.1|425473_425716_+	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
AVF24684.1|425864_426083_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24685.1|426054_426594_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24686.1|428195_428345_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24687.1|429074_429995_+	DNA polymerase IV 2	NA	O64031	Bacillus_phage	37.6	1.3e-44
AVF24688.1|430061_430202_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24689.1|430177_431308_+	Fic/DOC family protein	NA	NA	NA	NA	NA
AVF24690.1|431388_431526_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24691.1|431808_432429_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24692.1|432840_433836_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF24693.1|434308_434485_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24694.1|434531_434774_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24695.1|435532_436984_+	amino acid antiporter	NA	NA	NA	NA	NA
AVF24696.1|436995_438864_+	decarboxylase	NA	NA	NA	NA	NA
AVF24697.1|438934_440323_+	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF24698.1|440872_442135_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.2e-87
AVF24699.1|442166_442868_+	Replication protein	NA	NA	NA	NA	NA
AVF24700.1|443822_445271_+	putative transporter	NA	NA	NA	NA	NA
AVF24701.1|445328_447191_+	decarboxylase	NA	NA	NA	NA	NA
AVF24702.1|447300_448116_+	pyridoxine kinase PdxK	NA	NA	NA	NA	NA
AVF24703.1|448207_449593_+	putative tyrosine permease, NhaC family	NA	NA	NA	NA	NA
AVF24704.1|449879_450176_+	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVF24705.1|450431_451136_+	putative membrane protein	NA	NA	NA	NA	NA
AVF24706.1|451364_452180_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	D6QWP2	uncultured_phage	52.9	1.7e-40
AVF24707.1|452419_453250_+	Chitinase D precursor	NA	NA	NA	NA	NA
AVF24708.1|453744_454302_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.4	5.4e-38
AVF24709.1|454298_455258_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.7	6.6e-76
AVF24710.1|455254_456109_+|coat	spore coat polysaccharide biosynthesis protein SpsK	coat	NA	NA	NA	NA
AVF24711.1|456352_456934_+	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF24712.1|457224_457857_-	transporter-like protein	NA	NA	NA	NA	NA
AVF24713.1|458392_458716_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24714.1|458773_460138_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF24715.1|460124_460301_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24716.1|460465_460972_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24717.1|460990_461317_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24718.1|461980_462214_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24719.1|462232_463114_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24720.1|463136_464069_+	CRISPR-associated RAMP Cmr1 family protein	NA	NA	NA	NA	NA
AVF24721.1|464068_465742_+	CRISPR-associated RAMP Crm2 family protein	NA	NA	NA	NA	NA
AVF24722.1|465744_466866_+	CRISPR-associated protein, Cmr3 family	NA	NA	NA	NA	NA
AVF24723.1|466858_467776_+	CRISPR-associated RAMP protein, Cmr4 family	NA	NA	NA	NA	NA
AVF24724.1|467759_468164_+	CRISPR-associated protein, Cmr5 family	NA	NA	NA	NA	NA
AVF24725.1|468126_468996_+	CRISPR-associated RAMP Cmr6 family protein	NA	NA	NA	NA	NA
AVF24726.1|469291_469456_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	54.5	2.5e-07
AVF24727.1|469452_470181_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	68.3	4.9e-15
AVF24728.1|470431_470737_-	oxygen regulatory protein NreC	NA	NA	NA	NA	NA
AVF24729.1|470896_471568_+	ABC-transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
AVF24730.1|471564_471735_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24731.1|471754_472048_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	3.7e-14
AVF24732.1|472143_472518_-|transposase	putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	69.7	5.1e-48
AVF24733.1|473698_474187_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24734.1|474204_474573_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF24735.1|474593_474968_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.0	1.3e-64
AVF24736.1|475638_476895_+	sporulation protein YdcC	NA	NA	NA	NA	NA
AVF24737.1|477062_478250_+	alanine racemase Alr	NA	NA	NA	NA	NA
AVF24738.1|478484_478766_+	putative transcriptional regulator, CopG family	NA	NA	NA	NA	NA
AVF24739.1|478769_479120_+	mRNA interferase NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
AVF24740.1|479207_481496_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24741.1|481697_482279_-	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF24742.1|482661_483120_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24743.1|483152_483254_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24744.1|483204_483432_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24745.1|483687_484887_+|protease	minor extracellular protease Epr	protease	A0A217EQY2	Bacillus_phage	38.8	3.4e-45
AVF24746.1|485464_485821_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24747.1|485919_486390_+	SprT-like protein	NA	NA	NA	NA	NA
AVF24748.1|487112_487811_-|integrase	phage integrase-like protein	integrase	A0A2I7SC08	Paenibacillus_phage	58.4	1.9e-72
AVF24749.1|487798_488089_-|integrase	phage integrase family protein	integrase	S5MNZ2	Brevibacillus_phage	53.4	1.2e-15
AVF24750.1|488101_488866_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF24751.1|489165_489756_+	phage structural protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
AVF24752.1|489767_490058_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
AVF24753.1|490057_490216_+	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	60.9	4.3e-09
AVF24754.1|490371_490608_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
AVF24755.1|490604_491276_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	96.4	1.2e-129
AVF24756.1|491285_491531_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
AVF24757.1|492279_492438_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24758.1|493016_493445_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24759.1|493451_494675_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF24760.1|495047_495800_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	8.4e-135
AVF24761.1|495937_496621_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
AVF24762.1|497549_498194_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
AVF24763.1|498170_499001_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	1.5e-153
AVF24764.1|499006_499288_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
AVF24765.1|499312_500710_+	1-phosphatidylinositol phosphodiesterase precursor	NA	NA	NA	NA	NA
AVF24766.1|501071_501755_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF24767.1|501892_502645_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF24768.1|503230_504505_+	toxin-like protein	NA	NA	NA	NA	NA
AVF24769.1|504575_507188_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	33.4	2.6e-98
AVF24770.1|507713_508319_+	putative ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	9.7e-33
AVF24771.1|508673_509645_+	toxin-like protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
508338:508366	attR	TAACCTGTCTTAGCGGCAGGTTATTTTTA	NA	NA	NA	NA
AVF24772.1|509704_510724_+	toxin-like protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
AVF24773.1|510740_511148_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24774.1|511504_511786_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
AVF24775.1|511791_512622_+|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	1.5e-153
AVF24776.1|512675_512774_+	hypothetical protein	NA	A0A2I7SCT3	Paenibacillus_phage	96.9	2.3e-08
>prophage 5
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	582749	639387	4489122	transposase,tRNA,bacteriocin	Paenibacillus_phage(14.29%)	60	NA	NA
AVF24859.1|582749_583475_+|tRNA	tRNA (guanine-N(7)-)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVF24860.1|583471_584614_-	processive diacylglycerol glucosyltransferase UgtP	NA	NA	NA	NA	NA
AVF24861.1|585240_586479_+	glycosyl transferase	NA	NA	NA	NA	NA
AVF24862.1|586745_587246_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	3.4e-15
AVF24863.1|587291_587492_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVF24864.1|587531_587891_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVF24865.1|588379_590125_+	acetolactate synthase large subunit IlvB	NA	G8DDL3	Micromonas_pusilla_virus	31.0	3.3e-65
AVF24866.1|590124_590616_+	putative acetolactate synthase small subunit IlvH	NA	NA	NA	NA	NA
AVF24867.1|590848_591838_+	ketol-acid reductoisomerase IlvC	NA	NA	NA	NA	NA
AVF24868.1|591872_593420_+	2-isopropylmalate synthase LeuA	NA	E5EQ69	Micromonas_sp._RCC1109_virus	40.2	1.1e-08
AVF24869.1|593509_593743_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24870.1|593755_594283_-	integral membrane protein	NA	NA	NA	NA	NA
AVF24871.1|594279_594981_-	putative ABC-transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.6e-18
AVF24872.1|594973_596638_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24873.1|596715_597051_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF24874.1|597342_597657_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24875.1|598008_599097_+	3-isopropylmalate dehydrogenase LeuB	NA	NA	NA	NA	NA
AVF24876.1|599321_599867_+	thioredoxin-like protein YkuU	NA	NA	NA	NA	NA
AVF24877.1|600011_600407_+	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVF24878.1|600444_602415_-	glycosyl hydrolase, family 15	NA	NA	NA	NA	NA
AVF24879.1|602461_602662_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24880.1|602849_603275_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24881.1|603575_604259_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF24882.1|604429_605149_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF24883.1|605255_606215_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24884.1|606433_607252_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
AVF24885.1|607244_608357_+	sigmaI modulating factor-like protein	NA	NA	NA	NA	NA
AVF24886.1|608569_609964_+	sporulation kinase A	NA	NA	NA	NA	NA
AVF24887.1|610104_610644_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24888.1|611004_612471_-	putative glycine dehydrogenase [decarboxylating] subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	1.8e-80
AVF24889.1|612467_613823_-	putative glycine dehydrogenase [decarboxylating] subunit 1	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
AVF24890.1|613863_614970_-	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVF24891.1|615586_615976_+	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVF24892.1|616197_616632_+	UspA domain-containing protein	NA	NA	NA	NA	NA
AVF24893.1|616946_617216_+	ribokinase-like protein	NA	NA	NA	NA	NA
AVF24894.1|617245_618202_+	thymidylate synthase ThyA	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
AVF24895.1|618256_618742_+	dihydrofolate reductase DfrA	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
AVF24896.1|618686_618827_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24897.1|618810_619119_+	Copper-sensitive operon repressor	NA	NA	NA	NA	NA
AVF24898.1|619139_619340_+	copper insertion chaperone and transporter component-like protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
AVF24899.1|619434_621861_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
AVF24900.1|621917_622541_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24901.1|622630_623308_-	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVF24902.1|623304_624111_-	histidine kinase	NA	NA	NA	NA	NA
AVF24903.1|624400_624643_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24904.1|625366_625651_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24905.1|625823_627509_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AVF24906.1|627818_628175_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24907.1|628401_629064_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24908.1|629971_630673_-	nitric oxide-dependent regulator	NA	NA	NA	NA	NA
AVF24909.1|631030_632263_+	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
AVF24910.1|632287_633526_+	nitrite reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVF24911.1|633663_633828_+	Rubredoxin-2	NA	NA	NA	NA	NA
AVF24912.1|633899_634607_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVF24913.1|634882_635536_-	hypothetical protein	NA	NA	NA	NA	NA
AVF24914.1|635652_636834_-	putative membrane protein	NA	NA	NA	NA	NA
AVF24915.1|637019_637184_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24916.1|637730_637949_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.2	2.5e-07
AVF24917.1|638165_638483_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
AVF24918.1|638550_639387_-|transposase	transposase-like protein	transposase	A0A1B1P773	Bacillus_phage	39.5	1.9e-47
>prophage 6
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	706322	748506	4489122	protease,tRNA,transposase	Bacillus_phage(23.53%)	37	NA	NA
AVF24981.1|706322_708272_+|tRNA	threonine--tRNA ligase ThrS	tRNA	A0A2K9L6B6	Tupanvirus	36.2	6.0e-124
AVF24982.1|708414_709098_+	3D domain protein	NA	L0LBX4	Bacillus_phage	35.9	6.7e-14
AVF24983.1|709219_709582_+	hypothetical protein	NA	NA	NA	NA	NA
AVF24984.1|709806_710841_+	putative membrane protein	NA	NA	NA	NA	NA
AVF24985.1|710844_711879_+	sensor histidine kinase LiaS	NA	NA	NA	NA	NA
AVF24986.1|712802_714311_+|protease	putative serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.1	1.9e-21
AVF24987.1|714472_715162_+	response regulator MprA	NA	W8CYM9	Bacillus_phage	40.1	5.1e-38
AVF24988.1|715162_716668_+	sensory transduction histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	1.9e-24
AVF24989.1|716739_717693_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase IspH	NA	NA	NA	NA	NA
AVF24990.1|718003_718972_+	deoxyribonucleoside regulator	NA	NA	NA	NA	NA
AVF24991.1|719433_720618_+	pyrimidine nucleoside transport protein NupC	NA	NA	NA	NA	NA
AVF24992.1|720661_721966_+	pyrimidine-nucleoside phosphorylase Pdp	NA	A0A0H3UZD4	Geobacillus_virus	57.4	3.1e-137
AVF24993.1|722048_722726_+	deoxyribose-phosphate aldolase DeoC	NA	NA	NA	NA	NA
AVF24994.1|723017_723188_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.8e-22
AVF24995.1|723233_724016_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	98.5	7.4e-142
AVF24996.1|724682_726107_+	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVF24997.1|726206_726878_-	putative transporter protein	NA	G3MA03	Bacillus_virus	48.5	3.3e-21
AVF24998.1|727072_727681_-	2'-5' RNA-ligase-like protein	NA	NA	NA	NA	NA
AVF24999.1|727854_728943_+	phosphoserine aminotransferase SerC	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-89
AVF25000.1|729113_729578_+|tRNA	putative tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AVF25001.1|729783_730041_+	transcriptional regulator-like protein	NA	S5MA41	Brevibacillus_phage	48.0	3.6e-13
AVF25002.1|730414_731359_-	molybdate binding regulator-like protein	NA	NA	NA	NA	NA
AVF25003.1|731605_732433_+	molybdate-binding lipoprotein-like protein	NA	NA	NA	NA	NA
AVF25004.1|732435_733095_+	molybdenum transport permease-like protein	NA	NA	NA	NA	NA
AVF25005.1|733134_734118_+	thioredoxin reductase	NA	NA	NA	NA	NA
AVF25006.1|734172_734913_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25007.1|735119_737015_+	putative serine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	1.3e-102
AVF25008.1|737132_739703_-	Phosphatidylglycerol lysyltransferase	NA	NA	NA	NA	NA
AVF25009.1|740109_740307_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25010.1|740627_742559_+	zinc-transporting ATPase ZosA	NA	E4ZFI9	Streptococcus_phage	40.6	1.3e-126
AVF25011.1|742687_742894_+	putative conjugation protein	NA	NA	NA	NA	NA
AVF25012.1|743154_743355_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	3.7e-05
AVF25013.1|743494_744661_-	putative transporter protein	NA	NA	NA	NA	NA
AVF25014.1|744687_746253_-	putative ABC transporter ATP-binding protein YdiF	NA	A0A2K9L3Z8	Tupanvirus	31.0	8.3e-52
AVF25015.1|746420_746588_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25016.1|747355_747643_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF25017.1|747690_748506_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
>prophage 7
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	763358	837671	4489122	integrase,head,portal,terminase,tail,transposase,protease,capsid	Paenibacillus_phage(62.69%)	105	768517:768532	805361:805376
AVF25032.1|763358_764582_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF25033.1|764981_765245_+	site-specific recombinase XerD	NA	NA	NA	NA	NA
AVF25034.1|765557_765842_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF25035.1|766356_766728_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25036.1|766804_768316_+	sporulation kinase	NA	NA	NA	NA	NA
AVF25037.1|768339_768564_+	hypothetical protein	NA	NA	NA	NA	NA
768517:768532	attL	AAAAAAAAAGCAGAAG	NA	NA	NA	NA
AVF25038.1|768611_769295_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF25039.1|769465_770185_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF25040.1|770384_770801_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25041.1|771065_771377_+	RNA binding-like protein	NA	NA	NA	NA	NA
AVF25042.1|771462_771729_+	Two component transcriptional regulator, AraC family	NA	NA	NA	NA	NA
AVF25043.1|771775_772417_-	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
AVF25044.1|772552_773659_-	methylthioribose-1-phosphate isomerase 1	NA	NA	NA	NA	NA
AVF25045.1|773678_774908_-	methylthioribose kinase MtnK	NA	NA	NA	NA	NA
AVF25046.1|775126_775576_+	DNA protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
AVF25047.1|775747_776320_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25048.1|776500_777334_+	FeS assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
AVF25049.1|777401_778697_+	FeS assembly protein SufD	NA	NA	NA	NA	NA
AVF25050.1|778693_779920_+	putative cysteine desulfurase Csd	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
AVF25051.1|779906_780344_+	SUF system FeS assembly protein, NifU family	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
AVF25052.1|780368_781766_+	FeS cluster assembly protein SufB	NA	NA	NA	NA	NA
AVF25053.1|781847_783056_-|integrase	integrase Int	integrase	S5MBZ0	Brevibacillus_phage	37.2	3.8e-60
AVF25054.1|783096_783729_-	LexA repressor	NA	A0A1B2APZ3	Phage_Wrath	67.6	3.2e-79
AVF25055.1|783881_784130_+	helix-turn-helix protein	NA	A0A1B2APZ4	Phage_Wrath	68.0	4.6e-21
AVF25056.1|784154_784436_+	hypothetical protein	NA	A0A1B1P7U4	Bacillus_phage	56.0	7.2e-23
AVF25057.1|784520_784775_+	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	91.5	1.3e-34
AVF25058.1|784771_785143_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	8.5e-56
AVF25059.1|785139_785364_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
AVF25060.1|785360_785531_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
AVF25061.1|785535_785724_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25062.1|785720_786398_+	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
AVF25063.1|786412_786676_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
AVF25064.1|786678_786849_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25065.1|786845_787022_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25066.1|787110_788001_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
AVF25067.1|787963_788767_+	phage related protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
AVF25068.1|788816_789218_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
AVF25069.1|789242_789575_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
AVF25070.1|789623_790514_+	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
AVF25071.1|790476_791226_+	phage-related protein	NA	A0A0K2CYY7	Paenibacillus_phage	97.2	2.7e-117
AVF25072.1|791343_791574_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	98.6	9.7e-34
AVF25073.1|791554_792076_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	53.5	1.5e-50
AVF25074.1|792257_792488_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	66.2	6.1e-20
AVF25075.1|792500_792959_+	hypothetical protein	NA	A0A0C5AET2	Bacteriophage	98.7	2.1e-88
AVF25076.1|793048_793417_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	1.4e-13
AVF25077.1|793423_793657_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	69.8	1.7e-14
AVF25078.1|793649_794060_+	YopX protein	NA	A8ASP1	Listeria_phage	39.4	8.9e-14
AVF25079.1|794049_794286_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25080.1|794313_794751_+	phage transcriptional regulator, ArpU family	NA	A0A0K2CYZ6	Paenibacillus_phage	95.9	2.5e-70
AVF25081.1|794956_795298_+	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	8.4e-58
AVF25082.1|795308_796772_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
AVF25083.1|796934_797213_+	hypothetical protein	NA	E5DV94	Deep-sea_thermophilic_phage	42.9	5.9e-09
AVF25084.1|797196_797397_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25085.1|797393_797708_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	86.5	8.3e-44
AVF25086.1|797694_798036_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	98.2	4.4e-59
AVF25087.1|798170_798488_+|terminase	putative phage terminase, small subunit, P27 family	terminase	A0A0C5AMZ2	Paenibacillus_phage	89.5	1.7e-44
AVF25088.1|798462_800196_+|terminase	Phage terminase-like protein, large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	63.5	1.1e-214
AVF25089.1|800214_801474_+|portal	phage portal protein, HK97 family	portal	A0A0A7RUE7	Clostridium_phage	22.9	4.9e-18
AVF25090.1|801430_802012_+|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	34.0	4.4e-14
AVF25091.1|802017_803208_+|capsid	phage major capsid protein, HK97 family	capsid	NA	NA	NA	NA
AVF25092.1|803209_803506_+	putative phage protein (possible DNA packaging)	NA	A0A2H4J6E5	uncultured_Caudovirales_phage	40.7	2.9e-14
AVF25093.1|803468_803801_+|head,tail	putative phage head-tail adaptor	head,tail	A0A0C5AE87	Paenibacillus_phage	91.4	6.7e-52
AVF25094.1|803800_804229_+	phage protein, HK97 gp10 family	NA	A0A0C5AJ13	Paenibacillus_phage	94.4	3.0e-68
AVF25095.1|804212_804608_+	hypothetical protein	NA	A0A0C5AEH4	Paenibacillus_phage	84.7	9.1e-56
AVF25096.1|804609_805044_+|tail	phage major tail protein, TP901-1 family	tail	A0A2I7SCY9	Paenibacillus_phage	95.8	2.0e-72
AVF25097.1|805043_805382_+	hypothetical protein	NA	A0A0C5ABB9	Paenibacillus_phage	51.3	1.5e-22
805361:805376	attR	AAAAAAAAAGCAGAAG	NA	NA	NA	NA
AVF25098.1|805414_805663_+	hypothetical protein	NA	A0A0C5AE91	Paenibacillus_phage	70.4	4.7e-26
AVF25099.1|805717_808354_+|tail	putative phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	95.9	8.0e-249
AVF25100.1|808350_809226_+|tail	Phage tail protein	tail	A0A0C5AEI0	Paenibacillus_phage	46.0	5.0e-70
AVF25101.1|809228_810359_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.8	1.7e-59
AVF25102.1|810378_812331_+	phage structural protein	NA	E2ELJ8	Clostridium_phage	48.5	3.6e-52
AVF25103.1|812343_812529_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25104.1|812546_812729_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25105.1|812721_812877_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25106.1|812917_813157_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
AVF25107.1|813153_813828_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	97.8	1.0e-131
AVF25108.1|814100_814343_+	hypothetical protein	NA	A0A0C5AN23	Paenibacillus_phage	93.8	4.3e-32
AVF25109.1|815605_816358_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF25110.1|816495_817179_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF25111.1|817632_817797_+	40-residue YVTN family beta-propeller repeat	NA	NA	NA	NA	NA
AVF25112.1|817821_818637_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF25113.1|818684_818972_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF25114.1|819089_819710_+	40-residue YVTN family beta-propeller repeat	NA	NA	NA	NA	NA
AVF25115.1|819849_821133_+	ATPase, AAA family	NA	D0R099	Streptococcus_phage	22.5	1.2e-08
AVF25116.1|821107_821260_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25117.1|821510_822068_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF25118.1|822085_822421_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF25119.1|822820_823453_+	toxin-like protein	NA	NA	NA	NA	NA
AVF25120.1|823781_824240_-	HNH endonuclease	NA	NA	NA	NA	NA
AVF25121.1|825201_825489_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF25122.1|825536_826352_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF25123.1|826321_827359_+	amidinotransferase family protein	NA	NA	NA	NA	NA
AVF25124.1|827785_827986_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25125.1|828850_829024_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
AVF25126.1|829468_829876_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
AVF25127.1|830220_831441_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF25128.1|831559_831934_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF25129.1|831954_832323_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF25130.1|832518_832707_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
AVF25131.1|833524_833929_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25132.1|833910_834207_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25133.1|835142_836078_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF25134.1|836047_836491_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF25135.1|836487_836625_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25136.1|837344_837671_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	849029	904709	4489122	transposase,holin,lysis,coat	Paenibacillus_phage(47.37%)	51	NA	NA
AVF25148.1|849029_849782_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.4e-134
AVF25149.1|849915_850599_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF25150.1|850779_850992_+|coat	Spore coat associated protein JA (CotJA)	coat	NA	NA	NA	NA
AVF25151.1|851264_851531_+|coat	spore coat peptide assembly protein	coat	NA	NA	NA	NA
AVF25152.1|851572_852142_+	protein CotJC	NA	NA	NA	NA	NA
AVF25153.1|852534_852831_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
AVF25154.1|853060_853966_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVF25155.1|855169_855367_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25156.1|856062_856539_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	53.4	3.8e-40
AVF25157.1|856800_857295_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25158.1|857532_857922_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25159.1|858086_858770_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF25160.1|858940_859660_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF25161.1|860051_860600_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25162.1|860626_860881_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25163.1|861285_863601_+	magnesium-transporting ATPase, P-type 1	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
AVF25164.1|864378_865047_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF25165.1|865332_866985_+	Polyol:NADP oxidoreductase	NA	NA	NA	NA	NA
AVF25166.1|866975_868046_+	Mannonate dehydratase	NA	NA	NA	NA	NA
AVF25167.1|868162_869368_+	Glucuronide permease	NA	NA	NA	NA	NA
AVF25168.1|869333_869651_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25169.1|869671_871066_+	Uronate isomerase	NA	NA	NA	NA	NA
AVF25170.1|871131_871782_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AVF25171.1|871783_872788_+	5-dehydro-2-deoxygluconokinase IolC	NA	NA	NA	NA	NA
AVF25172.1|872991_874824_+	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
AVF25173.1|874843_875722_+	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF25174.1|875749_877633_+	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF25175.1|877661_878126_+	PTS system, fructose subfamily, IIA component	NA	NA	NA	NA	NA
AVF25176.1|878122_878470_+	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF25177.1|878484_879579_+	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF25178.1|879959_881489_-	glycosyltransferase-like protein	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	5.9e-42
AVF25179.1|881706_882573_+	glycosyltransferase-like protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
AVF25180.1|882688_883828_+	pleiotropic regulatory protein DegT	NA	NA	NA	NA	NA
AVF25181.1|883824_884466_+	bacterial transferase hexapeptide repeat protein	NA	NA	NA	NA	NA
AVF25182.1|884483_885206_+	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
AVF25183.1|885601_886240_-	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF25184.1|886361_886871_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF25185.1|886888_887446_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF25186.1|888438_888717_-	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF25187.1|888817_889024_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF25188.1|889737_889929_-|transposase	transposase-like protein	transposase	A0A0C5AEB1	Paenibacillus_phage	64.8	4.3e-11
AVF25189.1|890556_892866_-	Collagen triple helix repeat (20 copies)	NA	NA	NA	NA	NA
AVF25190.1|894075_894906_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	1.8e-154
AVF25191.1|894911_895193_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF25192.1|896510_896951_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25193.1|897732_898752_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	36.4	4.7e-56
AVF25194.1|898748_899471_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	H9NC64	Sphingomonas_phage	40.6	7.8e-45
AVF25195.1|900484_901375_+	3D domain protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
AVF25196.1|901679_902690_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF25197.1|903118_903994_+	putative endopeptidase LytE	NA	D2KRB9	Lactobacillus_phage	33.0	2.0e-10
AVF25198.1|904310_904709_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 9
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	918996	946387	4489122	coat,transposase	Rhodococcus_phage(50.0%)	29	NA	NA
AVF25214.1|918996_920433_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF25215.1|920438_921557_-|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
AVF25216.1|921556_922927_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF25217.1|922939_924139_-|coat	endospore coat-associated protein YheC	coat	NA	NA	NA	NA
AVF25218.1|924147_925521_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF25219.1|925650_926817_+	putative membrane protein	NA	NA	NA	NA	NA
AVF25220.1|926865_927225_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25221.1|927408_928404_+	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF25222.1|928599_929340_-	ABC-transporter ATP-binding protein	NA	NA	NA	NA	NA
AVF25223.1|929640_929997_+	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	NA	NA	NA	NA
AVF25224.1|930018_930147_+	putative transaldolase Tal	NA	NA	NA	NA	NA
AVF25225.1|930109_930271_-|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVF25226.1|930375_932187_-	oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
AVF25227.1|932393_932636_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25228.1|932754_933042_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25229.1|933196_934534_+	inosine-5'-monophosphate dehydrogenase GuaB	NA	NA	NA	NA	NA
AVF25230.1|934517_934823_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25231.1|934999_935152_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25232.1|935371_935554_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25233.1|935652_937974_+	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF25234.1|937970_938600_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVF25235.1|938621_939596_+	isoprenyl transferase-like protein	NA	NA	NA	NA	NA
AVF25236.1|940122_940329_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25237.1|940294_940837_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25238.1|941280_941532_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF25239.1|942997_944140_+	gamma-D-glutamate-meso-diaminopimelate muropeptidase-like protein	NA	A0A1W6DXV0	Rhodococcus_phage	40.2	6.2e-12
AVF25240.1|944588_945167_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25241.1|945163_945496_-	Sporulation membrane protein YtrH	NA	NA	NA	NA	NA
AVF25242.1|946015_946387_+|transposase	transposase, IS605 OrfB family protein	transposase	A0A288TXV8	Enterococcus_phage	85.2	3.1e-50
>prophage 10
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1025878	1072347	4489122	transposase,tail,capsid,coat	Brevibacillus_phage(42.11%)	58	NA	NA
AVF25321.1|1025878_1027213_+	phage protein	NA	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
AVF25322.1|1027214_1027676_+	putative phage protein	NA	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
AVF25323.1|1027695_1028118_+	phage protein	NA	X5JAB6	Clostridium_phage	41.8	4.4e-24
AVF25324.1|1028489_1030535_+|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	41.7	3.0e-134
AVF25325.1|1030534_1031176_+	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	46.3	4.6e-49
AVF25326.1|1031180_1032149_+	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
AVF25327.1|1032148_1032436_+	hypothetical protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
AVF25328.1|1032438_1032861_+	phage protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
AVF25329.1|1032838_1033915_+|capsid	phage capsid assembly-like protein	capsid	S5MUH6	Brevibacillus_phage	50.3	5.3e-98
AVF25330.1|1033907_1034489_+	putative phage protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
AVF25331.1|1034485_1034764_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25332.1|1034767_1036540_+	phage structural protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
AVF25333.1|1036552_1036948_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25334.1|1036940_1037099_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25335.1|1037137_1037377_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
AVF25336.1|1037373_1038045_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	95.1	2.3e-128
AVF25337.1|1038297_1038528_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
AVF25338.1|1038674_1038842_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
AVF25339.1|1039193_1040252_+	auxin efflux carrier	NA	NA	NA	NA	NA
AVF25340.1|1040288_1041311_+	D-3-phosphoglycerate dehydrogenase SerA	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
AVF25341.1|1041828_1043049_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF25342.1|1043261_1044533_-	putative bifunctional chitinase/lysozyme precursor	NA	NA	NA	NA	NA
AVF25343.1|1045214_1045562_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25344.1|1045612_1045960_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25345.1|1046141_1046345_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
AVF25346.1|1046363_1046666_+|coat	Spore coat protein F precursor	coat	NA	NA	NA	NA
AVF25347.1|1047492_1048632_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF25348.1|1048816_1049170_+	putative propanediol utilization protein	NA	NA	NA	NA	NA
AVF25349.1|1049181_1049613_+	putative ethanolamine/propanediol utilization protein	NA	NA	NA	NA	NA
AVF25350.1|1049847_1050420_+	response regulator-like protein	NA	NA	NA	NA	NA
AVF25351.1|1050412_1051837_+	putative sensor histidine kinase	NA	NA	NA	NA	NA
AVF25352.1|1051978_1053409_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AVF25353.1|1053438_1054803_+	ethanolamine ammonia-lyase heavy chain EutB	NA	NA	NA	NA	NA
AVF25354.1|1054824_1055775_+	ethanolamine ammonia-lyase light chain EutC	NA	NA	NA	NA	NA
AVF25355.1|1055793_1056447_+	ethanolamine utilization protein EutL	NA	NA	NA	NA	NA
AVF25356.1|1056458_1057199_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF25357.1|1057349_1058813_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF25358.1|1058862_1059150_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF25359.1|1059294_1060122_+	ethanolamine utilization cobalamin adenosyltransferase EutT	NA	NA	NA	NA	NA
AVF25360.1|1060133_1060772_+	phosphate propanoyltransferase PduL	NA	NA	NA	NA	NA
AVF25361.1|1060790_1061474_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF25362.1|1061486_1061759_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AVF25363.1|1061751_1062297_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF25364.1|1062316_1063432_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
AVF25365.1|1063434_1063545_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25366.1|1063770_1064622_+	methyltransferase type 11	NA	NA	NA	NA	NA
AVF25367.1|1064749_1064914_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25368.1|1064961_1065123_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25369.1|1066058_1066253_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF25370.1|1066275_1066488_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25371.1|1066586_1067054_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
AVF25372.1|1067043_1067175_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25373.1|1067979_1068282_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25374.1|1068298_1068823_+	putative integral membrane protein	NA	NA	NA	NA	NA
AVF25375.1|1068892_1069306_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25376.1|1069578_1069881_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25377.1|1070265_1070703_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25378.1|1071291_1072347_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
>prophage 11
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1226365	1279898	4489122	transposase,protease,integrase	Paenibacillus_phage(30.77%)	52	1247275:1247290	1273741:1273756
AVF25547.1|1226365_1226869_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	29.8	1.1e-10
AVF25548.1|1227205_1227601_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25549.1|1229331_1231575_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVF25550.1|1231617_1232604_+	metal-dependent phosphohydrolase-like protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	25.7	1.7e-05
AVF25551.1|1233169_1234393_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF25552.1|1234576_1235773_+	ATPase, AAA family	NA	NA	NA	NA	NA
AVF25553.1|1235764_1236133_-	putative chloramphenical resistance permease RarD	NA	NA	NA	NA	NA
AVF25554.1|1236173_1236491_-	putative chloramphenical resistance permease RarD	NA	NA	NA	NA	NA
AVF25555.1|1236675_1237380_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF25556.1|1237575_1238529_+	site-specific tyrosine recombinase XerD-like protein	NA	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
AVF25557.1|1239413_1239566_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25558.1|1239948_1240275_+	aminopeptidase AmpS	NA	NA	NA	NA	NA
AVF25559.1|1240654_1241887_+	putative membrane protein	NA	NA	NA	NA	NA
AVF25560.1|1241927_1242491_-	signal peptidase I	NA	NA	NA	NA	NA
AVF25561.1|1242690_1243611_+	purine nucleosidase	NA	NA	NA	NA	NA
AVF25562.1|1243836_1246047_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.5	3.5e-11
AVF25563.1|1246532_1247447_+	proline dehydrogenase 1	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
1247275:1247290	attL	AATTTCAAATGCTTTA	NA	NA	NA	NA
AVF25564.1|1247473_1249042_+	1-pyrroline-5-carboxylate dehydrogenase RocA	NA	NA	NA	NA	NA
AVF25565.1|1249266_1250190_+	hydrolase, alpha/beta fold family	NA	NA	NA	NA	NA
AVF25566.1|1250375_1251371_+	HTH-type transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVF25567.1|1251684_1252230_+	integral membrane protein, YccS/YhfK family	NA	NA	NA	NA	NA
AVF25568.1|1252328_1252907_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF25569.1|1253059_1254493_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25570.1|1254522_1255512_-	putative glycosyltransferase YkoT	NA	B9UDL7	Salmonella_phage	40.0	2.4e-49
AVF25571.1|1255763_1256291_+|protease	CAAX amino terminal protease self- immunity	protease	NA	NA	NA	NA
AVF25572.1|1256535_1257060_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25573.1|1257056_1258115_+	luciferase family protein	NA	NA	NA	NA	NA
AVF25574.1|1258171_1259110_+	daunorubicin/doxorubicin resistance ATP-binding protein DrrA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
AVF25575.1|1259102_1259882_+	ABC transporter, efflux permease protein	NA	NA	NA	NA	NA
AVF25576.1|1260069_1261419_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	3.1e-71
AVF25577.1|1261422_1261563_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25578.1|1261849_1262377_+	putative acetyltransferase	NA	NA	NA	NA	NA
AVF25579.1|1262818_1264777_+	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
AVF25580.1|1264769_1265912_+	Dihydroorotase	NA	NA	NA	NA	NA
AVF25581.1|1265890_1266253_+	dihydroorotase	NA	NA	NA	NA	NA
AVF25582.1|1266292_1266649_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25583.1|1266652_1266991_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25584.1|1267011_1267797_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF25585.1|1267799_1268465_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF25586.1|1268506_1269613_+	pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVF25587.1|1269616_1270351_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25588.1|1271103_1271466_-|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	73.6	7.6e-33
AVF25589.1|1271480_1271627_+	hypothetical protein	NA	A0A0K2CYN9	Paenibacillus_phage	100.0	4.0e-09
AVF25590.1|1272453_1273674_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF25591.1|1274081_1274318_-	hypothetical protein	NA	NA	NA	NA	NA
1273741:1273756	attR	TAAAGCATTTGAAATT	NA	NA	NA	NA
AVF25592.1|1274807_1275404_-	putative ABC transporter permease YknZ	NA	NA	NA	NA	NA
AVF25593.1|1275446_1276337_-	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AVF25594.1|1276482_1276647_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25595.1|1276760_1276943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25596.1|1277140_1277878_+	1D-myo-inositol 2-acetamido-2-deoxy-alpha-D-glucopyranoside deacetylase	NA	NA	NA	NA	NA
AVF25597.1|1277944_1278994_-	putative lipoprotein	NA	NA	NA	NA	NA
AVF25598.1|1279214_1279898_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
>prophage 12
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1398546	1405301	4489122		Staphylococcus_phage(57.14%)	7	NA	NA
AVF25723.1|1398546_1398984_+	peptidyl-prolyl cis-trans isomerase B	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
AVF25724.1|1399907_1401041_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.6e-52
AVF25725.1|1401044_1401710_+	riboflavin synthase alpha chain RibE	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
AVF25726.1|1401744_1402977_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
AVF25727.1|1403008_1403479_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
AVF25728.1|1403908_1404691_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
AVF25729.1|1404656_1405301_+	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 13
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1529776	1640655	4489122	transposase,bacteriocin	Paenibacillus_phage(59.09%)	105	NA	NA
AVF25863.1|1529776_1531000_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF25864.1|1531133_1532135_+	putative oxidoreductase	NA	NA	NA	NA	NA
AVF25865.1|1532179_1533112_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVF25866.1|1533131_1534280_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF25867.1|1534297_1535221_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	5.1e-25
AVF25868.1|1535252_1536008_-	ABC-type transport system involved in multi-copper enzyme maturation, permease component	NA	NA	NA	NA	NA
AVF25869.1|1536620_1537013_-	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVF25870.1|1537464_1537668_-	Bifunctional aspartate aminotransferase and L-aspartate beta-decarboxylase	NA	NA	NA	NA	NA
AVF25871.1|1537664_1537901_-	Bifunctional aspartate aminotransferase and L-aspartate beta-decarboxylase	NA	NA	NA	NA	NA
AVF25872.1|1538139_1538364_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25873.1|1538360_1538891_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25874.1|1539042_1539294_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25875.1|1540725_1549122_+	glycosyltransferase family 36 protein	NA	NA	NA	NA	NA
AVF25876.1|1549351_1550059_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25877.1|1550075_1559186_+	Cell wall-associated polypeptide	NA	S5W9C6	Leptospira_phage	38.0	5.4e-10
AVF25878.1|1559198_1559789_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25879.1|1559848_1560301_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25880.1|1560303_1560666_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25881.1|1560960_1561656_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25882.1|1561669_1562071_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25883.1|1562274_1562805_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25884.1|1562801_1563332_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25885.1|1563348_1564251_+	RHS repeat-associated core domain protein	NA	S5W9C6	Leptospira_phage	40.5	2.5e-08
AVF25886.1|1564258_1564765_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25887.1|1565167_1565926_+	Cell wall-associated polypeptide	NA	NA	NA	NA	NA
AVF25888.1|1565918_1567142_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF25889.1|1567206_1568172_+	putative phage DNA-binding protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
AVF25890.1|1568242_1568869_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25891.1|1569135_1569531_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25892.1|1569625_1570084_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25893.1|1570096_1570402_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25894.1|1570642_1571866_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF25895.1|1571893_1572682_+|transposase	transposase	transposase	A0A2I7SCM7	Paenibacillus_phage	96.9	3.6e-11
AVF25896.1|1572700_1573393_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25897.1|1573432_1574476_+	Cell wall-associated polypeptide	NA	S5W9C6	Leptospira_phage	37.2	4.8e-11
AVF25898.1|1574535_1574799_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25899.1|1574767_1575298_+	CRISPR-associated protein Cas4/endonuclease Cas1 fusion	NA	NA	NA	NA	NA
AVF25900.1|1577670_1577976_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25901.1|1578326_1579550_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF25902.1|1579614_1579821_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF25903.1|1580150_1580555_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF25904.1|1580565_1581297_-	pseudouridine synthase, RluA family	NA	NA	NA	NA	NA
AVF25905.1|1581300_1582167_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVF25906.1|1582370_1583387_+	1,4-alpha-glucan-branching enzyme	NA	NA	NA	NA	NA
AVF25907.1|1583453_1584137_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF25908.1|1584307_1585027_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF25909.1|1585143_1585998_+	1,4-alpha-glucan-branching enzyme	NA	NA	NA	NA	NA
AVF25910.1|1585994_1587143_+	glucose-1-phosphate adenylyltransferase GlgC	NA	NA	NA	NA	NA
AVF25911.1|1587149_1588259_+	glycogen biosynthesis protein GlgD	NA	NA	NA	NA	NA
AVF25912.1|1588289_1589735_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AVF25913.1|1590209_1590440_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25914.1|1590639_1591095_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF25915.1|1591430_1592006_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25916.1|1592135_1592321_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25917.1|1592583_1592871_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF25918.1|1592918_1593734_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF25919.1|1593857_1595462_-	Alpha-galactosidase	NA	NA	NA	NA	NA
AVF25920.1|1595722_1596946_+	Nitric oxide dioxygenase	NA	NA	NA	NA	NA
AVF25921.1|1597281_1598523_+	arginine deiminase ArcA	NA	NA	NA	NA	NA
AVF25922.1|1598540_1599539_+	ornithine carbamoyltransferase, catabolic	NA	NA	NA	NA	NA
AVF25923.1|1599634_1601050_+	arginine/ornithine antiporter ArcD	NA	NA	NA	NA	NA
AVF25924.1|1601066_1602020_+	carbamate kinase ArcC	NA	NA	NA	NA	NA
AVF25925.1|1602058_1602745_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVF25926.1|1602800_1603298_-	cAMP-binding protein	NA	NA	NA	NA	NA
AVF25927.1|1603455_1603854_+	putative amino acid aldolase or racemase	NA	NA	NA	NA	NA
AVF25928.1|1604158_1604842_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF25929.1|1604979_1605732_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF25930.1|1605844_1606270_-	putative ribosomal protein	NA	NA	NA	NA	NA
AVF25931.1|1606398_1607262_-	copper amine oxidase-like protein	NA	NA	NA	NA	NA
AVF25932.1|1607603_1608635_-	putative membrane protein	NA	NA	NA	NA	NA
AVF25933.1|1608867_1609302_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25934.1|1609407_1609731_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25935.1|1610524_1610851_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF25936.1|1610957_1612721_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25937.1|1612717_1613257_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25938.1|1613287_1613839_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25939.1|1613828_1614497_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
AVF25940.1|1614496_1614658_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25941.1|1614760_1616380_+	HTH-type transcriptional activator Btr	NA	NA	NA	NA	NA
AVF25942.1|1616476_1617454_+	iron-uptake system-binding protein FeuA	NA	NA	NA	NA	NA
AVF25943.1|1617461_1618472_+	iron-uptake system permease protein FeuB	NA	NA	NA	NA	NA
AVF25944.1|1618464_1619493_+	iron-uptake system permease protein FeuC	NA	NA	NA	NA	NA
AVF25945.1|1619839_1621021_+	GlcNAc-binding protein A	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
AVF25946.1|1621176_1622007_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	3.4e-153
AVF25947.1|1622012_1622294_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF25948.1|1622406_1623243_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AVF25949.1|1623305_1624181_-	ferri-bacillibactin esterase BesA	NA	NA	NA	NA	NA
AVF25950.1|1624328_1625546_-	cytochrome P450	NA	NA	NA	NA	NA
AVF25951.1|1626008_1627889_+	ATP-dependent OLD family endonuclease	NA	NA	NA	NA	NA
AVF25952.1|1627975_1628296_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25953.1|1628664_1629465_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVF25954.1|1629587_1630694_+	type-1 restriction enzyme StySJI specificity protein HsdS	NA	NA	NA	NA	NA
AVF25955.1|1631035_1634011_+	putative DNA helicase	NA	NA	NA	NA	NA
AVF25956.1|1634044_1634272_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25957.1|1634288_1634468_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF25958.1|1634687_1635194_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF25959.1|1635583_1636258_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25960.1|1636399_1636525_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF25961.1|1636551_1636710_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF25962.1|1636748_1637513_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF25963.1|1637873_1638308_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25964.1|1638689_1638908_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25965.1|1638879_1639179_-	hypothetical protein	NA	NA	NA	NA	NA
AVF25966.1|1639891_1640260_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF25967.1|1640280_1640655_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.0	1.7e-64
>prophage 14
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1664921	1701830	4489122	transposase,tRNA,integrase,coat	Bacillus_virus(18.18%)	37	1664435:1664449	1701694:1701708
1664435:1664449	attL	CTTTTAAGTAACCTC	NA	NA	NA	NA
AVF25988.1|1664921_1666010_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF25989.1|1666321_1666708_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF25990.1|1666990_1667233_+	ABC transporter, ATP-binding protein	NA	NA	NA	NA	NA
AVF25991.1|1667233_1667785_+	ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	2.5e-19
AVF25992.1|1667774_1668065_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25993.1|1668504_1669467_+	putative lipoprotein	NA	NA	NA	NA	NA
AVF25994.1|1669564_1670134_+|coat	spore coat protein E	coat	NA	NA	NA	NA
AVF25995.1|1670235_1671591_+	hypothetical protein	NA	NA	NA	NA	NA
AVF25996.1|1671714_1674396_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	3.8e-28
AVF25997.1|1674426_1676475_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	3.5e-66
AVF25998.1|1676544_1677375_+	methyltransferase-like protein	NA	NA	NA	NA	NA
AVF25999.1|1677362_1678325_+|tRNA	tRNA dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVF26000.1|1678402_1678642_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVF26001.1|1678790_1681223_+	penicillin-binding protein 1F	NA	NA	NA	NA	NA
AVF26002.1|1681406_1682081_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	48.8	5.6e-21
AVF26003.1|1682131_1682518_+	carboxylesterase	NA	NA	NA	NA	NA
AVF26004.1|1682707_1683409_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AVF26005.1|1683405_1684452_+	lipoate-protein ligase LplJ	NA	NA	NA	NA	NA
AVF26006.1|1684578_1685568_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.5	3.4e-51
AVF26007.1|1685593_1686883_+	GTP-binding protein HflX	NA	NA	NA	NA	NA
AVF26008.1|1686925_1688176_+	aluminum resistance protein	NA	NA	NA	NA	NA
AVF26009.1|1688346_1688754_+	HTH-type transcriptional regulator GlnR	NA	NA	NA	NA	NA
AVF26010.1|1688790_1690122_+	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVF26011.1|1690416_1690704_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	35.6	6.9e-05
AVF26012.1|1690751_1691567_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF26013.1|1691835_1691979_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF26014.1|1691975_1692506_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF26015.1|1692976_1693351_+	toxin-like protein	NA	NA	NA	NA	NA
AVF26016.1|1693311_1694103_+	toxin-like protein	NA	NA	NA	NA	NA
AVF26017.1|1694168_1697525_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	38.0	8.2e-89
AVF26018.1|1697757_1698978_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF26019.1|1699597_1699918_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26020.1|1699962_1700289_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26021.1|1700357_1700597_-|integrase	phage integrase-like protein	integrase	A0A0S2SXP1	Bacillus_phage	71.8	5.5e-24
AVF26022.1|1700856_1701207_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26023.1|1701046_1701379_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26024.1|1701368_1701830_-|transposase	putative transposase for insertion sequence element IS3 family protein	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.7	4.2e-20
1701694:1701708	attR	CTTTTAAGTAACCTC	NA	NA	NA	NA
>prophage 15
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1838678	1885624	4489122	transposase,protease	Paenibacillus_phage(18.18%)	56	NA	NA
AVF26158.1|1838678_1838924_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.5e-11
AVF26159.1|1839638_1839863_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF26160.1|1840010_1841210_+	putative MFS-type transporter	NA	NA	NA	NA	NA
AVF26161.1|1841463_1841610_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26162.1|1841584_1841920_-	Transposase	NA	NA	NA	NA	NA
AVF26163.1|1842131_1842773_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26164.1|1843051_1845319_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	30.1	1.1e-44
AVF26165.1|1845293_1845974_+	Uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	41.8	4.7e-44
AVF26166.1|1846104_1847046_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26167.1|1847171_1847534_+	sporulation kinase E	NA	NA	NA	NA	NA
AVF26168.1|1847576_1848545_+	ROK family protein	NA	NA	NA	NA	NA
AVF26169.1|1848486_1848690_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26170.1|1848639_1848870_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26171.1|1849065_1850130_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26172.1|1850176_1851292_-|protease	thermophilic metalloprotease, M29 family	protease	NA	NA	NA	NA
AVF26173.1|1851837_1853049_+	transporter, major facilitator family protein	NA	NA	NA	NA	NA
AVF26174.1|1853144_1853864_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF26175.1|1854034_1854718_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF26176.1|1854856_1855483_-	uridine kinase Udk	NA	A0A1V0SAA3	Catovirus	40.4	8.0e-38
AVF26177.1|1855661_1855979_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26178.1|1856060_1856348_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26179.1|1856456_1857386_+	phospholipase, patatin family	NA	NA	NA	NA	NA
AVF26180.1|1857658_1858690_+	ABC transporter, substrate-binding protein, putative	NA	NA	NA	NA	NA
AVF26181.1|1858732_1859023_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26182.1|1859019_1859787_+	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF26183.1|1859798_1860581_+	ABC transporter, ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-16
AVF26184.1|1860585_1861371_+	TatD-related deoxyribonuclease	NA	NA	NA	NA	NA
AVF26185.1|1861399_1861978_+	DNA-3-methyladenine glycosylase 1	NA	NA	NA	NA	NA
AVF26186.1|1862032_1862332_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26187.1|1862471_1862633_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26188.1|1862770_1863598_-	putative D-methionine-binding lipoprotein MetQ	NA	NA	NA	NA	NA
AVF26189.1|1863666_1864326_-	D-methionine transport system permease protein MetI	NA	NA	NA	NA	NA
AVF26190.1|1864329_1865334_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.8	4.0e-31
AVF26191.1|1865339_1865507_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26192.1|1865723_1866434_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26193.1|1866440_1867415_-	FAD-dependent disulfide oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF26194.1|1867632_1868061_+	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVF26195.1|1868294_1868621_+	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	2.9e-07
AVF26196.1|1868724_1870410_+	dihydroxy-acid dehydratase IlvD	NA	NA	NA	NA	NA
AVF26197.1|1870613_1870853_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26198.1|1871126_1871363_+	redoxin-like protein	NA	NA	NA	NA	NA
AVF26199.1|1871485_1872439_+	thioredoxin reductase TrxB	NA	A0A2I2L5E1	Orpheovirus	48.1	1.6e-69
AVF26200.1|1872792_1873611_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVF26201.1|1873789_1874521_-	magnesium transporter MgtE	NA	NA	NA	NA	NA
AVF26202.1|1874671_1874815_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26203.1|1874811_1875801_-	catabolite control protein A	NA	NA	NA	NA	NA
AVF26204.1|1876037_1876850_+	putative hydrolase	NA	NA	NA	NA	NA
AVF26205.1|1877493_1877901_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26206.1|1877913_1878114_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26207.1|1878352_1878874_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26208.1|1879073_1879217_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26209.1|1879515_1880415_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF26210.1|1880458_1882075_+	putative MFS-type transporter YusP	NA	NA	NA	NA	NA
AVF26211.1|1882257_1882803_-	DNA-binding protein	NA	NA	NA	NA	NA
AVF26212.1|1882955_1884317_+	putative D-serine dehydratase DsdA	NA	NA	NA	NA	NA
AVF26213.1|1884403_1885624_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
>prophage 16
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1899513	1948380	4489122	coat,tRNA,bacteriocin,integrase,transposase	Paenibacillus_phage(33.33%)	51	1907714:1907740	1953490:1953516
AVF26224.1|1899513_1900803_-|tRNA	seryl-tRNA ligase SerS	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
AVF26225.1|1901740_1903183_+	lysine-specific permease LysP	NA	NA	NA	NA	NA
AVF26226.1|1903374_1903788_+|coat	inner spore coat-like protein	coat	NA	NA	NA	NA
AVF26227.1|1903873_1905004_+	spore germination protein (amino acid permease)	NA	NA	NA	NA	NA
AVF26228.1|1905018_1906545_+	spore germination protein KA	NA	NA	NA	NA	NA
AVF26229.1|1906547_1907699_+	Spore germination protein A3 precursor	NA	NA	NA	NA	NA
1907714:1907740	attL	CCCCTGTCAAGTAGACAGTGTAAAAAA	NA	NA	NA	NA
AVF26230.1|1907811_1908516_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	3.0e-57
AVF26231.1|1908689_1909379_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF26232.1|1909669_1910566_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF26233.1|1910725_1911931_+	efflux transporter-like protein	NA	A0A2H4PQR6	Staphylococcus_phage	45.1	3.1e-99
AVF26234.1|1912061_1912217_-	integral membrane protein	NA	NA	NA	NA	NA
AVF26235.1|1912416_1912611_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26236.1|1912611_1913364_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.9e-23
AVF26237.1|1913351_1915040_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26238.1|1915165_1915381_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF26239.1|1915804_1916239_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF26240.1|1916311_1916959_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26241.1|1917114_1917621_+	uridylate kinase-like protein	NA	NA	NA	NA	NA
AVF26242.1|1917735_1918473_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26243.1|1918758_1920048_+	Hemolysin C	NA	NA	NA	NA	NA
AVF26244.1|1920479_1921391_+	phenazine biosynthesis protein PhzF	NA	NA	NA	NA	NA
AVF26245.1|1921578_1922181_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26246.1|1922265_1922718_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF26247.1|1922848_1923535_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF26248.1|1923623_1924457_+	HAD-superfamily hydrolase	NA	NA	NA	NA	NA
AVF26249.1|1924605_1924851_+	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
AVF26250.1|1925033_1926065_-	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
AVF26251.1|1926464_1927748_+	maltose/maltodextrin-binding protein MalX	NA	NA	NA	NA	NA
AVF26252.1|1927830_1929144_+	putative arabinogalactan oligomer transport system permease protein GanP	NA	NA	NA	NA	NA
AVF26253.1|1929140_1929986_+	putative arabinogalactan oligomer transport system permease protein GanQ	NA	NA	NA	NA	NA
AVF26254.1|1930051_1930468_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26255.1|1930652_1931147_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
AVF26256.1|1931213_1932287_+	putative nitronate monooxygenase	NA	NA	NA	NA	NA
AVF26257.1|1932517_1933807_+	hydroxylamine reductase Hcp	NA	NA	NA	NA	NA
AVF26258.1|1933923_1934850_-	UDP-N-acetylenolpyruvoylglucosamine reductase MurB	NA	NA	NA	NA	NA
AVF26259.1|1935062_1935287_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26260.1|1935620_1935983_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26261.1|1936019_1937495_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AVF26262.1|1937685_1938639_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	29.9	7.4e-11
AVF26263.1|1938717_1938891_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26264.1|1939002_1939881_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF26265.1|1939938_1941372_-	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF26266.1|1941371_1942301_-	1-phosphofructokinase FruK	NA	NA	NA	NA	NA
AVF26267.1|1942471_1943254_+	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF26268.1|1943333_1943891_+	MutX-like protein	NA	NA	NA	NA	NA
AVF26269.1|1943885_1944290_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF26270.1|1944282_1944615_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF26271.1|1944620_1945160_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF26272.1|1945485_1945836_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26273.1|1946197_1946956_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF26274.1|1947687_1948380_-|integrase	putative integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	57.3	4.1e-59
1953490:1953516	attR	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
>prophage 17
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1951871	2091387	4489122	coat,integrase,portal,tail,holin,lysis,transposase	Paenibacillus_phage(79.57%)	174	1968380:1968439	2070168:2070182
AVF26278.1|1951871_1952555_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF26279.1|1952725_1953445_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF26280.1|1954255_1954396_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26281.1|1954342_1955563_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF26282.1|1956254_1956458_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.6	2.7e-27
AVF26283.1|1956474_1956918_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	56.6	1.7e-42
AVF26284.1|1957199_1958333_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	NA	NA	NA	NA
AVF26285.1|1959403_1959652_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26286.1|1959690_1959798_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26287.1|1960099_1960345_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AVF26288.1|1960846_1961428_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF26289.1|1961522_1962389_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AVF26290.1|1962425_1963070_+	polar amino acid ABC transporter, inner membrane subunit	NA	NA	NA	NA	NA
AVF26291.1|1963091_1963838_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.6	1.5e-35
AVF26292.1|1963881_1964304_+	peroxiredoxin, OsmC subfamily	NA	NA	NA	NA	NA
AVF26293.1|1964440_1964884_+	cyanate hydratase CynS	NA	NA	NA	NA	NA
AVF26294.1|1966015_1966738_+|coat	spore coat protein, CotS family	coat	NA	NA	NA	NA
AVF26295.1|1967463_1967889_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26296.1|1967917_1968112_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26297.1|1968234_1968462_+	hypothetical protein	NA	NA	NA	NA	NA
1968380:1968439	attL	GTATTTCCCCCGAGGGGGAAATCGTGTTTCTAGCGCAAGTGGTGGCCAACTCGATCCGGG	NA	NA	NA	NA
AVF26298.1|1968408_1969629_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
1968380:1968439	attL	GTATTTCCCCCGAGGGGGAAATCGTGTTTCTAGCGCAAGTGGTGGCCAACTCGATCCGGG	NA	NA	NA	NA
AVF26299.1|1969901_1970987_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26300.1|1970983_1971160_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26301.1|1971156_1971816_+	ATP-binding transport protein NatA	NA	A0A2K9L0W2	Tupanvirus	24.6	1.4e-05
AVF26302.1|1972021_1972372_-	acyl-CoA O-methyltransferase-like protein	NA	W8CYT3	Bacillus_phage	53.5	4.3e-25
AVF26303.1|1972537_1972654_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26304.1|1972744_1973119_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF26305.1|1973139_1973508_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	98.4	1.3e-64
AVF26306.1|1976507_1976651_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26307.1|1978547_1978664_+|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVF26308.1|1978635_1979643_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	47.7	7.4e-70
AVF26309.1|1979854_1982302_+	CRISPR-associated nuclease/helicase Cas3	NA	NA	NA	NA	NA
AVF26310.1|1982539_1983166_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AVF26311.1|1983230_1984454_-|integrase	integrase Int	integrase	A0A0C5AN64	Paenibacillus_phage	86.0	9.3e-200
AVF26312.1|1984479_1985178_-	LexA repressor	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	2.1e-47
AVF26313.1|1985314_1985515_+	transcriptional regulator, y4mF family	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
AVF26314.1|1985580_1985808_+	DNA binding domain, excisionase family	NA	A0A0C5AN65	Paenibacillus_phage	77.1	9.0e-24
AVF26315.1|1985833_1986247_+	phage regulatory protein, Rha family	NA	A0A0N9SSV8	Paenibacillus_phage	60.0	2.5e-24
AVF26316.1|1986226_1986535_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26317.1|1986654_1987293_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	99.1	6.5e-128
AVF26318.1|1987315_1988110_+	putative prophage antirepressor	NA	A0A0N9SJU0	Paenibacillus_phage	87.3	2.0e-126
AVF26319.1|1988106_1988283_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26320.1|1988279_1988453_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.6e-20
AVF26321.1|1988449_1988752_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
AVF26322.1|1988767_1989094_+	hypothetical protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
AVF26323.1|1989346_1989721_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	45.2	7.6e-20
AVF26324.1|1989778_1990150_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	92.7	3.4e-60
AVF26325.1|1990133_1990511_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
AVF26326.1|1990529_1990796_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
AVF26327.1|1990803_1991574_+	putative DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
AVF26328.1|1991570_1992947_+	replicative DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
AVF26329.1|1992959_1993910_+	DNA primase	NA	A0A0N9S7Y2	Paenibacillus_phage	82.9	1.5e-152
AVF26330.1|1993969_1994548_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
AVF26331.1|1994613_1995141_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	8.4e-81
AVF26332.1|1995225_1995948_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
AVF26333.1|1996123_1996465_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
AVF26334.1|1996461_1996581_+	hypothetical protein	NA	A0A0N7GFF1	Paenibacillus_phage	74.4	1.8e-07
AVF26335.1|1996609_1997023_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
AVF26336.1|1997010_1997220_+	hypothetical protein	NA	A0A0N9SJW4	Paenibacillus_phage	95.7	2.8e-32
AVF26337.1|1997234_1997831_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	67.8	1.3e-61
AVF26338.1|1997906_1999628_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.2	9.1e-310
AVF26339.1|1999629_1999947_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	61.7	7.3e-32
AVF26340.1|1999940_2001068_+	DNA-directed DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
AVF26341.1|2001068_2001266_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
AVF26342.1|2001262_2001877_+	DNA polymerase III PolC-like protein	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
AVF26343.1|2001909_2002881_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.4e-136
AVF26344.1|2002906_2003389_+	crossover junction endodeoxyribonuclease	NA	A0A0N9ST03	Paenibacillus_phage	85.5	6.1e-30
AVF26345.1|2003385_2003568_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26346.1|2003635_2005852_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.6	3.1e-278
AVF26347.1|2005865_2006897_+	ribonucleoside-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
AVF26348.1|2006908_2007436_+	deoxyuridine 5'-triphosphate nucleotidohydrolase Dut	NA	D2XR49	Bacillus_phage	54.3	1.9e-40
AVF26349.1|2007428_2007725_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26350.1|2007721_2008060_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26351.1|2008060_2008387_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26352.1|2008400_2008520_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	94.9	1.6e-16
AVF26353.1|2008528_2008729_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
AVF26354.1|2008725_2008956_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26355.1|2008957_2009275_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
AVF26356.1|2009268_2009739_+	putative prophage protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
AVF26357.1|2009735_2010104_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26358.1|2010147_2011227_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
AVF26359.1|2011210_2011771_+	deoxynucleoside monophosphate kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	85.8	1.6e-85
AVF26360.1|2011727_2012111_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	77.2	4.7e-57
AVF26361.1|2012189_2012597_+	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.1	2.0e-58
AVF26362.1|2012586_2013039_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
AVF26363.1|2013425_2013521_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26364.1|2013530_2013761_+	hypothetical protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	34.7	2.2e-06
AVF26365.1|2013960_2014206_+	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	97.8	4.5e-13
AVF26366.1|2014189_2015029_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.8	2.6e-153
AVF26367.1|2015371_2015566_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
AVF26368.1|2015587_2016007_+	putative phage-associated protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
AVF26369.1|2015996_2016395_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
AVF26370.1|2017050_2017263_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26371.1|2017584_2017761_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
AVF26372.1|2017757_2017913_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26373.1|2018026_2018326_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26374.1|2018457_2020224_+	phage protein	NA	A0A0N9RZA7	Paenibacillus_phage	97.7	0.0e+00
AVF26375.1|2020376_2021732_+|portal	phage portal protein, SPP1 family	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	1.4e-241
AVF26376.1|2021728_2022589_+	putative phage protein	NA	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
AVF26377.1|2022680_2023316_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	74.4	3.0e-61
AVF26378.1|2023371_2024307_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
AVF26379.1|2024321_2024705_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
AVF26380.1|2024705_2025038_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.4	1.7e-55
AVF26381.1|2025034_2025460_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	92.2	3.5e-69
AVF26382.1|2025456_2025831_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	94.4	4.7e-62
AVF26383.1|2025843_2026392_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
AVF26384.1|2026442_2026820_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.0	5.1e-56
AVF26385.1|2027005_2027170_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	74.1	7.9e-14
AVF26386.1|2027197_2030092_+|tail	putative phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	56.2	5.2e-249
AVF26387.1|2030091_2031549_+|tail	phage tail component	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
AVF26388.1|2031551_2033873_+	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
AVF26389.1|2033869_2034307_+	phage-related protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	1.1e-67
AVF26390.1|2034294_2034711_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
AVF26391.1|2034703_2035573_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
AVF26392.1|2035860_2036154_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26393.1|2036292_2036505_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26394.1|2036507_2036891_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26395.1|2037578_2038220_-	hypothetical protein	NA	A0A142F168	Bacillus_phage	46.7	1.4e-16
AVF26396.1|2038605_2038974_-	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	83.2	2.6e-52
AVF26397.1|2038976_2039327_-	phage protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
AVF26398.1|2039371_2039797_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26399.1|2039961_2040588_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
AVF26400.1|2040660_2041047_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	94.5	3.4e-63
AVF26401.1|2041442_2043347_+	CRISPR-associated protein Cas8c/Csd1, subtype I-C/DVULG	NA	NA	NA	NA	NA
AVF26402.1|2043361_2044222_+	CRISPR-associated protein Cas7/Csd2, subtype I-C/DVULG	NA	NA	NA	NA	NA
AVF26403.1|2044211_2044871_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AVF26404.1|2044867_2045899_+	CRISPR-associated protein Cas4/endonuclease Cas1 fusion	NA	NA	NA	NA	NA
AVF26405.1|2045971_2046199_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AVF26406.1|2047569_2047728_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF26407.1|2048862_2049009_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26408.1|2049026_2050079_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26409.1|2050260_2050788_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26410.1|2051354_2051582_+|transposase	transposase-like protein	transposase	A0A0C5AEA5	Paenibacillus_phage	50.0	1.8e-08
AVF26411.1|2051645_2052866_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF26412.1|2053005_2054493_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
2052836:2054158	attR	CCCGGATCGAGTTGGCCACCACTTGCGCTAGAAACACGATTTCCCCCTCGGGGGAAATACAGACTGTCGACAAAGTCCTGTCGACAGTCTTTTTTACGAAAATACACCAACCATTCACCGCATTCATATAGTATCATATAGGTAAATAACTAGTGCGGGAGTGCTTGAATATGTTGCGAAAAACCGGTTACGAAGGACGTTCTCAAATTTCCATGGTCTCCTTGGACGAGCTTGTACCTATAGATCATTTGGTCCGCAAAATCGAATACGCCATCGATTTTAGTTTCATCTATGACTTGGTTCGGGATGTTTACTGTGAGGATAACGGCCGCCCTAGCATTGATCCGGTTGTTCTTATTAAAATTGCGCTTATTCAATGCCTTTTTGGTATTCGCTCCATGCGTCAGACCATCAAAGAGATTGAAACCAACGTCGCGTACCGTTGGTTTATTGGCTATGACTTCAGTCAGCCCATTCCTCATTTCTCCACGCTGGGTAAAAATTATGTGCGCCGTTTTCGGGATACTGGACTGTTTGAGGGAATCTTTCATCGCATCCTCGAAGAAGCTGCCCGGCATGGTTTCATTGAACCTGACGTACTCTTCATCGACGCGACACATGTTAAAGCAAGCGCGAACAAAAACAAATATGTAAAACAGATCGTTCAGGAGCAAAGTCGAAAGTACCAGGATCAGCTTGATGAAGAGATCAATCAAGATCGGGCTCTACATGGAAAGAAACCGTTCGAAAAAAAGCCCAATGTCACGCAGAAGGAGGTGAAGGTGAGCACGACTGACCCGGAGTGTGGTTTGTTCGTGAAGGGAGAGAAAGAACGTGTTTTCGCCTACAGCTTCCATACCGCGTGTGATCGGAACGGGTTTGTACTCGGCGTCAAAGTAACCCCTGGAAATATCCACGACAGCCAAGTATTTGAAGATGTTCTACACGAGGTTACTCGCGTAGTTCCGGCTCCACAAGCGGTTGCCGCGGATGCAGGTTATAAAACACCAGCCATCTGCAAAATGCTGCAAGAACAAGAGATTCGTCCCGTCCTGCCGTATACCCGTCCCAAGACGAAAGAAGAATTCTTTAAAAAGCATGATTACGTTTACGATGAGCACTACGACTGCTACCTGTGTCCGGCAAATGCCATACTGTCTTACGAAACAACGAACCGTGCTGGTTATAAAATGTATCGCTCGAATCCGGCAATCTGCCAAGCCTGTCCTTTCCGGACACAATGTACAGAGAGTAAAGAGGCAGTGAAGCGTATTAGTCGTCATGTTTGGGCTGAATGTGTGGAAGAGGCGGACCACCTTCGCC	NA	NA	NA	NA
AVF26413.1|2054857_2055460_-|transposase	transposase	transposase	NA	NA	NA	NA
2052836:2054158	attR	CCCGGATCGAGTTGGCCACCACTTGCGCTAGAAACACGATTTCCCCCTCGGGGGAAATACAGACTGTCGACAAAGTCCTGTCGACAGTCTTTTTTACGAAAATACACCAACCATTCACCGCATTCATATAGTATCATATAGGTAAATAACTAGTGCGGGAGTGCTTGAATATGTTGCGAAAAACCGGTTACGAAGGACGTTCTCAAATTTCCATGGTCTCCTTGGACGAGCTTGTACCTATAGATCATTTGGTCCGCAAAATCGAATACGCCATCGATTTTAGTTTCATCTATGACTTGGTTCGGGATGTTTACTGTGAGGATAACGGCCGCCCTAGCATTGATCCGGTTGTTCTTATTAAAATTGCGCTTATTCAATGCCTTTTTGGTATTCGCTCCATGCGTCAGACCATCAAAGAGATTGAAACCAACGTCGCGTACCGTTGGTTTATTGGCTATGACTTCAGTCAGCCCATTCCTCATTTCTCCACGCTGGGTAAAAATTATGTGCGCCGTTTTCGGGATACTGGACTGTTTGAGGGAATCTTTCATCGCATCCTCGAAGAAGCTGCCCGGCATGGTTTCATTGAACCTGACGTACTCTTCATCGACGCGACACATGTTAAAGCAAGCGCGAACAAAAACAAATATGTAAAACAGATCGTTCAGGAGCAAAGTCGAAAGTACCAGGATCAGCTTGATGAAGAGATCAATCAAGATCGGGCTCTACATGGAAAGAAACCGTTCGAAAAAAAGCCCAATGTCACGCAGAAGGAGGTGAAGGTGAGCACGACTGACCCGGAGTGTGGTTTGTTCGTGAAGGGAGAGAAAGAACGTGTTTTCGCCTACAGCTTCCATACCGCGTGTGATCGGAACGGGTTTGTACTCGGCGTCAAAGTAACCCCTGGAAATATCCACGACAGCCAAGTATTTGAAGATGTTCTACACGAGGTTACTCGCGTAGTTCCGGCTCCACAAGCGGTTGCCGCGGATGCAGGTTATAAAACACCAGCCATCTGCAAAATGCTGCAAGAACAAGAGATTCGTCCCGTCCTGCCGTATACCCGTCCCAAGACGAAAGAAGAATTCTTTAAAAAGCATGATTACGTTTACGATGAGCACTACGACTGCTACCTGTGTCCGGCAAATGCCATACTGTCTTACGAAACAACGAACCGTGCTGGTTATAAAATGTATCGCTCGAATCCGGCAATCTGCCAAGCCTGTCCTTTCCGGACACAATGTACAGAGAGTAAAGAGGCAGTGAAGCGTATTAGTCGTCATGTTTGGGCTGAATGTGTGGAAGAGGCGGACCACCTTCGCC	NA	NA	NA	NA
AVF26414.1|2055640_2055742_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26415.1|2055940_2056450_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26416.1|2056467_2057025_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26417.1|2057322_2057841_+|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF26418.1|2057837_2058119_+	pyridoxamine 5'-phosphate oxidase, FMN-binding family	NA	NA	NA	NA	NA
AVF26419.1|2058938_2059439_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF26420.1|2059428_2059995_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	34.1	1.0e-15
AVF26421.1|2061393_2062020_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF26422.1|2062432_2062789_-	group I intron endonuclease	NA	NA	NA	NA	NA
AVF26423.1|2062809_2063568_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26424.1|2065833_2068782_+	formate dehydrogenase, alpha subunit	NA	NA	NA	NA	NA
AVF26425.1|2068784_2069276_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26426.1|2069292_2070087_+	FdhD-like protein	NA	NA	NA	NA	NA
AVF26427.1|2070400_2071354_+	iron-siderophore ABC transporter-like protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
AVF26428.1|2071343_2072297_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVF26429.1|2072290_2073049_+	iron-siderophore ABC transporter-like protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
AVF26430.1|2073140_2074094_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVF26431.1|2074095_2074209_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26432.1|2074603_2074861_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26433.1|2074882_2076031_+	6-phosphogluconolactonase-like protein	NA	NA	NA	NA	NA
AVF26434.1|2076587_2076902_+	MIP18 family protein YitW	NA	NA	NA	NA	NA
AVF26435.1|2077060_2077510_+	Cysteine dioxygenase	NA	NA	NA	NA	NA
AVF26436.1|2077697_2078459_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF26437.1|2078511_2078667_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26438.1|2078684_2079350_+	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
AVF26439.1|2079495_2079909_+	penicillinase repressor	NA	NA	NA	NA	NA
AVF26440.1|2079911_2080757_+	peptidase, M56 family	NA	NA	NA	NA	NA
AVF26441.1|2080844_2081561_+	disulfide bond formation protein D	NA	NA	NA	NA	NA
AVF26442.1|2081569_2082004_+	thiol-disulfide oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF26443.1|2082046_2082769_-	oxidoreductase, short chain dehydrogenase/reductase family protein	NA	A0A0M4JSW6	Mollivirus	25.9	5.8e-08
AVF26444.1|2083153_2083609_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF26445.1|2083790_2084624_+	putative permease	NA	NA	NA	NA	NA
AVF26446.1|2084620_2085016_+	putative membrane protein	NA	NA	NA	NA	NA
AVF26447.1|2085197_2087129_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AVF26448.1|2087204_2088713_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AVF26449.1|2088699_2089878_+	aminoacyltransferase FemX	NA	NA	NA	NA	NA
AVF26450.1|2090302_2090812_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26451.1|2090829_2091387_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2318178	2419173	4489122	transposase,protease,bacteriocin	Paenibacillus_phage(46.67%)	95	NA	NA
AVF26588.1|2318178_2318643_-|protease	putative serine protease HtrA	protease	W5SAB9	Pithovirus	41.1	3.4e-09
AVF26589.1|2318960_2320145_+	Purine efflux pump PbuE	NA	NA	NA	NA	NA
AVF26590.1|2320167_2320926_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF26591.1|2321104_2321836_+	exodeoxyribonuclease III (xth)	NA	NA	NA	NA	NA
AVF26592.1|2321873_2323331_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF26593.1|2323415_2323979_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26594.1|2324103_2325000_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF26595.1|2325783_2325987_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26596.1|2325983_2326352_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26597.1|2326542_2327277_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF26598.1|2327332_2328118_-	N-acetylmuramic acid deacetylase-like protein	NA	NA	NA	NA	NA
AVF26599.1|2328231_2329749_-	membrane protein	NA	NA	NA	NA	NA
AVF26600.1|2329828_2330947_-	two-component response regulator	NA	NA	NA	NA	NA
AVF26601.1|2331421_2331694_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
AVF26602.1|2331714_2332134_-	ribonuclease	NA	NA	NA	NA	NA
AVF26603.1|2332656_2334087_-	hydrolase-like protein	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
AVF26604.1|2334161_2335361_-	NAD(FAD)-dependent dehydrogenase	NA	NA	NA	NA	NA
AVF26605.1|2335843_2336074_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26606.1|2336337_2337396_+	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF26607.1|2337510_2338527_+	glucose-1-phosphate thymidylyltransferase StrD	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
AVF26608.1|2339140_2339326_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF26609.1|2339470_2339716_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26610.1|2339786_2340560_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AVF26611.1|2341177_2341336_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26612.1|2341810_2344234_-	Acyl-homoserine lactone acylase QuiP precursor	NA	NA	NA	NA	NA
AVF26613.1|2344730_2345522_-	transcriptional regulator, RpiR family	NA	NA	NA	NA	NA
AVF26614.1|2345557_2346238_-	putative N-acetylmannosamine-6-phosphate 2-epimerase NanE	NA	NA	NA	NA	NA
AVF26615.1|2346242_2347775_-	PTS system glucose-specific EIICBA component PtsG	NA	NA	NA	NA	NA
AVF26616.1|2348148_2349267_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF26617.1|2349443_2350271_+	metallophosphoesterase-like protein	NA	NA	NA	NA	NA
AVF26618.1|2350717_2352280_-	gluconokinase GntK	NA	NA	NA	NA	NA
AVF26619.1|2352314_2353676_-	gluconate permease GnuT	NA	NA	NA	NA	NA
AVF26620.1|2353786_2354464_-	gluconate operon transcriptional repressor	NA	NA	NA	NA	NA
AVF26621.1|2354577_2355252_-	6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	38.3	3.5e-47
AVF26622.1|2355286_2355460_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26623.1|2355639_2355957_-	hypothetical protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
AVF26624.1|2356545_2356857_-	hypothetical protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
AVF26625.1|2357052_2357157_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26626.1|2357306_2357816_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26627.1|2357833_2358391_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26628.1|2359671_2360061_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26629.1|2360549_2363105_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
AVF26630.1|2363130_2363400_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	2.5e-41
AVF26631.1|2364070_2366704_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	47.7	3.1e-232
AVF26632.1|2368253_2369195_+	transcriptional regulator LytR-like protein	NA	NA	NA	NA	NA
AVF26633.1|2370002_2370224_-	putative transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.1e-13
AVF26634.1|2370679_2370871_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	3.4e-24
AVF26635.1|2370867_2371140_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
AVF26636.1|2371143_2371356_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
AVF26637.1|2371707_2372256_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
AVF26638.1|2372507_2373227_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF26639.1|2373397_2374081_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF26640.1|2374338_2374548_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26641.1|2374751_2375435_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF26642.1|2375605_2376325_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF26643.1|2376614_2376902_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF26644.1|2376949_2377765_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF26645.1|2377721_2378228_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	80.6	5.4e-77
AVF26646.1|2378190_2378463_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
AVF26647.1|2378490_2378667_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26648.1|2378666_2380121_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF26649.1|2380263_2381856_-	SagB-type dehydrogenase domain protein	NA	NA	NA	NA	NA
AVF26650.1|2381880_2383818_-|bacteriocin	bacteriocin biosynthesis docking scaffold, SagD family	bacteriocin	NA	NA	NA	NA
AVF26651.1|2385825_2386095_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26652.1|2386477_2386579_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26653.1|2386859_2387636_+	hydrolase-like protein	NA	NA	NA	NA	NA
AVF26654.1|2387992_2389942_-	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF26655.1|2389928_2390699_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
AVF26656.1|2391080_2391644_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26657.1|2392007_2392334_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26658.1|2392471_2392678_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26659.1|2393239_2393788_+	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVF26660.1|2394003_2395119_+	oxalate decarboxylase OxdD	NA	NA	NA	NA	NA
AVF26661.1|2395257_2395686_-	cell wall hydrolase CwlJ	NA	NA	NA	NA	NA
AVF26662.1|2395852_2396242_-	Putative oxidoreductase CatD	NA	NA	NA	NA	NA
AVF26663.1|2396841_2397219_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	31.2	1.7e-06
AVF26664.1|2398352_2398859_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26665.1|2398995_2399532_-	alkaline phosphatase synthesis transcriptional regulatory protein PhoP	NA	NA	NA	NA	NA
AVF26666.1|2400003_2401413_+	putative multidrug resistance protein YoeA	NA	NA	NA	NA	NA
AVF26667.1|2401505_2402393_-	putative membrane protein	NA	NA	NA	NA	NA
AVF26668.1|2402598_2402937_-	D-proline reductase proprotein PrdA	NA	NA	NA	NA	NA
AVF26669.1|2402937_2403060_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26670.1|2403536_2404367_+	acid phosphatase	NA	NA	NA	NA	NA
AVF26671.1|2405154_2406522_-	putative integral membrane protein	NA	NA	NA	NA	NA
AVF26672.1|2406717_2407767_+	putative ABC transporter ATP-binding protein YvrO	NA	G9BWD6	Planktothrix_phage	40.0	1.2e-30
AVF26673.1|2407760_2408078_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26674.1|2408097_2408898_+	putative ABC transporter permease YknZ	NA	NA	NA	NA	NA
AVF26675.1|2409485_2409944_-	short-chain flavodoxin-like protein	NA	A7KUZ7	Bacillus_phage	31.6	6.5e-13
AVF26676.1|2410163_2411498_-	magnesium transporter mgtE	NA	NA	NA	NA	NA
AVF26677.1|2411605_2414254_-	magnesium-transporting ATPase, P-type 1	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	5.2e-38
AVF26678.1|2414542_2414818_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26679.1|2415531_2415960_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26680.1|2416054_2417296_-	lipase Lip	NA	NA	NA	NA	NA
AVF26681.1|2417599_2418352_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	2.6e-136
AVF26682.1|2418489_2419173_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
>prophage 19
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2532588	2540728	4489122	transposase	Paenibacillus_phage(66.67%)	8	NA	NA
AVF26781.1|2532588_2532777_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	93.0	3.7e-23
AVF26782.1|2532766_2532964_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	66.2	1.9e-17
AVF26783.1|2533105_2533438_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26784.1|2533434_2533611_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.7	8.5e-22
AVF26785.1|2533829_2535071_-	putative lethal factor domain protein	NA	A0A1V0E017	Clostridioides_phage	25.6	1.4e-06
AVF26786.1|2535401_2538473_-	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	35.0	1.4e-95
AVF26787.1|2538543_2539407_-	toxin-like protein	NA	NA	NA	NA	NA
AVF26788.1|2539555_2540728_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.2	1.8e-216
>prophage 20
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2642346	2734993	4489122	transposase,protease,integrase,tRNA	Paenibacillus_phage(28.57%)	102	2685294:2685353	2715487:2716658
AVF26887.1|2642346_2643741_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
AVF26888.1|2643910_2644453_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AVF26889.1|2644631_2645960_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil-5-)- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVF26890.1|2645972_2648063_-	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
AVF26891.1|2648210_2649320_-	DNA processing Smf single strand binding protein-like protein	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
AVF26892.1|2649423_2650359_-	succinyl-CoA ligase [ADP-forming] subunit alpha	NA	NA	NA	NA	NA
AVF26893.1|2650415_2651576_-	succinyl-CoA ligase [ADP-forming] subunit beta	NA	NA	NA	NA	NA
AVF26894.1|2651758_2651848_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26895.1|2651964_2652225_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26896.1|2652256_2652652_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26897.1|2652866_2654390_+	Mg chelatase-like protein	NA	NA	NA	NA	NA
AVF26898.1|2654487_2654892_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26899.1|2654901_2655234_-	flagellar biosynthesis-like protein	NA	NA	NA	NA	NA
AVF26900.1|2655230_2657042_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF26901.1|2657096_2657780_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
AVF26902.1|2658072_2658954_-	ribosome biogenesis GTPase A	NA	NA	NA	NA	NA
AVF26903.1|2659062_2659647_-	signal peptidase I	NA	NA	NA	NA	NA
AVF26904.1|2659758_2660100_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVF26905.1|2660242_2660995_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVF26906.1|2660991_2661513_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVF26907.1|2661738_2661969_-	RNA binding-like protein	NA	NA	NA	NA	NA
AVF26908.1|2661991_2662264_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVF26909.1|2662305_2663673_-	signal recognition particle protein Ffh	NA	NA	NA	NA	NA
AVF26910.1|2663702_2664065_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF26911.1|2664198_2665206_-	cell division protein, FtsY-like protein	NA	NA	NA	NA	NA
AVF26912.1|2665290_2668869_-	chromosome partition protein SMC	NA	NA	NA	NA	NA
AVF26913.1|2669037_2669739_-	ribonuclease 3	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
AVF26914.1|2669918_2671154_-	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVF26915.1|2671243_2671477_-	acyl carrier protein AcpP	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
AVF26916.1|2671595_2672336_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
AVF26917.1|2672435_2673371_-	malonyl CoA-acyl carrier protein transacylase FabD	NA	NA	NA	NA	NA
AVF26918.1|2673402_2674389_-	3-oxoacyl-[acyl-carrier-protein] synthase 3	NA	NA	NA	NA	NA
AVF26919.1|2674399_2675386_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AVF26920.1|2675387_2675978_-	transcription factor FapR	NA	NA	NA	NA	NA
AVF26921.1|2676153_2676327_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVF26922.1|2676445_2676958_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26923.1|2677045_2678164_-	peptidase Do	NA	NA	NA	NA	NA
AVF26924.1|2678303_2679653_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVF26925.1|2679663_2680173_-	phosphopantetheine adenylyltransferase CoaD	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
AVF26926.1|2680190_2680748_-	putative rRNA methyltransferase YlbH	NA	NA	NA	NA	NA
AVF26927.1|2681297_2681495_-	Helix-turn-helix domain protein	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
AVF26928.1|2681559_2681973_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
AVF26929.1|2682120_2682510_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26930.1|2682795_2683071_-	amidinotransferase family protein	NA	NA	NA	NA	NA
AVF26931.1|2683609_2684941_-	GlcNAc-binding protein A	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
2685294:2685353	attL	CTATATAAGTTGAATCAATATTCTTAGCAAACCTTGGCAAGGAAAAAGGAACCATTTGTC	NA	NA	NA	NA
AVF26932.1|2685348_2685906_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF26933.1|2685923_2686433_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF26934.1|2686497_2686740_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
AVF26935.1|2686749_2687421_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	96.0	1.4e-128
AVF26936.1|2687417_2687657_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
AVF26937.1|2687684_2687813_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26938.1|2688069_2688381_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF26939.1|2688419_2689286_+|transposase	putative transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.7	4.7e-12
AVF26940.1|2690628_2690979_-	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
AVF26941.1|2691028_2692252_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF26942.1|2692632_2692923_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	6.5e-35
AVF26943.1|2693062_2693578_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26944.1|2694349_2694460_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26945.1|2694459_2694684_-	helix-turn-helix protein	NA	NA	NA	NA	NA
AVF26946.1|2694830_2695541_+	LexA repressor-like protein	NA	R9VW28	Paenibacillus_phage	39.8	1.3e-41
AVF26947.1|2695560_2696118_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.0e-28
AVF26948.1|2697362_2697566_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26949.1|2697802_2698543_-	FMN reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVF26950.1|2698693_2699965_-	NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AVF26951.1|2700099_2701437_-	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF26952.1|2701841_2702159_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF26953.1|2702160_2702364_-	putative ABC transporter ATP-binding protein YdiF	NA	NA	NA	NA	NA
AVF26954.1|2702360_2702522_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26955.1|2702590_2702929_-	YolD-like protein	NA	NA	NA	NA	NA
AVF26956.1|2702925_2704173_-	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF26957.1|2704727_2705783_-	arsenite resistance protein ArsB	NA	NA	NA	NA	NA
AVF26958.1|2705811_2706159_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF26959.1|2706821_2707184_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF26960.1|2707393_2709526_+	putative cadmium-transporting ATPase CadA	NA	E4ZFI9	Streptococcus_phage	44.6	1.0e-164
AVF26961.1|2709751_2709988_+	alkaline phosphatase synthesis sensor protein PhoR	NA	W8CYF6	Bacillus_phage	37.7	3.0e-06
AVF26962.1|2710066_2711173_+	acidobacterial duplicated orphan permease	NA	NA	NA	NA	NA
AVF26963.1|2711172_2711856_+	putative ABC transporter ATP-binding protein YvrO	NA	G9BWD6	Planktothrix_phage	39.0	2.4e-35
AVF26964.1|2712103_2712337_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26965.1|2712252_2712540_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26966.1|2712560_2712848_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF26967.1|2712895_2713711_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF26968.1|2713735_2713924_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26969.1|2714222_2714384_+	hypothetical protein	NA	NA	NA	NA	NA
AVF26970.1|2714406_2714916_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26971.1|2714933_2715491_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF26972.1|2715589_2716216_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AVF26973.1|2716463_2717099_-	NAD-dependent epimerase/dehydratase	NA	NA	NA	NA	NA
2715487:2716658	attR	GACAAATGGTTCCTTTTTCCTTGCCAAGGTTTGCTAAGAATATTGATTCAACTTATATAGACGCAATGTTCAAAACAAATTATTGTTAAATAATAGAGGAGGATTGTGTTATGAACTCAACTCCTTACTATATTACTTTTTATGCGACAGTGGATTTGATGTTTATCGGGTAGCTGGAACTGTTTATGATTTAAAAGGGGATAAATGGAAACCGGATGATGGTCATGTTATTATCATCTTACAATACCGAAATCAAACATATATAGTAGATGGCGGCTTTGCGTCACATCTTCCTTTGTATCCCGTTCCATTTAATGGAGAAGTGATATCTTCTCAAACAGGAAAGTATCGTATTCGCAAACAGGATACTGAAAAAGGAACTTACGTGTTAGAAATGCGAAAAGGGGAAAATGGAGAAACAGCACAATTTCTTGGTTCTGAGCCTACAGATATGTGGCGTACTGGATATGCCTTTACTTTAGATGAAATAGATACAAAAAAAGTAAATGAAATACAAGATATCATTGTTAAGCACCCAGAATCCCCCTTTAATAAAGGACATATTGTTTGTAAACTTATTGAAAATGGACATGTTTCACTTACAAAAAGAACCTTTACAGAAACAAAAAAAGGACAAAAAATAAAAAAGAAAATAACCGAAAAAGAATACCATCAAATTCTTAAAGATGTATTTAATATCGCAAACGAGGCTTTTGCGTCAAGTTTATAAAGTTCGTTTAATACGTGTTTCCCATAAAAACCACGCAAGCCAAAGTGATATGCTCCCCTTCAGGAATAGATGTTGATTATTTCATCTGTCTACATAAAGGGAAGCATATCAAAACCCGCGGGTTCATTCAATTACTTGAAATGAAATAAGTAGAGGAAAGTTAAAAGGGCCTTGAGGTATTTCCTCAAAGGCTCTTCTTTCTGTGTATATCTTTTGAATTCCCCTACAAAAGGTTTTGCTTTATTTATTAGGATTCAGATACCACCGTATAGCGCTCGTTAAGATGCTGGGGATTTTCAATTTCATCCAGTACTGCGATGGCATAGTCCTCCATGCTTACAAAACTTTCACCTTTCGAATTAACAAGCAGTTGGTCCTTTCCAAGCTTGTAGGCCCCGGTCCGTTTGCCCGGTGCAAATAAAGCTGATGGACTTAGGAAGGT	NA	NA	NA	NA
AVF26974.1|2717383_2718703_-	Magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVF26975.1|2719425_2719713_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26976.1|2719897_2720488_+	DNA alkylation repair enzyme	NA	NA	NA	NA	NA
AVF26977.1|2720619_2722668_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AVF26978.1|2722664_2723525_-	EDD domain protein, DegV family	NA	A0A0N9SI50	Staphylococcus_phage	37.4	1.2e-15
AVF26979.1|2723566_2725327_-	dihydroxyacetone-like protein/glyceraldehyde kinase-like protein	NA	NA	NA	NA	NA
AVF26980.1|2725345_2725705_-	hypothetical protein	NA	NA	NA	NA	NA
AVF26981.1|2725996_2726185_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVF26982.1|2726993_2727656_-	ribulose-phosphate 3-epimerase Rpe	NA	NA	NA	NA	NA
AVF26983.1|2727658_2728558_-	putative ribosome biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AVF26984.1|2728557_2730627_-	serine/threonine-protein kinase PrkC	NA	A0A0H4Y184	Salmon_gill_poxvirus	31.9	4.0e-25
AVF26985.1|2730633_2731353_-	protein phosphatase PrpC	NA	NA	NA	NA	NA
AVF26986.1|2731411_2732455_-	ribosomal RNA large subunit methyltransferase N	NA	NA	NA	NA	NA
AVF26987.1|2732572_2733958_-	ribosomal RNA small subunit methyltransferase B	NA	NA	NA	NA	NA
AVF26988.1|2734054_2734993_-|tRNA	methionyl-tRNA formyltransferase Fmt	tRNA	E3SNR5	Prochlorococcus_phage	37.1	1.9e-14
>prophage 21
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2806255	2826307	4489122	tail,capsid,portal,terminase	Brevibacillus_phage(55.56%)	31	NA	NA
AVF27058.1|2806255_2806498_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	96.2	7.3e-32
AVF27059.1|2806512_2806791_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	91.4	3.9e-45
AVF27060.1|2806787_2807465_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	96.4	3.3e-130
AVF27061.1|2807461_2807698_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
AVF27062.1|2807853_2808012_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	60.9	4.3e-09
AVF27063.1|2808011_2808302_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
AVF27064.1|2808313_2808904_-	phage structural protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
AVF27065.1|2808907_2809186_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27066.1|2809182_2809764_-	putative phage protein	NA	S5MA71	Brevibacillus_phage	45.4	1.5e-35
AVF27067.1|2809756_2810833_-|capsid	phage capsid assembly-like protein	capsid	A0A0K2CP27	Brevibacillus_phage	53.3	1.2e-102
AVF27068.1|2810825_2811236_-	phage protein	NA	A0A0A7RTU4	Clostridium_phage	50.0	1.2e-29
AVF27069.1|2811238_2811481_-	hypothetical protein	NA	S6C459	Thermus_phage	47.6	3.1e-14
AVF27070.1|2811480_2812464_-	putative phage cell wall hydrolase	NA	S5MA66	Brevibacillus_phage	55.9	2.6e-104
AVF27071.1|2812468_2813107_-	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	49.5	2.2e-51
AVF27072.1|2813103_2815221_-|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	42.3	1.2e-141
AVF27073.1|2815274_2815445_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27074.1|2815444_2815870_-	phage protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
AVF27075.1|2815896_2816361_-	putative phage protein	NA	A0A0K2CNG3	Brevibacillus_phage	62.7	7.2e-52
AVF27076.1|2817383_2817692_-	phage protein	NA	A0A0A7RTT5	Clostridium_phage	56.0	6.9e-27
AVF27077.1|2817696_2817864_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27078.1|2817856_2818267_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.2	2.3e-25
AVF27079.1|2818674_2819034_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	56.4	1.4e-31
AVF27080.1|2819035_2819428_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	60.5	1.4e-32
AVF27081.1|2819432_2819690_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27082.1|2819701_2820745_-|capsid	putative major capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.0	1.1e-172
AVF27083.1|2820760_2821117_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.3	1.0e-42
AVF27084.1|2821132_2821756_-	Phage minor structural protein GP20	NA	A0A0K2CP96	Brevibacillus_phage	68.9	2.4e-71
AVF27085.1|2821799_2822819_-	NAD(+)--arginine ADP-ribosyltransferase EFV	NA	S5MTV5	Brevibacillus_phage	53.8	2.6e-102
AVF27086.1|2822815_2824288_-|portal	phage portal protein, SPP1 family	portal	A0A0K2CNK4	Brevibacillus_phage	62.0	3.5e-169
AVF27087.1|2824302_2825574_-|terminase	phage-related terminase-like protein large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.0	1.3e-164
AVF27088.1|2825566_2826307_-|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	48.4	2.1e-45
>prophage 22
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2829317	2845582	4489122	integrase	Paenibacillus_phage(75.0%)	36	2842279:2842292	2851407:2851420
AVF27095.1|2829317_2829530_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	87.0	7.8e-30
AVF27096.1|2829590_2829941_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	6.2e-56
AVF27097.1|2829961_2830198_-	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	70.1	1.5e-18
AVF27098.1|2830353_2830557_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	86.6	1.9e-25
AVF27099.1|2830690_2831155_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AC66	Paenibacillus_phage	73.0	7.7e-54
AVF27100.1|2831296_2831629_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27101.1|2831621_2832029_-	YopX protein	NA	A8ASP1	Listeria_phage	39.6	4.9e-12
AVF27102.1|2832035_2832260_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	94.4	1.2e-31
AVF27103.1|2832266_2832545_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27104.1|2832596_2832740_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	80.0	4.5e-13
AVF27105.1|2832755_2833469_-	dUTPase	NA	S5M658	Brevibacillus_phage	39.4	1.4e-30
AVF27106.1|2833447_2833579_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27107.1|2833571_2834672_-	RNA polymerase sigma-B factor SigB	NA	A0A0K2CZU8	Paenibacillus_phage	79.5	1.4e-159
AVF27108.1|2834876_2835251_-	endodeoxyribonuclease RUS	NA	A0A0K2CYQ8	Paenibacillus_phage	67.5	2.6e-44
AVF27109.1|2835252_2835462_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	1.7e-29
AVF27110.1|2835468_2835579_-	hypothetical protein	NA	A0A0K2CYR7	Paenibacillus_phage	88.9	1.0e-09
AVF27111.1|2835580_2836330_-	phage-related protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.6	4.5e-120
AVF27112.1|2836292_2837183_-	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
AVF27113.1|2837231_2837564_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
AVF27114.1|2837588_2837990_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
AVF27115.1|2838039_2838843_-	phage related protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
AVF27116.1|2838805_2839696_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
AVF27117.1|2839784_2839961_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27118.1|2839957_2840128_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27119.1|2840130_2840394_-	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
AVF27120.1|2840408_2841086_-	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
AVF27121.1|2841082_2841271_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27122.1|2841275_2841446_-	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
AVF27123.1|2841442_2841667_-	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
AVF27124.1|2841663_2842035_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	3.2e-55
AVF27125.1|2842027_2842315_-	hypothetical protein	NA	NA	NA	NA	NA
2842279:2842292	attL	TCGTAATGTTCATT	NA	NA	NA	NA
AVF27126.1|2842330_2842621_-	Helix-turn-helix domain protein	NA	A0A0K2CZS5	Paenibacillus_phage	84.2	1.9e-39
AVF27127.1|2842617_2843358_-	putative antirepressor, phage associated	NA	A0A0C5AFE7	Paenibacillus_phage	96.3	2.9e-132
AVF27128.1|2843354_2843624_-	putative phage protein	NA	NA	NA	NA	NA
AVF27129.1|2843850_2844270_+	transcriptional regulator-like protein	NA	Q786F1	Bacillus_phage	49.4	3.4e-16
AVF27130.1|2844352_2845582_+|integrase	phage integrase family protein	integrase	S5MNZ2	Brevibacillus_phage	54.6	1.6e-119
2851407:2851420	attR	AATGAACATTACGA	NA	NA	NA	NA
>prophage 23
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2900556	2911682	4489122	integrase	Paenibacillus_phage(53.85%)	19	2908404:2908417	2913364:2913377
AVF27192.1|2900556_2901930_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	4.8e-27
AVF27193.1|2902037_2902166_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27194.1|2902639_2902972_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	8.5e-31
AVF27195.1|2903121_2903511_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
AVF27196.1|2903700_2903904_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
AVF27197.1|2903980_2904100_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27198.1|2904146_2904266_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27199.1|2904528_2905173_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27200.1|2905208_2905322_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27201.1|2906059_2906281_-	putative transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
AVF27202.1|2906379_2906571_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
AVF27203.1|2906574_2906727_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
AVF27204.1|2906869_2907130_-	hypothetical protein	NA	A0A0C5AJ69	Bacteriophage	95.3	6.2e-37
AVF27205.1|2907141_2907633_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.9	1.7e-72
AVF27206.1|2908022_2908523_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
2908404:2908417	attL	GTGGTTACTTTCAA	NA	NA	NA	NA
AVF27207.1|2909102_2909285_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27208.1|2909580_2909991_+	helix-turn-helix family protein	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
AVF27209.1|2910022_2910439_+	Metallopeptidase ImmA	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
AVF27210.1|2910560_2911682_+|integrase	phage integrase-like protein	integrase	A0A1B0T6A8	Bacillus_phage	45.3	4.4e-87
2913364:2913377	attR	TTGAAAGTAACCAC	NA	NA	NA	NA
>prophage 24
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3090862	3147935	4489122	transposase,protease	Bacillus_phage(14.29%)	57	NA	NA
AVF27373.1|3090862_3093091_-|protease	protease, transglutaminase superfamily	protease	NA	NA	NA	NA
AVF27374.1|3093083_3094340_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27375.1|3094336_3095302_-	recombination factor protein RarA	NA	NA	NA	NA	NA
AVF27376.1|3095522_3095879_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
AVF27377.1|3095885_3096899_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
AVF27378.1|3096901_3097378_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
AVF27379.1|3097409_3098273_-	putative membrane protein	NA	NA	NA	NA	NA
AVF27380.1|3098438_3098645_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27381.1|3098919_3099465_+	RNA polymerase sigma-28 factor SigK	NA	S6ANS0	Bacillus_phage	31.8	2.1e-10
AVF27382.1|3099554_3101165_-	putative DNA recombinase CisA	NA	Q38184	Lactococcus_phage	23.9	4.2e-22
AVF27383.1|3101197_3101344_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27384.1|3101407_3102709_-	PASTA domain protein	NA	NA	NA	NA	NA
AVF27385.1|3102948_3104289_+	Ktr system potassium uptake protein B	NA	NA	NA	NA	NA
AVF27386.1|3104856_3105234_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27387.1|3105248_3106943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27388.1|3107537_3108368_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
AVF27389.1|3108543_3108975_-	Fluoroacetyl-CoA thioesterase	NA	NA	NA	NA	NA
AVF27390.1|3109037_3110237_-	beta-ketoadipyl-CoA thiolase PcaF	NA	NA	NA	NA	NA
AVF27391.1|3110241_3110985_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVF27392.1|3110974_3111835_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVF27393.1|3111838_3112630_-	putative enoyl-CoA hydratase PaaG	NA	NA	NA	NA	NA
AVF27394.1|3112642_3113416_-	short chain enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVF27395.1|3113412_3114768_-	phenylacetate-coenzyme A ligase PaaK	NA	NA	NA	NA	NA
AVF27396.1|3114779_3115565_-	enoyl-CoA hydratase/carnithine racemase	NA	NA	NA	NA	NA
AVF27397.1|3115601_3116000_-	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVF27398.1|3115996_3116299_-	EthD protein	NA	NA	NA	NA	NA
AVF27399.1|3116333_3117794_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVF27400.1|3117872_3118364_-	phenylacetic acid degradation protein PaaD	NA	NA	NA	NA	NA
AVF27401.1|3118377_3119211_-	putative phenylacetate degradation protein PaaC	NA	NA	NA	NA	NA
AVF27402.1|3119217_3119559_-	putative phenylacetate degradation protein PaaB	NA	NA	NA	NA	NA
AVF27403.1|3119555_3120542_-	phenylacetic acid degradation protein PaaA	NA	NA	NA	NA	NA
AVF27404.1|3120534_3121977_-	dihydrolipoyl dehydrogenase PdhD	NA	NA	NA	NA	NA
AVF27405.1|3123336_3124320_-	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVF27406.1|3124316_3125405_-	pyruvate dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AVF27407.1|3125503_3125812_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF27408.1|3125798_3126428_-	ABC-type uncharacterized transport system, permease component	NA	NA	NA	NA	NA
AVF27409.1|3127165_3127783_-	ABC-type uncharacterized transport system, periplasmic component	NA	NA	NA	NA	NA
AVF27410.1|3128886_3129657_-|transposase	putative transposase	transposase	A0A068A1P5	Thermus_phage	50.0	1.4e-39
AVF27411.1|3129969_3130179_-	RNA polymerase sigma-E factor SigE	NA	NA	NA	NA	NA
AVF27412.1|3130408_3130834_-	GtrA family protein	NA	NA	NA	NA	NA
AVF27413.1|3130911_3132174_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AVF27414.1|3132910_3133639_-	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVF27415.1|3133795_3134305_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF27416.1|3134322_3134880_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF27417.1|3134991_3135516_+	efflux transporter-like protein	NA	NA	NA	NA	NA
AVF27418.1|3135500_3135947_+	multidrug resistance protein	NA	NA	NA	NA	NA
AVF27419.1|3136093_3136597_-	anaerobic ribonucleotide reductase activating-like protein	NA	A0A2D0YLR2	Vibrio_phage	45.0	6.6e-27
AVF27420.1|3136545_3138393_-	ribonucleoside-triphosphate reductase class III catalytic subunit	NA	A0A0A8WEK0	Clostridium_phage	46.6	1.1e-159
AVF27421.1|3138716_3140186_-	nicotinate phosphoribosyltransferase PncB	NA	G3MA18	Bacillus_virus	50.3	2.2e-123
AVF27422.1|3140269_3141190_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27423.1|3141304_3142051_-	putative lipoprotein	NA	NA	NA	NA	NA
AVF27424.1|3142391_3142535_+	Sporulation inhibitor A	NA	NA	NA	NA	NA
AVF27425.1|3142650_3144261_-	putative beta-hexosaminidase A	NA	NA	NA	NA	NA
AVF27426.1|3144508_3144634_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF27427.1|3144641_3145928_-	HAMP domain protein	NA	NA	NA	NA	NA
AVF27428.1|3146091_3146544_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	1.8e-76
AVF27429.1|3147377_3147935_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3245576	3287292	4489122	tRNA,portal,terminase,tail,transposase,capsid	Brevibacillus_phage(44.44%)	51	NA	NA
AVF27521.1|3245576_3248243_-|tRNA	valine--tRNA ligase ValS	tRNA	A0A1V0SK04	Klosneuvirus	41.4	4.1e-168
AVF27522.1|3248807_3248972_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27523.1|3249035_3250187_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
AVF27524.1|3250596_3250836_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	66.7	1.3e-20
AVF27525.1|3251450_3251789_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27526.1|3251927_3254498_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	51.8	3.5e-233
AVF27527.1|3254821_3256342_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.3e-123
AVF27528.1|3256740_3257730_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27529.1|3257699_3258572_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27530.1|3258970_3259453_-	putative phage protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.2e-25
AVF27531.1|3260028_3260241_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27532.1|3260237_3260399_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	84.0	3.5e-14
AVF27533.1|3260654_3262373_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27534.1|3262363_3262591_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27535.1|3262577_3263561_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27536.1|3263983_3264703_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF27537.1|3264873_3265557_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF27538.1|3265717_3266446_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27539.1|3266387_3267104_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27540.1|3267239_3267482_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	96.2	7.3e-32
AVF27541.1|3267496_3267775_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	91.4	3.9e-45
AVF27542.1|3267771_3268449_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	96.4	3.3e-130
AVF27543.1|3268445_3268682_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
AVF27544.1|3268837_3268996_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	60.9	4.3e-09
AVF27545.1|3268995_3269286_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
AVF27546.1|3269297_3269888_-	phage structural protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
AVF27547.1|3269891_3270170_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27548.1|3270166_3270748_-	putative phage protein	NA	S5MA71	Brevibacillus_phage	45.4	1.5e-35
AVF27549.1|3270740_3271817_-|capsid	phage capsid assembly-like protein	capsid	A0A0K2CP27	Brevibacillus_phage	53.3	1.2e-102
AVF27550.1|3271809_3272220_-	phage protein	NA	A0A0A7RTU4	Clostridium_phage	50.0	1.2e-29
AVF27551.1|3272222_3272465_-	hypothetical protein	NA	S6C459	Thermus_phage	47.6	3.1e-14
AVF27552.1|3272464_3273448_-	putative phage cell wall hydrolase	NA	S5MA66	Brevibacillus_phage	55.9	2.6e-104
AVF27553.1|3273452_3274091_-	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	49.5	2.2e-51
AVF27554.1|3274087_3276205_-|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	42.3	1.2e-141
AVF27555.1|3276258_3276429_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27556.1|3276428_3276854_-	phage protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
AVF27557.1|3276880_3277345_-	putative phage protein	NA	A0A0K2CNG3	Brevibacillus_phage	62.7	7.2e-52
AVF27558.1|3277346_3278678_-	phage protein	NA	A0A0K2CNL4	Brevibacillus_phage	50.1	2.9e-114
AVF27559.1|3278678_3278849_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27560.1|3278841_3279252_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.2	2.3e-25
AVF27561.1|3279248_3279659_-	phage protein	NA	A0A0A7RTT0	Clostridium_phage	58.0	2.1e-39
AVF27562.1|3279658_3280018_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	56.4	1.4e-31
AVF27563.1|3280019_3280391_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	60.5	1.3e-32
AVF27564.1|3280417_3280675_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27565.1|3280686_3281730_-|capsid	putative major capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.0	1.1e-172
AVF27566.1|3281745_3282102_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.3	1.0e-42
AVF27567.1|3282117_3282741_-	Phage minor structural protein GP20	NA	A0A0K2CP96	Brevibacillus_phage	68.9	2.4e-71
AVF27568.1|3282784_3283804_-	NAD(+)--arginine ADP-ribosyltransferase EFV	NA	S5MTV5	Brevibacillus_phage	53.8	2.6e-102
AVF27569.1|3283800_3285273_-|portal	phage portal protein, SPP1 family	portal	A0A0K2CNK4	Brevibacillus_phage	62.0	3.5e-169
AVF27570.1|3285287_3286559_-|terminase	phage-related terminase-like protein large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.0	1.3e-164
AVF27571.1|3286551_3287292_-|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	48.4	2.1e-45
>prophage 26
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3290302	3472657	4489122	coat,integrase,tRNA,portal,terminase,plate,tail,transposase,protease,capsid	Paenibacillus_phage(46.82%)	250	3353761:3353779	3409795:3409813
AVF27578.1|3290302_3290515_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	87.0	7.8e-30
AVF27579.1|3290575_3290926_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	6.2e-56
AVF27580.1|3290946_3291183_-	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	70.1	1.5e-18
AVF27581.1|3291338_3291542_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	86.6	1.9e-25
AVF27582.1|3291675_3292140_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AC66	Paenibacillus_phage	73.0	7.7e-54
AVF27583.1|3292281_3292722_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27584.1|3292714_3292939_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	60.3	4.7e-17
AVF27585.1|3292990_3293155_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	85.0	3.6e-14
AVF27586.1|3293170_3293884_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	39.1	6.3e-31
AVF27587.1|3293862_3293994_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27588.1|3293986_3295087_-	RNA polymerase sigma-B factor SigB	NA	A0A2I7SC33	Paenibacillus_phage	79.5	6.5e-160
AVF27589.1|3295290_3295665_-	Holliday junction resolvase	NA	A0A0K2CYQ8	Paenibacillus_phage	65.0	8.4e-43
AVF27590.1|3295666_3295876_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	83.8	5.5e-28
AVF27591.1|3295882_3295993_-	hypothetical protein	NA	A0A0K2CYR7	Paenibacillus_phage	88.9	1.0e-09
AVF27592.1|3295994_3296744_-	phage-related protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.2	1.7e-119
AVF27593.1|3296706_3297597_-	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	86.1	6.1e-124
AVF27594.1|3297645_3297978_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	91.8	6.1e-53
AVF27595.1|3298002_3298404_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.0e-46
AVF27596.1|3298453_3299257_-	phage related protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	1.2e-46
AVF27597.1|3299219_3300110_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
AVF27598.1|3300200_3300368_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27599.1|3300352_3300544_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27600.1|3300548_3300683_-	hypothetical protein	NA	A0A0K2CYI0	Paenibacillus_phage	84.1	5.5e-13
AVF27601.1|3300679_3301006_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.2	9.8e-48
AVF27602.1|3301020_3301698_-	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	83.1	6.8e-59
AVF27603.1|3301694_3301883_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27604.1|3301918_3302227_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27605.1|3302223_3302979_-	putative prophage antirepressor	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
AVF27606.1|3303015_3303180_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27607.1|3303196_3303364_-	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	88.0	1.8e-21
AVF27608.1|3303326_3303587_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	76.1	5.6e-22
AVF27609.1|3303583_3303955_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	88.3	1.5e-55
AVF27610.1|3303947_3304130_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27611.1|3304122_3304224_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27612.1|3304239_3304530_-	DNA binding domain, excisionase family	NA	A0A0K2CZS5	Paenibacillus_phage	85.3	4.3e-39
AVF27613.1|3304776_3304986_-	putative phage protein	NA	Q786F1	Bacillus_phage	44.3	6.3e-08
AVF27614.1|3305260_3305986_+	transcriptional regulator-like protein	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
AVF27615.1|3306053_3307283_+|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	75.6	1.3e-180
AVF27616.1|3307355_3308219_-	putative RNA pseudouridine synthase YhcT	NA	NA	NA	NA	NA
AVF27617.1|3308466_3309600_+	exopolysaccharide biosynthesis protein	NA	A0A1P8CWN9	Bacillus_phage	30.9	1.4e-11
AVF27618.1|3309874_3310831_-	pantothenate kinase CoaA	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
AVF27619.1|3310975_3312277_-	glutamate-1-semialdehyde 2,1-aminomutase 2	NA	NA	NA	NA	NA
AVF27620.1|3312339_3313779_-	protoporphyrinogen oxidase HemY	NA	NA	NA	NA	NA
AVF27621.1|3313819_3314749_-	ferrochelatase HemH	NA	NA	NA	NA	NA
AVF27622.1|3314745_3315819_-	uroporphyrinogen decarboxylase HemE	NA	NA	NA	NA	NA
AVF27623.1|3316011_3317007_-	delta-aminolevulinic acid dehydratase HemB	NA	NA	NA	NA	NA
AVF27624.1|3317027_3318578_-	porphyrin biosynthesis protein HemD	NA	NA	NA	NA	NA
AVF27625.1|3318594_3319539_-	porphobilinogen deaminase HemC	NA	NA	NA	NA	NA
AVF27626.1|3319587_3320325_-	precorrin-2 dehydrogenase SirC	NA	NA	NA	NA	NA
AVF27627.1|3320321_3321164_-	protein HemX	NA	NA	NA	NA	NA
AVF27628.1|3321195_3322596_-|tRNA	glutamyl-tRNA reductase HemA	tRNA	NA	NA	NA	NA
AVF27629.1|3322767_3323301_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27630.1|3323438_3323840_-	S-adenosylmethionine decarboxylase proenzyme SpeH	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
AVF27631.1|3324212_3324800_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27632.1|3325190_3325805_-	putative GTP-binding protein EngB	NA	NA	NA	NA	NA
AVF27633.1|3325823_3328157_-|protease	Lon protease Lon	protease	A0A0R6PGP8	Moraxella_phage	41.5	9.5e-169
AVF27634.1|3328306_3330025_-|protease	Lon protease 2	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
AVF27635.1|3330249_3330948_+	N-acetylmuramoyl-L-alanine amidase-like protein	NA	NA	NA	NA	NA
AVF27636.1|3330998_3332120_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase IspG	NA	NA	NA	NA	NA
AVF27637.1|3332224_3333487_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
AVF27638.1|3333502_3334093_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
AVF27639.1|3334257_3335559_-	trigger factor Tig	NA	NA	NA	NA	NA
AVF27640.1|3335738_3336641_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27641.1|3336771_3337992_-	PGA biosynthesis protein CapA	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.2	1.3e-55
AVF27642.1|3338088_3338205_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27643.1|3338218_3338332_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27644.1|3338386_3339892_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF27645.1|3339884_3340361_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF27646.1|3340527_3341073_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27647.1|3341169_3343014_+	asparagine ligase	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
AVF27648.1|3343081_3343714_-	Non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
AVF27649.1|3343700_3344456_-	ribonuclease PH	NA	NA	NA	NA	NA
AVF27650.1|3344766_3345798_-	spore germination protein GerM	NA	NA	NA	NA	NA
AVF27651.1|3346034_3346550_+	phosphatidylglycerophosphatase A-like protein	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
AVF27652.1|3346661_3347471_+	putative membrane protein	NA	NA	NA	NA	NA
AVF27653.1|3347708_3348428_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF27654.1|3348598_3349282_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF27655.1|3349534_3349816_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	100.0	4.8e-43
AVF27656.1|3349821_3350652_+|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	3.4e-153
AVF27657.1|3350804_3351119_-	putative membrane protein	NA	NA	NA	NA	NA
AVF27658.1|3351118_3351460_-	small multidrug resistance protein	NA	NA	NA	NA	NA
AVF27659.1|3351527_3352109_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF27660.1|3352464_3352926_+	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	47.0	2.1e-35
AVF27661.1|3352965_3353169_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	65.7	1.6e-16
3353761:3353779	attL	CAATTTGTATTTCCAATTT	NA	NA	NA	NA
AVF27662.1|3354277_3354439_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.0	3.0e-13
AVF27663.1|3354582_3354822_-	hypothetical protein	NA	A0A2I7SDD6	Paenibacillus_phage	93.7	1.6e-31
AVF27664.1|3355087_3355759_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	97.3	5.0e-131
AVF27665.1|3355755_3355992_-	hypothetical protein	NA	A0A0K2CZB4	Paenibacillus_phage	100.0	1.0e-30
AVF27666.1|3356027_3356186_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27667.1|3356178_3356574_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27668.1|3356586_3357954_-	phage structural protein	NA	S5MNY5	Brevibacillus_phage	38.5	2.4e-10
AVF27669.1|3357957_3358236_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27670.1|3358232_3358814_-	putative phage protein	NA	S5MA71	Brevibacillus_phage	45.4	2.0e-35
AVF27671.1|3358806_3359883_-|capsid	phage capsid assembly-like protein	capsid	A0A0K2CP27	Brevibacillus_phage	53.5	1.6e-102
AVF27672.1|3359875_3360286_-	phage protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	1.4e-27
AVF27673.1|3360288_3360531_-	hypothetical protein	NA	S5MC71	Brevibacillus_phage	35.9	1.1e-11
AVF27674.1|3360530_3361514_-	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	55.3	7.7e-104
AVF27675.1|3361518_3362157_-	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	50.5	9.9e-52
AVF27676.1|3362153_3364262_-|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	43.0	3.3e-144
AVF27677.1|3364382_3365603_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF27678.1|3365681_3366323_-	hypothetical protein	NA	S5MUN3	Brevibacillus_phage	41.2	1.1e-34
AVF27679.1|3366388_3366562_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27680.1|3366561_3366987_-	phage protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
AVF27681.1|3367010_3367478_-	putative phage protein	NA	A0A0K2CNG3	Brevibacillus_phage	64.3	4.2e-52
AVF27682.1|3367479_3368811_-	phage protein	NA	A0A0K2CNL4	Brevibacillus_phage	49.9	6.5e-114
AVF27683.1|3368811_3368982_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27684.1|3368974_3369385_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	47.6	8.3e-28
AVF27685.1|3369381_3369789_-	phage protein	NA	S5MNW5	Brevibacillus_phage	60.3	2.6e-37
AVF27686.1|3369788_3370148_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	55.6	7.0e-31
AVF27687.1|3370149_3370518_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	51.7	1.5e-28
AVF27688.1|3370504_3371515_-	hypothetical protein	NA	D2J006	Enterococcus_phage	65.6	2.2e-114
AVF27689.1|3371532_3372174_-	Phage minor structural protein GP20	NA	A0A0K2CP96	Brevibacillus_phage	71.8	1.5e-63
AVF27690.1|3372214_3373234_-	NAD(+)--arginine ADP-ribosyltransferase EFV	NA	S5M601	Brevibacillus_phage	55.5	2.9e-106
AVF27691.1|3373230_3374661_-|portal	phage portal protein, SPP1 family	portal	S5MNW1	Brevibacillus_phage	62.1	9.0e-170
AVF27692.1|3374677_3375949_-|terminase	phage-related terminase-like protein large subunit	terminase	A0A0K2CP71	Brevibacillus_phage	79.7	3.7e-199
AVF27693.1|3375917_3376355_-	Terminase small subunit	NA	S6B9Y6	Thermus_phage	63.9	1.3e-47
AVF27694.1|3376404_3376572_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27695.1|3376605_3376779_-	hypothetical protein	NA	A0A0C5AJR9	Paenibacillus_phage	78.0	3.3e-10
AVF27696.1|3376997_3377621_-	RNA polymerase sigma factor, sigma-70 family	NA	NA	NA	NA	NA
AVF27697.1|3377586_3377826_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
AVF27698.1|3377822_3377951_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27699.1|3377943_3379056_-	RNA polymerase sigma-F factor SigF	NA	A0A0K2CZU8	Paenibacillus_phage	80.3	1.2e-161
AVF27700.1|3379239_3379461_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	93.2	2.1e-33
AVF27701.1|3379465_3379870_-	Holliday junction resolvase	NA	A0A2I7SC39	Paenibacillus_phage	96.2	3.9e-70
AVF27702.1|3379850_3380435_-	NUMOD4 motif	NA	K7Z7Q9	Megavirus	39.9	1.8e-28
AVF27703.1|3380830_3381160_-	hypothetical protein	NA	A0A0C5JZC6	Enterococcus_phage	49.3	3.3e-11
AVF27704.1|3381165_3383379_-	Regulatory protein RepA	NA	A0A2I7SC35	Paenibacillus_phage	93.2	0.0e+00
AVF27705.1|3383383_3383713_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	100.0	8.3e-63
AVF27706.1|3383728_3383893_-	hypothetical protein	NA	A0A0K2CZU3	Paenibacillus_phage	95.6	8.7e-21
AVF27707.1|3383902_3385483_-	type I restriction enzyme EcoKI subunit R	NA	A0A0K2CZF8	Paenibacillus_phage	97.3	6.9e-296
AVF27708.1|3385492_3386002_-	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	92.9	4.6e-84
AVF27709.1|3386023_3387103_-	hypothetical protein	NA	A0A0K2CZH1	Paenibacillus_phage	84.4	1.2e-174
AVF27710.1|3387102_3388413_-	putative ATP-binding protein involved in virulence	NA	A0A2I7SC23	Paenibacillus_phage	81.2	8.5e-175
AVF27711.1|3388478_3389189_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	7.5e-125
AVF27712.1|3389225_3389597_-	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	95.9	5.3e-58
AVF27713.1|3389664_3389844_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27714.1|3389885_3390107_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	69.9	5.7e-23
AVF27715.1|3390146_3390422_-	hypothetical protein	NA	A0A0N9RRC2	Paenibacillus_phage	89.0	3.4e-25
AVF27716.1|3390697_3390964_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27717.1|3390965_3391199_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27718.1|3391195_3391366_-	hypothetical protein	NA	R9VY98	Paenibacillus_phage	80.8	5.0e-19
AVF27719.1|3391337_3391589_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	72.2	1.9e-22
AVF27720.1|3391589_3391868_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27721.1|3391873_3392167_-	DNA binding domain, excisionase family	NA	A0A2I7SC15	Paenibacillus_phage	86.6	1.4e-40
AVF27722.1|3392163_3392901_-	putative antirepressor, phage associated	NA	A0A2I7SC24	Paenibacillus_phage	92.7	2.7e-130
AVF27723.1|3392918_3393548_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27724.1|3393765_3393957_-	helix-turn-helix protein	NA	NA	NA	NA	NA
AVF27725.1|3394082_3394499_+	HTH-type transcriptional regulator ImmR	NA	R9W020	Paenibacillus_phage	76.4	8.4e-44
AVF27726.1|3394446_3395508_+	putative phage DNA-binding protein	NA	A0A0F6N3H6	Staphylococcus_phage	30.6	9.4e-07
AVF27727.1|3395606_3396842_+|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	96.6	1.4e-232
AVF27728.1|3397099_3398083_-	beta-lactamase domain protein	NA	NA	NA	NA	NA
AVF27729.1|3398092_3398734_-	methyltransferase domain protein	NA	NA	NA	NA	NA
AVF27730.1|3399326_3400274_+	L-lactate dehydrogenase P	NA	NA	NA	NA	NA
AVF27731.1|3400521_3400764_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27732.1|3401090_3401534_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF27733.1|3401675_3402035_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF27734.1|3402863_3406460_+	type-F conjugative transfer system pilin assembly protein TraF	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.6	2.8e-42
AVF27735.1|3406532_3407102_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF27736.1|3407610_3408516_+|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.2	3.4e-90
AVF27737.1|3408925_3409132_+	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF27738.1|3409232_3409511_+	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF27739.1|3410175_3410814_+	channel protein, hemolysin III family	NA	NA	NA	NA	NA
3409795:3409813	attR	CAATTTGTATTTCCAATTT	NA	NA	NA	NA
AVF27740.1|3411512_3411977_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	63.6	5.4e-07
AVF27741.1|3412126_3413350_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF27742.1|3414158_3415721_-	putative DNA recombinase CisA	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
AVF27743.1|3415659_3415941_-	hypothetical protein	NA	A0A0C5AF76	Paenibacillus_phage	98.9	2.7e-46
AVF27744.1|3415952_3416411_-	phage transcriptional regulator, ArpU family	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
AVF27745.1|3416461_3416920_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
AVF27746.1|3417078_3417666_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	93.8	4.7e-101
AVF27747.1|3417662_3417875_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
AVF27748.1|3417864_3417990_-	hypothetical protein	NA	R9W0Q8	Paenibacillus_phage	97.6	5.8e-17
AVF27749.1|3417982_3418174_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
AVF27750.1|3418223_3418589_-	HTH-type transcriptional regulator ImmR	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
AVF27751.1|3418635_3418785_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
AVF27752.1|3418799_3419105_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
AVF27753.1|3419107_3420436_-	replicative DNA helicase DnaC	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.2e-247
AVF27754.1|3420395_3421232_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.9	1.2e-158
AVF27755.1|3421245_3421560_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
AVF27756.1|3421556_3422315_-	putative metallo-hydrolase YycJ	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
AVF27757.1|3422327_3423242_-	phage recombination protein Bet	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
AVF27758.1|3423244_3423442_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
AVF27759.1|3423438_3424959_-	chromosome segregation protein	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
AVF27760.1|3424942_3425236_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
AVF27761.1|3425240_3425501_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
AVF27762.1|3425536_3425947_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27763.1|3426108_3426342_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
AVF27764.1|3426338_3426581_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
AVF27765.1|3426677_3426854_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27766.1|3426837_3427110_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
AVF27767.1|3427136_3427877_-	phage regulatory protein, Rha family	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
AVF27768.1|3427905_3428049_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
AVF27769.1|3428246_3428465_-	phage-associated protein, BcepMu gp16 family	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
AVF27770.1|3428682_3429129_+	HTH-type transcriptional regulator ImmR	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
AVF27771.1|3429702_3429906_+	membrane protein YqaE	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
AVF27772.1|3430002_3430233_-	putative transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
AVF27773.1|3430708_3430900_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
AVF27774.1|3430896_3431163_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	84.3	8.0e-32
AVF27775.1|3431166_3431373_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
AVF27776.1|3431464_3431707_-	hypothetical protein	NA	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
AVF27777.1|3431959_3432634_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC18	Paenibacillus_phage	93.3	2.4e-128
AVF27778.1|3432630_3432870_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
AVF27779.1|3432905_3433064_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27780.1|3433056_3433452_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27781.1|3433464_3435249_-	phage structural protein	NA	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
AVF27782.1|3435249_3435813_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	91.4	1.9e-91
AVF27783.1|3435809_3436934_-|plate	baseplate assembly protein	plate	A0A0C5AEG2	Bacteriophage	100.0	9.4e-207
AVF27784.1|3436930_3437257_-|plate	baseplate wedge subunit	plate	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
AVF27785.1|3437246_3437648_-	Phage protein U	NA	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
AVF27786.1|3437644_3438022_-|plate	phage baseplate assembly protein V	plate	A0A0C5AEP6	Bacteriophage	90.4	1.6e-57
AVF27787.1|3438024_3439053_-|tail	tail protein	tail	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
AVF27788.1|3439049_3439259_-	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	76.1	4.8e-24
AVF27789.1|3439255_3441751_-	tape measure domain protein	NA	A0A0C5ABJ2	Bacteriophage	84.4	0.0e+00
AVF27790.1|3441734_3441878_-	hypothetical protein	NA	A0A0C5AN07	Bacteriophage	66.7	3.3e-08
AVF27791.1|3441910_3442246_-	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
AVF27792.1|3442273_3442792_-|tail	major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
AVF27793.1|3442804_3444247_-|tail	major tail sheath protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
AVF27794.1|3444250_3444523_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
AVF27795.1|3444519_3444987_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
AVF27796.1|3444983_3445535_-|tail	Prophage minor tail protein Z (GPZ)	tail	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
AVF27797.1|3445531_3445843_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
AVF27798.1|3445839_3445989_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
AVF27799.1|3446002_3447031_-|capsid	Phage major capsid protein E	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
AVF27800.1|3447046_3447403_-	hypothetical protein	NA	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
AVF27801.1|3447399_3448521_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A0C5AEN1	Bacteriophage	98.4	6.7e-205
AVF27802.1|3448480_3450040_-|portal	phage portal protein, lambda family	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
AVF27803.1|3450036_3450258_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
AVF27804.1|3450274_3452137_-|tail	Bacteriophage tail assembly protein	tail	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
AVF27805.1|3452120_3452633_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
AVF27806.1|3453780_3453984_+	YcfA-like protein	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
AVF27807.1|3454014_3454425_+	Antitoxin HicB	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
AVF27808.1|3454453_3454657_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
AVF27809.1|3454747_3454987_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	62.8	8.9e-14
AVF27810.1|3455127_3456447_-	putative permease	NA	NA	NA	NA	NA
AVF27811.1|3456576_3457509_-	dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit	NA	NA	NA	NA	NA
AVF27812.1|3457489_3458191_-	dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit	NA	NA	NA	NA	NA
AVF27813.1|3458606_3459134_+	3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2	NA	NA	NA	NA	NA
AVF27814.1|3459217_3460054_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF27815.1|3460040_3461057_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVF27816.1|3461061_3461853_-	glycosyltransferase, group 2 family protein	NA	NA	NA	NA	NA
AVF27817.1|3462006_3462927_+	NAD dependent epimerase/dehydratase family protein WcaG	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.9	1.6e-31
AVF27818.1|3463008_3463728_-	glycosyltransferase-like protein	NA	K7Z8A5	Megavirus	23.6	2.1e-10
AVF27819.1|3463735_3464641_-	UDP-2-acetamido-2,6-dideoxy-hexulose 4-reductase	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
AVF27820.1|3464637_3465468_-	putative reductase	NA	NA	NA	NA	NA
AVF27821.1|3465464_3466451_-	polysaccharide biosynthesis protein CapD	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
AVF27822.1|3466440_3467535_-	UDP-N-acetylglucosamine 2-epimerase WecB	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
AVF27823.1|3467531_3469085_-	extracellular matrix biosynthesis-like protein	NA	NA	NA	NA	NA
AVF27824.1|3469265_3469637_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27825.1|3469636_3470773_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVF27826.1|3470747_3471938_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVF27827.1|3471934_3472657_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	G3MA50	Bacillus_virus	40.9	1.8e-46
>prophage 27
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3559305	3637287	4489122	coat,tRNA,integrase,head,portal,tail,transposase	Paenibacillus_phage(58.49%)	98	3579035:3579051	3619457:3619473
AVF27907.1|3559305_3559989_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF27908.1|3560159_3560879_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF27909.1|3561027_3561708_-	putative membrane protein	NA	NA	NA	NA	NA
AVF27910.1|3561704_3562076_-	LrgA family protein	NA	NA	NA	NA	NA
AVF27911.1|3562198_3563092_+	putative HTH-type transcriptional regulator YwbI	NA	NA	NA	NA	NA
AVF27912.1|3563467_3564025_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27913.1|3564135_3565284_-	transglutaminase domain protein	NA	NA	NA	NA	NA
AVF27914.1|3565311_3565551_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27915.1|3565573_3565726_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27916.1|3565844_3566987_+	exporter-like protein	NA	NA	NA	NA	NA
AVF27917.1|3567186_3567537_+	ribonuclease-like protein	NA	NA	NA	NA	NA
AVF27918.1|3567538_3568180_-	BsSco	NA	NA	NA	NA	NA
AVF27919.1|3568270_3569239_-	protoheme IX farnesyltransferase CyoE	NA	NA	NA	NA	NA
AVF27920.1|3569441_3571454_-	methyl-accepting chemotaxis protein McpC	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
AVF27921.1|3572061_3572541_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AVF27922.1|3572579_3572858_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27923.1|3572945_3573929_+	membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
AVF27924.1|3574065_3574290_-	small, acid-soluble spore protein A	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
AVF27925.1|3574794_3575781_-|tRNA	tryptophan--tRNA ligase TrpS	tRNA	NA	NA	NA	NA
AVF27926.1|3576159_3577578_-	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVF27927.1|3577790_3578429_-	ribonuclease H	NA	NA	NA	NA	NA
3579035:3579051	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
AVF27928.1|3579170_3579557_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27929.1|3579950_3580178_-	putative transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	85.1	3.0e-27
AVF27930.1|3580647_3580833_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
AVF27931.1|3580918_3581182_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
AVF27932.1|3581310_3582030_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	1.9e-136
AVF27933.1|3582200_3582884_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF27934.1|3583036_3583744_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27935.1|3583706_3584423_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27936.1|3584558_3584801_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
AVF27937.1|3584810_3585482_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	96.4	6.6e-131
AVF27938.1|3585478_3585718_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
AVF27939.1|3585897_3586230_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
AVF27940.1|3586239_3586992_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
AVF27941.1|3586994_3588467_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
AVF27942.1|3588466_3589168_-	Phage-related protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
AVF27943.1|3589170_3590577_-	Phage-related protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.3e-16
AVF27944.1|3590662_3591883_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF27945.1|3591941_3593738_-	tape measure domain protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
AVF27946.1|3593758_3594106_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	46.0	8.3e-21
AVF27947.1|3594171_3594477_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27948.1|3594476_3594995_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
AVF27949.1|3595008_3595419_-	hypothetical protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
AVF27950.1|3595423_3595759_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
AVF27951.1|3595764_3596070_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27952.1|3596066_3596387_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AVF27953.1|3596389_3596938_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
AVF27954.1|3597016_3598237_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF27955.1|3598278_3598644_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
AVF27956.1|3598656_3599247_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27957.1|3599333_3600176_-|head	phage head morphogenesis protein, SPP1 gp7 family	head	S5MTV5	Brevibacillus_phage	35.3	3.1e-37
AVF27958.1|3600135_3601548_-|portal	phage portal protein, SPP1 family	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
AVF27959.1|3601548_3602970_-	hypothetical protein	NA	A0A090EUA8	Clostridium_phage	69.2	3.0e-189
AVF27960.1|3602962_3603460_-	hypothetical protein	NA	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
AVF27961.1|3603675_3604299_-	RNA polymerase sigma factor, sigma-70 family	NA	NA	NA	NA	NA
AVF27962.1|3604264_3604504_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
AVF27963.1|3604500_3604629_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27964.1|3604621_3605740_-	RNA polymerase sigma-F factor SigF	NA	A0A2I7SC33	Paenibacillus_phage	89.4	7.2e-183
AVF27965.1|3605741_3605963_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
AVF27966.1|3605966_3606362_-	Holliday junction resolvase	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
AVF27967.1|3606351_3606705_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	99.1	6.2e-64
AVF27968.1|3606916_3609169_-	Regulatory protein RepA	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
AVF27969.1|3609173_3609503_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
AVF27970.1|3609499_3611089_-	type I restriction enzyme EcoKI subunit R	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
AVF27971.1|3611098_3611599_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
AVF27972.1|3611623_3612322_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	99.6	5.2e-139
AVF27973.1|3612353_3613457_-	hypothetical protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
AVF27974.1|3613456_3614767_-	putative ATP-binding protein involved in virulence	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
AVF27975.1|3614827_3615538_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.7	3.3e-125
AVF27976.1|3615587_3615959_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
AVF27977.1|3615988_3616273_-	transition state regulatory protein AbrB	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
AVF27978.1|3616276_3616510_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	84.1	4.3e-21
AVF27979.1|3616525_3616780_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
AVF27980.1|3616751_3616973_-	DNA binding domain, excisionase family	NA	NA	NA	NA	NA
AVF27981.1|3617057_3617300_-	anaerobic benzoate catabolism transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
AVF27982.1|3617424_3617757_+	putative phage protein	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
AVF27983.1|3617766_3618228_+	hypothetical protein	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
AVF27984.1|3618309_3619449_+|integrase	phage integrase family protein	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
AVF27985.1|3619501_3619867_-	hypothetical protein	NA	NA	NA	NA	NA
3619457:3619473	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
AVF27986.1|3620456_3622262_-	oligoendopeptidase, pepF/M3 family	NA	NA	NA	NA	NA
AVF27987.1|3622629_3622923_+	hypothetical protein	NA	NA	NA	NA	NA
AVF27988.1|3623050_3623752_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27989.1|3623779_3624163_-	bacterial globin family protein	NA	NA	NA	NA	NA
AVF27990.1|3624218_3624317_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27991.1|3624474_3625725_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVF27992.1|3625868_3626675_+	putative inorganic polyphosphate/ATP-NAD kinase PpnK	NA	NA	NA	NA	NA
AVF27993.1|3626777_3627197_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27994.1|3627234_3628119_-	lipoyl synthase LipA	NA	NA	NA	NA	NA
AVF27995.1|3628307_3629393_+	peptidase, M23 family	NA	A0A7K9	Microcystis_virus	37.0	8.7e-08
AVF27996.1|3629447_3630197_-	spore formation-associated protein	NA	NA	NA	NA	NA
AVF27997.1|3630729_3630834_-	hypothetical protein	NA	NA	NA	NA	NA
AVF27998.1|3630916_3631822_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF27999.1|3632332_3633271_-	O-acetylserine sulfhydrylase CysK	NA	C3U2M1	Lactococcus_phage	55.7	1.7e-84
AVF28000.1|3633294_3634113_-	RNA methyltransferase, TrmH family	NA	NA	NA	NA	NA
AVF28001.1|3634115_3634775_-	Ktr system potassium uptake protein C	NA	NA	NA	NA	NA
AVF28002.1|3634931_3635141_+	small, acid-soluble spore protein I	NA	NA	NA	NA	NA
AVF28003.1|3635401_3636163_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF28004.1|3636159_3637287_-|coat	spore coat protein SA	coat	NA	NA	NA	NA
>prophage 28
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3741260	3834999	4489122	transposase,integrase,protease	Paenibacillus_phage(25.0%)	82	3738040:3738055	3769370:3769385
3738040:3738055	attL	ATATTATAGTAAATAA	NA	NA	NA	NA
AVF28097.1|3741260_3742484_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF28098.1|3742639_3744088_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF28099.1|3744222_3744609_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28100.1|3744630_3745089_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28101.1|3745780_3745930_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28102.1|3745919_3747128_-	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
AVF28103.1|3747124_3747268_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF28104.1|3748001_3748154_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28105.1|3750116_3750368_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28106.1|3750444_3750885_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28107.1|3751017_3751389_-	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
AVF28108.1|3751656_3751956_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVF28109.1|3752209_3752560_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28110.1|3752860_3754393_-	NADH dehydrogenase AhpF	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
AVF28111.1|3754401_3754965_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AVF28112.1|3755108_3755276_-	Virus attachment protein p12 family protein	NA	NA	NA	NA	NA
AVF28113.1|3755289_3757278_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVF28114.1|3757274_3757502_-	FeoA family protein	NA	NA	NA	NA	NA
AVF28115.1|3758511_3758970_-	HTH-type transcriptional regulator GltC	NA	NA	NA	NA	NA
AVF28116.1|3759081_3760239_+	putative transporter protein	NA	NA	NA	NA	NA
AVF28117.1|3760497_3761010_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF28118.1|3761006_3761300_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF28119.1|3761443_3762451_-	spermidine/putrescine import ATP-binding protein potA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.5e-30
AVF28120.1|3762881_3763244_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
AVF28121.1|3763258_3763708_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
AVF28122.1|3764288_3765263_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF28123.1|3765436_3766030_+|protease	serine alkaline protease-like protein	protease	A0A127AWU5	Bacillus_phage	37.7	3.3e-25
AVF28124.1|3766274_3767540_-	toxin-like protein	NA	NA	NA	NA	NA
AVF28125.1|3767572_3768796_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF28126.1|3769082_3769274_-	toxin-like protein	NA	NA	NA	NA	NA
AVF28127.1|3769326_3770073_-	toxin-like protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
3769370:3769385	attR	TTATTTACTATAATAT	NA	NA	NA	NA
AVF28128.1|3770339_3772787_-	3-oxoacyl-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AVF28129.1|3772798_3773845_-	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVF28130.1|3773847_3776640_-	putative acetyltransferase	NA	NA	NA	NA	NA
AVF28131.1|3776636_3777125_-	(3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AVF28132.1|3777131_3777419_-	acyl carrier protein	NA	NA	NA	NA	NA
AVF28133.1|3777541_3778288_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
AVF28134.1|3778280_3779231_-	malonyl-CoA-[acyl-carrier-protein] transacylase	NA	NA	NA	NA	NA
AVF28135.1|3779227_3779647_-	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVF28136.1|3779652_3780807_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF28137.1|3780982_3781930_-	export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
AVF28138.1|3782268_3783375_+	filamentation induced by cAMP protein Fic	NA	NA	NA	NA	NA
AVF28139.1|3783810_3785694_-	chaperone protein HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
AVF28140.1|3786412_3787210_-	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF28141.1|3787214_3788015_-	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF28142.1|3789067_3789550_-	taurine catabolism dioxygenase TauD/TfdA	NA	NA	NA	NA	NA
AVF28143.1|3790801_3790909_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28144.1|3790861_3791761_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28145.1|3791910_3795075_-	endonuclease subunit	NA	NA	NA	NA	NA
AVF28146.1|3795135_3795897_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28147.1|3795889_3797350_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28148.1|3797334_3798639_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28149.1|3798864_3799002_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28150.1|3799290_3802641_-	type I restriction enzyme EcoKI subunit R	NA	Q5YA94	Bacillus_phage	22.9	2.0e-18
AVF28151.1|3802651_3803116_-|transposase	transposase	transposase	A0A2I7SCM7	Paenibacillus_phage	93.8	2.8e-11
AVF28152.1|3803143_3804367_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF28153.1|3804359_3805250_-	EcoKI restriction-modification system protein HsdS	NA	NA	NA	NA	NA
AVF28154.1|3805250_3806708_-	Type I restriction enzyme EcoKI M protein	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
AVF28155.1|3807518_3808028_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28156.1|3808724_3811898_-	type 2 lantibiotic biosynthesis protein LanM	NA	NA	NA	NA	NA
AVF28157.1|3811999_3812221_-	type 2 lantibiotic, mersacidin/lichenicidin family	NA	NA	NA	NA	NA
AVF28158.1|3812321_3813476_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF28159.1|3813481_3814180_-	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
AVF28160.1|3814195_3815206_-|protease	intracellular serine protease	protease	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
AVF28161.1|3815202_3815475_-	transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AVF28162.1|3816150_3817842_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.5e-123
AVF28163.1|3817818_3818055_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28164.1|3818239_3820234_+	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.1e-11
AVF28165.1|3820403_3820595_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28166.1|3820691_3820922_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28167.1|3820848_3821520_-	putative phage antirepressor protein	NA	O48391	Streptococcus_phage	68.8	9.8e-18
AVF28168.1|3823229_3823664_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28169.1|3823664_3825158_+	phage related protein	NA	NA	NA	NA	NA
AVF28170.1|3825594_3827247_-	23S rRNA (uracil-C(5))-methyltransferase RlmCD	NA	A0A2K5B251	Erysipelothrix_phage	40.2	9.6e-107
AVF28171.1|3827243_3828188_-	diacylglycerol kinase DagK	NA	NA	NA	NA	NA
AVF28172.1|3828337_3829126_-	sirohydrochlorin cobaltochelatase CbiX	NA	NA	NA	NA	NA
AVF28173.1|3829293_3829584_-	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVF28174.1|3830157_3830442_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28175.1|3830782_3831856_+	putative lipoprotein YerB	NA	NA	NA	NA	NA
AVF28176.1|3831962_3832442_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28177.1|3832674_3833157_-	NTP pyrophosphohydrolase-like protein	NA	NA	NA	NA	NA
AVF28178.1|3834555_3834999_-|protease	intracellular serine protease	protease	NA	NA	NA	NA
>prophage 29
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3839523	3850180	4489122		Prochlorococcus_phage(25.0%)	9	NA	NA
AVF28185.1|3839523_3841071_-	bifunctional purine biosynthesis protein PurH	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
AVF28186.1|3841281_3841905_-	phosphoribosylglycinamide formyltransferase PurN	NA	M4QRX9	Synechococcus_phage	38.9	1.8e-26
AVF28187.1|3841901_3842948_-	phosphoribosylformylglycinamidine cyclo-ligase PurM	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-68
AVF28188.1|3843041_3844616_-	amidophosphoribosyltransferase PurF	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
AVF28189.1|3844600_3846844_-	phosphoribosylformylglycinamidine synthase 2	NA	A6N228	Microbacterium_phage	44.5	4.5e-168
AVF28190.1|3846821_3847517_-	phosphoribosylformylglycinamidine synthase 1	NA	NA	NA	NA	NA
AVF28191.1|3847589_3847832_-	phosphoribosylformylglycinamidine synthase PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
AVF28192.1|3847926_3848811_-	phosphoribosylaminoimidazole-succinocarboxamide synthase PurC	NA	A0A0M4JBD3	Mollivirus	33.6	9.5e-37
AVF28193.1|3848884_3850180_-	adenylosuccinate lyase PurB	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 30
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3882809	3995441	4489122	transposase,holin,lysis	Paenibacillus_phage(34.78%)	114	NA	NA
AVF28215.1|3882809_3884291_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
AVF28216.1|3884428_3885784_-	putative polysaccharide deacetylase YheN	NA	NA	NA	NA	NA
AVF28217.1|3886075_3886546_-	peroxiredoxin-like protein	NA	NA	NA	NA	NA
AVF28218.1|3887095_3888121_+	transcriptional regulator LytR	NA	NA	NA	NA	NA
AVF28219.1|3888212_3889526_+	glutamate-1-semialdehyde 2,1-aminomutase 1	NA	NA	NA	NA	NA
AVF28220.1|3890052_3894582_+	glutamate synthase [NADPH] large chain GltA	NA	NA	NA	NA	NA
AVF28221.1|3894657_3895662_-	biotin synthase BioB	NA	NA	NA	NA	NA
AVF28222.1|3895822_3896260_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AVF28223.1|3896342_3897197_-	inositol-1-monophosphatase SuhB	NA	NA	NA	NA	NA
AVF28224.1|3897704_3897998_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28225.1|3898131_3898902_-	enoyl-[acyl-carrier-protein] reductase [NADH] FabI	NA	NA	NA	NA	NA
AVF28226.1|3899090_3900119_-	UV DNA damage endonuclease UvsE	NA	A0A2I2L3D9	Orpheovirus	27.5	7.7e-22
AVF28227.1|3900626_3901748_-	D-alanine--D-alanine ligase Ddl	NA	NA	NA	NA	NA
AVF28228.1|3901770_3902790_-	two-component response regulator	NA	NA	NA	NA	NA
AVF28229.1|3903131_3905831_+	aconitate hydratase Acn	NA	NA	NA	NA	NA
AVF28230.1|3905990_3906962_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF28231.1|3907069_3907813_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28232.1|3908150_3909182_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28233.1|3909255_3910536_+	putative superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.8	8.1e-37
AVF28234.1|3910756_3911347_-	GTP cyclohydrolase 1	NA	E7DN69	Pneumococcus_phage	54.4	5.5e-49
AVF28235.1|3911701_3911911_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28236.1|3912011_3913046_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF28237.1|3913116_3914286_-	putative iron-sulfur cluster binding protein	NA	NA	NA	NA	NA
AVF28238.1|3914314_3914902_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28239.1|3915182_3915611_-	Acetyltransferase YpeA	NA	NA	NA	NA	NA
AVF28240.1|3915891_3916521_-|holin	glycine betaine/carnitine/choline transport system permease protein OpuCD	holin	NA	NA	NA	NA
AVF28241.1|3916564_3917458_-|holin	choline-binding protein	holin	NA	NA	NA	NA
AVF28242.1|3917474_3918131_-|holin	choline transport system permease protein OpuBB	holin	NA	NA	NA	NA
AVF28243.1|3918127_3919288_-|holin	glycine betaine/carnitine/choline transport ATP-binding protein OpuCA	holin	G3M9Y6	Bacillus_virus	33.6	9.0e-27
AVF28244.1|3919699_3921001_-	putative 6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVF28245.1|3921006_3921981_-	Glucosamine kinase GspK	NA	NA	NA	NA	NA
AVF28246.1|3922026_3923034_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
AVF28247.1|3923327_3923438_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28248.1|3923698_3924313_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
AVF28249.1|3924430_3927049_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
AVF28250.1|3927109_3928096_-	ABC-2 type transport system permease protein PotC	NA	NA	NA	NA	NA
AVF28251.1|3928092_3928869_-	putative pleiotropic drug resistance protein	NA	NA	NA	NA	NA
AVF28252.1|3928884_3929832_-	spermidine/putrescine import ATP-binding protein potA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
AVF28253.1|3929991_3930201_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28254.1|3931016_3931319_-	putative membrane protein	NA	NA	NA	NA	NA
AVF28255.1|3931427_3932600_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVF28256.1|3932746_3933088_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28257.1|3933312_3933705_-	holo-[acyl-carrier-protein] synthase AcpS	NA	NA	NA	NA	NA
AVF28258.1|3933799_3934714_-	putative membrane protein	NA	NA	NA	NA	NA
AVF28259.1|3934697_3935624_-	putative ABC transporter ATP-binding protein YhcH	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
AVF28260.1|3935828_3936635_-	NH(3)-dependent NAD(+) ligase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
AVF28261.1|3937081_3937513_-	bacillithiol system oxidoreductase, YphP/YqiW family	NA	NA	NA	NA	NA
AVF28262.1|3937654_3938008_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28263.1|3938011_3938878_-	prolipoprotein diacylglyceryl transferase Lgt	NA	NA	NA	NA	NA
AVF28264.1|3938995_3939718_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AVF28265.1|3939720_3940239_-	phage shock protein C, PspC	NA	NA	NA	NA	NA
AVF28266.1|3940245_3940911_-	phage shock protein A, PspA	NA	NA	NA	NA	NA
AVF28267.1|3940965_3941256_-	putative membrane protein	NA	NA	NA	NA	NA
AVF28268.1|3941514_3942201_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28269.1|3942340_3943363_+	Ser/Thr phosphatase family protein	NA	NA	NA	NA	NA
AVF28270.1|3943408_3943897_+	tricarballylate dehydrogenase	NA	NA	NA	NA	NA
AVF28271.1|3944192_3944507_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28272.1|3944526_3945246_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	9.5e-136
AVF28273.1|3945416_3946100_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
AVF28274.1|3946166_3946427_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28275.1|3946516_3947002_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28276.1|3947158_3948427_+	tricarballylate dehydrogenase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
AVF28277.1|3948525_3948894_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28278.1|3949283_3949748_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF28279.1|3950748_3951342_+	undecaprenyl-diphosphatase BcrC	NA	NA	NA	NA	NA
AVF28280.1|3951448_3951685_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.6e-26
AVF28281.1|3951749_3952973_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF28282.1|3953015_3953597_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.4	5.2e-100
AVF28283.1|3953734_3954418_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVF28284.1|3954605_3955307_+	response regulator ArlR	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
AVF28285.1|3955296_3956676_+	sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
AVF28286.1|3956833_3957355_+	putative cell-wall hydrolase	NA	NA	NA	NA	NA
AVF28287.1|3957428_3957911_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28288.1|3957961_3958693_-	glyoxalase family protein	NA	NA	NA	NA	NA
AVF28289.1|3959092_3959884_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28290.1|3959880_3960783_-	carboxylate/amino acid/amine transporter	NA	NA	NA	NA	NA
AVF28291.1|3961114_3962098_-	Homoserine kinase	NA	NA	NA	NA	NA
AVF28292.1|3962355_3963573_-	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVF28293.1|3963638_3964229_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF28294.1|3964353_3965415_-	glyceraldehyde-3-phosphate dehydrogenase 2	NA	NA	NA	NA	NA
AVF28295.1|3965691_3966732_-	putative oxidoreductase YvaA	NA	NA	NA	NA	NA
AVF28296.1|3966816_3967062_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28297.1|3967640_3968123_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28298.1|3968532_3969018_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28299.1|3969414_3969585_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF28300.1|3969599_3969824_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28301.1|3969974_3970292_-	methylated-DNA-protein- cysteinemethyltransferase	NA	NA	NA	NA	NA
AVF28302.1|3970552_3970924_-	transcriptional regulator, ArsR family	NA	NA	NA	NA	NA
AVF28303.1|3970925_3971351_-	putative toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
AVF28304.1|3971707_3972112_-|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
AVF28305.1|3972330_3972579_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28306.1|3972581_3972761_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28307.1|3972733_3972985_-	Sigma-O factor regulatory protein RsoA	NA	NA	NA	NA	NA
AVF28308.1|3973050_3973644_-	RNA polymerase sigma factor SigO	NA	NA	NA	NA	NA
AVF28309.1|3974284_3975493_+	putative inner membrane protein	NA	NA	NA	NA	NA
AVF28310.1|3975482_3975710_+	Sulfurtransferase TusA	NA	NA	NA	NA	NA
AVF28311.1|3976059_3977280_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
AVF28312.1|3977321_3977591_-	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVF28313.1|3977593_3977764_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28314.1|3977770_3978196_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF28315.1|3978465_3978729_-	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF28316.1|3978803_3979034_-	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF28317.1|3979517_3980756_-	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVF28318.1|3980883_3981717_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28319.1|3982164_3982971_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF28320.1|3983153_3984332_+	cystathionine beta-lyase PatB	NA	NA	NA	NA	NA
AVF28321.1|3984380_3986741_-	Helicase IV	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.5	2.9e-08
AVF28322.1|3986984_3987440_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF28323.1|3987496_3988435_+	multidrug resistance protein	NA	NA	NA	NA	NA
AVF28324.1|3988583_3990221_-	L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AVF28325.1|3990555_3991824_-	putative membrane protein	NA	NA	NA	NA	NA
AVF28326.1|3991816_3992722_-	ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
AVF28327.1|3993024_3994248_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
AVF28328.1|3995222_3995441_-|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
>prophage 31
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	4005048	4049522	4489122	transposase,tRNA,bacteriocin	Pneumococcus_phage(16.67%)	49	NA	NA
AVF28339.1|4005048_4005738_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF28340.1|4005911_4006616_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	5.1e-57
AVF28341.1|4006867_4008841_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28342.1|4009136_4009493_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28343.1|4009489_4010185_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.9	1.2e-18
AVF28344.1|4010178_4010298_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF28345.1|4011042_4011420_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF28346.1|4011654_4011756_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28347.1|4011784_4011952_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVF28348.1|4012757_4013156_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.2	7.6e-10
AVF28349.1|4013184_4013313_-	putative transposon DNA-invertase Bin3	NA	NA	NA	NA	NA
AVF28350.1|4013424_4013607_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28351.1|4013761_4014061_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF28352.1|4014068_4015190_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28353.1|4015204_4015336_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28354.1|4015714_4016329_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	4.8e-11
AVF28355.1|4016307_4016811_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28356.1|4017260_4017941_-	Putative undecaprenyl-diphosphatase YbjG	NA	NA	NA	NA	NA
AVF28357.1|4018028_4019840_-	Phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
AVF28358.1|4019868_4020567_-	regulatory protein TenI	NA	NA	NA	NA	NA
AVF28359.1|4020538_4021462_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ThiD	NA	NA	NA	NA	NA
AVF28360.1|4021458_4022259_-	thiazole synthase ThiG	NA	NA	NA	NA	NA
AVF28361.1|4022260_4022464_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVF28362.1|4022520_4023666_-	FAD-dependent glycine oxidase-like protein	NA	NA	NA	NA	NA
AVF28363.1|4023649_4024282_-	regulatory protein TenI	NA	NA	NA	NA	NA
AVF28364.1|4024693_4025125_-	Double zinc ribbon	NA	NA	NA	NA	NA
AVF28365.1|4025298_4025580_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28366.1|4026142_4026763_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28367.1|4026746_4027295_-	RNA polymerase sigma factor SigW-like protein	NA	NA	NA	NA	NA
AVF28368.1|4027530_4028949_+	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF28369.1|4029054_4029456_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVF28370.1|4029711_4031154_-	putative dipeptidase YtjP	NA	NA	NA	NA	NA
AVF28371.1|4031278_4032325_-	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVF28372.1|4032491_4032983_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.6e-49
AVF28373.1|4033036_4033774_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
AVF28374.1|4033766_4034252_-	queuosine biosynthesis protein QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
AVF28375.1|4034248_4034920_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.3	1.4e-67
AVF28376.1|4035462_4037172_+|tRNA	arginine--tRNA ligase ArgS	tRNA	A0A2I2L3K1	Orpheovirus	32.3	4.1e-76
AVF28377.1|4037401_4037836_-|transposase	transposase, IS605 OrfB family protein	transposase	A0A288TXV8	Enterococcus_phage	74.4	9.7e-43
AVF28378.1|4038204_4040187_+	peptidoglycan-N-acetylmuramate O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.7	2.0e-42
AVF28379.1|4040203_4040707_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28380.1|4040788_4041007_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28381.1|4041048_4042149_-	putative beta-lactamase	NA	NA	NA	NA	NA
AVF28382.1|4042537_4043434_+	Major membrane immunogen, membrane-anchored lipoprotein	NA	NA	NA	NA	NA
AVF28383.1|4043579_4045457_+	NADH dehydrogenase Ndh	NA	NA	NA	NA	NA
AVF28384.1|4045582_4046032_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28385.1|4046047_4047025_+	heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
AVF28386.1|4047746_4048514_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF28387.1|4048727_4049522_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	52.9	1.1e-55
>prophage 32
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	4061937	4091235	4489122	transposase	Bacillus_phage(37.5%)	34	NA	NA
AVF28396.1|4061937_4063161_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF28397.1|4063565_4064093_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28398.1|4064188_4064503_+	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVF28399.1|4064477_4064738_+	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVF28400.1|4064734_4065040_+	heavy metal sensor kinase	NA	NA	NA	NA	NA
AVF28401.1|4065049_4065379_+	Two-component sensor histidine kinase YkoG-like protein	NA	NA	NA	NA	NA
AVF28402.1|4065726_4066611_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AVF28403.1|4066582_4068022_-	3-octaprenyl-4hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVF28404.1|4068035_4069310_-	aminotransferase class-III	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.5e-27
AVF28405.1|4069345_4071268_-	peptidase U32	NA	NA	NA	NA	NA
AVF28406.1|4071400_4072204_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVF28407.1|4072219_4073086_-	energy-coupling factor transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
AVF28408.1|4073061_4073895_-	energy-coupling factor transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.4e-21
AVF28409.1|4073930_4074491_-	heptaprenyl diphosphate synthase related protein	NA	NA	NA	NA	NA
AVF28410.1|4074477_4074858_-	putative membrane protein	NA	NA	NA	NA	NA
AVF28411.1|4075157_4076225_+	thiamine biosynthesis lipoprotein ApbE	NA	NA	NA	NA	NA
AVF28412.1|4076672_4077902_+	acetyltransferase	NA	NA	NA	NA	NA
AVF28413.1|4078427_4080026_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVF28414.1|4080099_4080498_-|transposase	putative transposase	transposase	A0A2I7RFB5	Vibrio_phage	34.5	9.9e-10
AVF28415.1|4080919_4081132_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28416.1|4081086_4081431_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28417.1|4081948_4082326_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28418.1|4082322_4082892_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF28419.1|4083464_4083947_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28420.1|4084563_4084878_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	41.6	4.0e-14
AVF28421.1|4084969_4085389_+	site-specific tyrosine recombinase XerC	NA	NA	NA	NA	NA
AVF28422.1|4085927_4086347_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF28423.1|4086353_4087007_+	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVF28424.1|4087126_4087414_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF28425.1|4087431_4088352_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF28426.1|4088417_4089452_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF28427.1|4089435_4090128_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF28428.1|4090084_4090900_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.8	4.8e-59
AVF28429.1|4090947_4091235_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
>prophage 33
CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	4313493	4320671	4489122	transposase	Bacillus_phage(33.33%)	8	NA	NA
AVF28626.1|4313493_4315563_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheH	NA	W8CYL7	Bacillus_phage	29.5	2.4e-46
AVF28627.1|4315559_4317320_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheI	NA	W8CYL7	Bacillus_phage	28.2	1.2e-46
AVF28628.1|4317489_4317633_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28629.1|4317912_4318743_-	putative oxidoreductase YajO	NA	A0A2H4PQR8	Staphylococcus_phage	49.3	7.2e-71
AVF28630.1|4318873_4319248_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF28631.1|4319268_4319637_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	100.0	9.0e-66
AVF28632.1|4319727_4320006_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28633.1|4320017_4320671_-	ABC-type transporter ATP-binding protein EcsA	NA	A0A076FI99	Aureococcus_anophage	27.6	1.1e-10
>prophage 1
CP019656	Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed1, complete sequence	103273	5150	62870	103273	transposase	Paenibacillus_phage(38.46%)	73	NA	NA
AVF28798.1|5150_5522_-	HTH-type transcriptional regulator ImmR	NA	A0A0F6WBJ9	Vibrio_phage	37.3	5.6e-07
AVF28799.1|5628_5853_+	helix-turn-helix protein	NA	NA	NA	NA	NA
AVF28800.1|5889_6294_+	phage transcriptional regulator, ArpU family	NA	NA	NA	NA	NA
AVF28801.1|6311_7178_+	thermophilic serine proteinase	NA	NA	NA	NA	NA
AVF28802.1|7443_8286_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28803.1|8362_8533_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	81.6	4.6e-17
AVF28804.1|8586_8901_+	hypothetical protein	NA	A0A0N9SGJ1	Paenibacillus_phage	45.1	5.1e-17
AVF28805.1|8893_9109_+	hypothetical protein	NA	A0A0K2CY28	Paenibacillus_phage	97.2	7.9e-38
AVF28806.1|9113_9434_+	hypothetical protein	NA	A0A2I7SCA0	Paenibacillus_phage	88.2	2.1e-47
AVF28807.1|9430_9589_+	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	58.5	1.2e-06
AVF28808.1|9688_9793_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28809.1|10068_10314_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28810.1|10303_10573_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28811.1|10636_10795_+	hypothetical protein	NA	A0A288TZ64	Enterococcus_phage	70.4	4.9e-05
AVF28812.1|10763_11069_+|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	51.5	1.7e-22
AVF28813.1|11190_11490_+	hypothetical protein	NA	R9W0Q8	Paenibacillus_phage	70.7	5.7e-10
AVF28814.1|11623_12679_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.2	6.2e-59
AVF28815.1|12656_13031_+	50S ribosomal protein L22/unknown domain fusion protein	NA	Q6SE87	Lactobacillus_prophage	46.0	1.2e-25
AVF28816.1|13049_13196_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28817.1|13218_13728_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF28818.1|13745_14303_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF28819.1|14485_14746_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28820.1|15328_15508_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28821.1|15561_18219_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28822.1|18243_18516_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28823.1|18532_18769_+	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
AVF28824.1|18855_19425_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28825.1|19429_20392_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28826.1|20410_22012_+	DNA primase (bacterial type)	NA	NA	NA	NA	NA
AVF28827.1|22029_22428_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28828.1|22448_22805_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28829.1|22809_25083_+	Conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVF28830.1|25123_25822_+	archaeal flagella assembly protein J	NA	NA	NA	NA	NA
AVF28831.1|25838_26957_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AVF28832.1|26972_27731_+	Flp pilus assembly protein TadB	NA	NA	NA	NA	NA
AVF28833.1|27745_29980_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28834.1|30005_30335_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28835.1|30339_30996_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28836.1|31010_32960_+	conjugal transfer ATP-binding protein TraC	NA	NA	NA	NA	NA
AVF28837.1|32959_34069_+	cell wall endopeptidase, family M23/M37	NA	A0A1P8BKT8	Lactococcus_phage	40.7	1.5e-15
AVF28838.1|34092_34989_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28839.1|35277_35535_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28840.1|35559_35973_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28841.1|36251_36458_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28842.1|36524_36677_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28843.1|36686_37904_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28844.1|38443_39064_+	DNA topoisomerase I	NA	Q331T5	Clostridium_botulinum_C_phage	32.3	7.2e-07
AVF28845.1|39360_40185_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28846.1|40265_40829_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28847.1|41447_42698_+|transposase	transposase, IS605 OrfB family	transposase	A0A1L2BWW3	Bacteriophage	40.4	1.7e-63
AVF28848.1|43828_44347_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28849.1|44399_46550_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	40.6	9.9e-88
AVF28850.1|46563_46758_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28851.1|46760_47804_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28852.1|47906_48038_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28853.1|48039_49098_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28854.1|49272_49623_+	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	62.6	4.6e-35
AVF28855.1|49875_50244_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	94.2	2.5e-63
AVF28856.1|50256_51393_+	DNA adenine methyltransferase YhdJ	NA	A0A1B0VM49	Pseudomonas_phage	45.1	4.9e-78
AVF28857.1|51542_52226_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF28858.1|52428_52716_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28859.1|52712_52904_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28860.1|52887_53718_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	99.6	6.8e-154
AVF28861.1|53723_54005_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	5.3e-42
AVF28862.1|54136_54778_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28863.1|55380_56130_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVF28864.1|56219_56732_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVF28865.1|57013_57856_-	ATP-dependent DNA ligase-like protein	NA	O64130	Bacillus_phage	44.9	4.1e-53
AVF28866.1|57956_59141_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28867.1|59115_60528_+	RNA polymerase-associated helicase-like protein	NA	I3VYY6	Thermoanaerobacterium_phage	25.9	2.3e-37
AVF28868.1|60511_61819_+	putative phosphoadenosine phosphosulfate sulfotransferase	NA	A0A220GKF8	Streptococcus_phage	32.6	8.8e-63
AVF28869.1|61805_62222_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28870.1|62222_62870_+	ParB-like nuclease domain protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	2.5e-50
>prophage 1
CP019657	Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence	60868	17466	53128	60868	integrase,transposase	Paenibacillus_phage(28.57%)	42	12445:12459	41734:41748
12445:12459	attL	AACATTGATAATTAC	NA	NA	NA	NA
AVF28934.1|17466_17862_+|transposase	transposase IS200-family protein	transposase	Q332K6	Clostridium_botulinum_C_phage	63.6	1.3e-41
AVF28935.1|17866_18922_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
AVF28936.1|19360_19807_+	transition state regulatory protein AbrB	NA	NA	NA	NA	NA
AVF28937.1|20361_21819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28938.1|21856_22531_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28939.1|22691_23009_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28940.1|22950_23097_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28941.1|23546_23816_+	Antitoxin MazE	NA	A0A0N9S804	Paenibacillus_phage	50.0	3.7e-08
AVF28942.1|23812_24142_+	mRNA interferase NdoA	NA	NA	NA	NA	NA
AVF28943.1|24386_25025_-	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF28944.1|25792_26071_-	DNA-binding protein HU 1	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
AVF28945.1|26180_26387_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
AVF28946.1|26743_27427_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
AVF28947.1|27564_28317_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	8.4e-135
AVF28948.1|28431_29349_-|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
AVF28949.1|29495_29747_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28950.1|29712_29973_+	hypothetical protein	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
AVF28951.1|30175_30904_+	DNA topoisomerase 1	NA	NA	NA	NA	NA
AVF28952.1|31004_31625_-	hypothetical protein	NA	NA	NA	NA	NA
AVF28953.1|31956_33537_+	putative DnaQ family exonuclease/DinG family helicase	NA	NA	NA	NA	NA
AVF28954.1|33982_34918_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVF28955.1|35106_35994_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28956.1|36174_36624_+	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	48.2	7.5e-06
AVF28957.1|36931_37033_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28958.1|37256_38144_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	44.5	2.8e-52
AVF28959.1|38576_38960_+|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF28960.1|39047_39908_-	metallo-beta-lactamase domain protein	NA	NA	NA	NA	NA
AVF28961.1|40181_40670_+	Bacterial transcription activator, effector binding domain	NA	NA	NA	NA	NA
AVF28962.1|40749_42801_+	Catalase HPII	NA	A0A2K9L572	Tupanvirus	40.8	1.8e-115
41734:41748	attR	AACATTGATAATTAC	NA	NA	NA	NA
AVF28963.1|43531_44755_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
AVF28964.1|45655_45853_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28965.1|45892_46177_-	YolD-like protein	NA	NA	NA	NA	NA
AVF28966.1|46221_47103_-	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF28967.1|47152_47458_-	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF28968.1|48304_48667_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28969.1|48656_48827_+	Spo0E like sporulation regulatory protein	NA	NA	NA	NA	NA
AVF28970.1|48903_49029_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28971.1|49018_49357_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28972.1|49411_49819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28973.1|49885_50389_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28974.1|50541_51504_+	hypothetical protein	NA	NA	NA	NA	NA
AVF28975.1|52072_53128_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
