The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	115570	175933	4023351	transposase,protease	Paenibacillus_phage(25.0%)	46	NA	NA
AVG10602.1|115570_116794_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG10603.1|117052_117349_+	S-layer protein	NA	NA	NA	NA	NA
AVG10604.1|118104_120612_+	protein translocase subunit SecA	NA	NA	NA	NA	NA
AVG10605.1|120773_121772_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	2.9e-05
AVG10606.1|121847_122720_+	putative membrane protein	NA	M1Q1P6	Streptococcus_phage	32.0	7.7e-31
AVG10607.1|122949_124011_+	N-acetyl-gamma-glutamyl-phosphate reductase ArgC	NA	NA	NA	NA	NA
AVG10608.1|124084_125311_+	arginine biosynthesis bifunctional protein ArgJ	NA	NA	NA	NA	NA
AVG10609.1|125368_126163_+	acetylglutamate kinase ArgB	NA	NA	NA	NA	NA
AVG10610.1|126216_127416_+	acetylornithine aminotransferase ArgD	NA	A0A1V0SKB7	Klosneuvirus	27.9	2.1e-31
AVG10611.1|127434_128394_+	ornithine carbamoyltransferase ArgF	NA	Q84489	Paramecium_bursaria_Chlorella_virus	29.2	1.0e-23
AVG10612.1|128419_129646_+	argininosuccinate synthase ArgG	NA	NA	NA	NA	NA
AVG10613.1|129733_131143_+	argininosuccinate lyase ArgH	NA	NA	NA	NA	NA
AVG10614.1|131317_132769_-	putative vancomycin resistance protein	NA	NA	NA	NA	NA
AVG10615.1|133180_133873_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.5	6.5e-25
AVG10616.1|133862_134783_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVG10617.1|134935_136207_+	cell wall endopeptidase, family M23/M37	NA	A0A075BS18	Microcystis_phage	47.4	2.9e-18
AVG10618.1|136307_137741_+|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	29.7	2.1e-25
AVG10619.1|137879_139166_+	cell division topological determinant MinJ	NA	NA	NA	NA	NA
AVG10620.1|139814_140588_-	putative flagellar motor protein	NA	NA	NA	NA	NA
AVG10621.1|140562_141360_-	motility protein A	NA	NA	NA	NA	NA
AVG10622.1|141611_143606_+	UvrABC system protein B	NA	NA	NA	NA	NA
AVG10623.1|143791_146674_+	UvrABC system protein A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.2	0.0e+00
AVG10624.1|146925_147381_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10625.1|147472_149089_-	ferredoxin--nitrite reductase NirA	NA	NA	NA	NA	NA
AVG10626.1|149331_149532_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10627.1|149723_150692_-	AP endonuclease, family 2	NA	NA	NA	NA	NA
AVG10628.1|153276_154782_+|protease	putative protease YrrO	protease	Q6DW11	Phage_TP	33.3	2.3e-27
AVG10629.1|155531_155855_+	SPBc2 prophage-derived uncharacterized protein YolA precursor	NA	NA	NA	NA	NA
AVG10630.1|155969_157193_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10631.1|157431_158718_-	adenylosuccinate ligase PurA	NA	A0A160ER07	Powai_lake_megavirus	37.0	3.2e-73
AVG10632.1|158878_160240_-	replicative DNA helicase DnaC	NA	A0A1P8VVQ6	Streptococcus_phage	50.2	8.4e-117
AVG10633.1|160264_160711_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
AVG10634.1|160707_162663_-	DHHA1 domain protein	NA	NA	NA	NA	NA
AVG10635.1|162680_163598_-	putative membrane protein	NA	NA	NA	NA	NA
AVG10636.1|164002_164338_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10637.1|164516_165740_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
AVG10638.1|165922_166198_+	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	66.7	5.8e-25
AVG10639.1|166423_167086_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10640.1|167387_168635_+	peptidase, M23 family	NA	A0A7K9	Microcystis_virus	44.5	1.2e-16
AVG10641.1|168869_169589_+	transcriptional regulatory protein WalR	NA	W8CYM9	Bacillus_phage	37.5	1.2e-37
AVG10642.1|169589_171416_+	sensor histidine kinase YycG	NA	A0A1V0SGX0	Hokovirus	26.6	3.0e-24
AVG10643.1|171412_172726_+	Two-component system YycF/YycG regulatory protein YycH	NA	NA	NA	NA	NA
AVG10644.1|172758_173526_+	YycH protein	NA	NA	NA	NA	NA
AVG10645.1|173572_174379_+	putative metallo-hydrolase YycJ	NA	A0A2I7SDH3	Paenibacillus_phage	36.1	1.3e-40
AVG10646.1|174347_174557_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10647.1|174724_175933_+|protease	putative serine protease YyxA	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	28.4	1.2e-10
>prophage 2
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	181569	240649	4023351	holin,transposase,integrase	Paenibacillus_phage(21.43%)	51	179706:179722	190597:190613
179706:179722	attL	GGGAAGGATCATATTGA	NA	NA	NA	NA
AVG10654.1|181569_181704_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVG10655.1|182027_183251_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10656.1|183976_185173_+	processive diacylglycerol glucosyltransferase UgtP	NA	NA	NA	NA	NA
AVG10657.1|185400_185784_-	putative MFS-type transporter YdgK	NA	NA	NA	NA	NA
AVG10658.1|186041_186740_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
AVG10659.1|186797_187253_-|holin	antiholin-like protein LrgA	holin	NA	NA	NA	NA
AVG10660.1|187394_188141_-	sensory transduction protein LytT	NA	NA	NA	NA	NA
AVG10661.1|188133_189900_-	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	32.9	4.6e-75
AVG10662.1|189901_190462_-	Acetyltransferase YpeA	NA	NA	NA	NA	NA
AVG10663.1|190577_191600_-	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
190597:190613	attR	TCAATATGATCCTTCCC	NA	NA	NA	NA
AVG10664.1|192179_192980_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AVG10665.1|193069_193498_-	transporter, EamA family	NA	NA	NA	NA	NA
AVG10666.1|193902_194880_+	putative oxidoreductase YajO	NA	NA	NA	NA	NA
AVG10667.1|194981_195164_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10668.1|195485_196724_+	peptidase T	NA	NA	NA	NA	NA
AVG10669.1|196807_197245_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10670.1|197425_197863_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10671.1|198172_199453_+	methyltransferase-like protein	NA	A0A1C9C5J0	Heterosigma_akashiwo_virus	29.5	3.8e-42
AVG10672.1|199449_199989_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	34.4	2.8e-23
AVG10673.1|199985_200909_+	NAD-dependent epimerase/dehydratase family protein	NA	M1H4P8	Acanthocystis_turfacea_Chlorella_virus	27.4	3.0e-17
AVG10674.1|200905_201928_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVG10675.1|202109_202877_+	cephalosporin hydroxylase family protein	NA	NA	NA	NA	NA
AVG10676.1|202895_203618_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10677.1|203648_204302_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10678.1|204351_205122_+	glucose-1-phosphate cytidylyltransferase RfbF	NA	NA	NA	NA	NA
AVG10679.1|205106_206213_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	25.8	6.4e-14
AVG10680.1|206276_207326_-	putative glycosyltransferase WscE	NA	NA	NA	NA	NA
AVG10681.1|207285_208008_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10682.1|208189_209047_+	methyltransferase type 11	NA	NA	NA	NA	NA
AVG10683.1|209095_209776_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10684.1|209790_210615_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10685.1|210675_211443_-	methyltransferase, FkbM family	NA	NA	NA	NA	NA
AVG10686.1|211667_212801_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVG10687.1|212805_213927_+	glycosyltransferase, group 1 family protein	NA	NA	NA	NA	NA
AVG10688.1|214009_215536_-	phage-related pre-neck appendage-like protein	NA	A0A1W6JQM0	Staphylococcus_phage	37.4	6.9e-19
AVG10689.1|215719_216853_+	glycosyltransferase-like protein	NA	A0A1V0SAH6	Catovirus	40.2	5.7e-10
AVG10690.1|216714_217485_-	putative 8-amino-7-oxononanoate synthase BioF	NA	NA	NA	NA	NA
AVG10691.1|217638_218862_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
AVG10692.1|219066_220227_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
AVG10693.1|220287_221124_+	ABC-type multidrug transport system, ATPase component	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	1.1e-21
AVG10694.1|221480_222179_+	heptaprenylglyceryl phosphate synthase PcrB	NA	NA	NA	NA	NA
AVG10695.1|222327_224658_+	ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.4e-134
AVG10696.1|224746_226768_+	DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	35.3	6.9e-99
AVG10697.1|232890_233208_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10698.1|233295_234873_-	putative glucose dehydrogenase	NA	NA	NA	NA	NA
AVG10699.1|234865_235462_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10700.1|235467_235860_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10701.1|236048_236954_+	putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase TagO	NA	NA	NA	NA	NA
AVG10702.1|237035_238142_+	lipoyl synthase-like protein	NA	NA	NA	NA	NA
AVG10703.1|238240_239362_+	maltodextrin import ATP-binding protein MsmX	NA	Q6GZ03	Mycoplasma_phage	32.3	2.7e-20
AVG10704.1|239425_240649_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 3
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	264761	311221	4023351	transposase,protease	Paenibacillus_phage(36.36%)	36	NA	NA
AVG10734.1|264761_265985_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10735.1|266278_266860_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	57.6	7.4e-54
AVG10736.1|267395_268424_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
AVG10737.1|268480_269485_+	glyceraldehyde-3-phosphate dehydrogenase Gap	NA	NA	NA	NA	NA
AVG10738.1|269623_270805_+	phosphoglycerate kinase Pgk	NA	NA	NA	NA	NA
AVG10739.1|270826_271579_+	triosephosphate isomerase TpiA	NA	NA	NA	NA	NA
AVG10740.1|271580_273119_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG10741.1|273275_274568_+	enolase Eno	NA	W6LP63	Streptococcus_phage	71.9	1.1e-171
AVG10742.1|274636_275350_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10743.1|275482_275719_+	Preprotein translocase band 1 subunit	NA	NA	NA	NA	NA
AVG10744.1|276006_278511_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.9	4.5e-92
AVG10745.1|279094_279574_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	8.2e-43
AVG10746.1|280522_280963_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10747.1|282818_283202_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10748.1|283306_284530_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10749.1|288553_289423_-	catechol-2,3-dioxygenase	NA	NA	NA	NA	NA
AVG10750.1|289450_291073_+	putative cardiolipin synthase	NA	NA	NA	NA	NA
AVG10751.1|291294_292518_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10752.1|292652_293048_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10753.1|293341_294367_+	O-demethylpuromycin-O-methyltransferase DmpM	NA	NA	NA	NA	NA
AVG10754.1|294493_295333_-	penicillin-binding protein 1F	NA	NA	NA	NA	NA
AVG10755.1|295624_296641_+	mannose-1-phosphate guanylyltransferase RfbM	NA	NA	NA	NA	NA
AVG10756.1|296688_297642_+	putative GDP-mannose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	34.0	2.7e-53
AVG10757.1|297642_298695_+	glycosyltransferase	NA	NA	NA	NA	NA
AVG10758.1|298827_299034_-	putative cold-inducible protein	NA	NA	NA	NA	NA
AVG10759.1|299129_299330_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	70.8	6.9e-20
AVG10760.1|300180_300405_+	4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase	NA	NA	NA	NA	NA
AVG10761.1|300349_301012_+	4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase KduI	NA	NA	NA	NA	NA
AVG10762.1|301050_301815_+	putative HTH-type transcriptional regulator YulB	NA	A0A077SK06	Escherichia_phage	31.2	9.5e-17
AVG10763.1|301849_302599_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
AVG10764.1|302676_303981_-	xanthine permease PbuX	NA	NA	NA	NA	NA
AVG10765.1|303973_304588_-	xanthine phosphoribosyltransferase Xpt	NA	NA	NA	NA	NA
AVG10766.1|305079_308217_+	glycosyl hydrolase, family 5	NA	NA	NA	NA	NA
AVG10767.1|308615_309188_+	meso-diaminopimelate D-dehydrogenase Ddh	NA	NA	NA	NA	NA
AVG10768.1|309326_309965_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG10769.1|309997_311221_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	6.2e-228
>prophage 4
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	365885	593163	4023351	protease,tRNA,coat,bacteriocin,integrase,transposase	Paenibacillus_phage(44.44%)	228	353644:353658	469035:470424
353644:353658	attL	TTGGGCAAGCTGGCT	NA	NA	NA	NA
AVG10816.1|365885_366764_+|protease	chaperone-like protein/protease-like protein	protease	NA	NA	NA	NA
353644:353658	attL	TTGGGCAAGCTGGCT	NA	NA	NA	NA
AVG10817.1|366779_367289_+	putative ribosomal-protein-alanine acetyltransferase RimI	NA	NA	NA	NA	NA
AVG10818.1|367310_368330_+|tRNA	putative tRNA threonylcarbamoyladenosine biosynthesis protein Gcp	tRNA	A0A0R6PI74	Moraxella_phage	39.7	4.3e-65
AVG10819.1|368462_369044_-	Glycerate 2-kinase	NA	NA	NA	NA	NA
AVG10820.1|369075_369603_-	Glycerate kinase	NA	W6LM47	Streptococcus_phage	52.8	9.7e-13
AVG10821.1|370041_370383_-	carbohydrate diacid transcriptional activator CdaR	NA	NA	NA	NA	NA
AVG10822.1|370342_370456_-	Sugar diacid regulator	NA	NA	NA	NA	NA
AVG10823.1|370670_370820_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10824.1|371092_372109_+	peptidase U61 LD-carboxypeptidase A	NA	NA	NA	NA	NA
AVG10825.1|372204_374136_-	putative ABC transporter ATP-binding protein YdiF	NA	A0A2K9L3Z8	Tupanvirus	30.7	1.5e-58
AVG10826.1|374188_374305_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10827.1|374416_375046_+	5-formyltetrahydrofolate cyclo-ligase-like protein	NA	NA	NA	NA	NA
AVG10828.1|375104_375557_+	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AVG10829.1|375575_376067_+	molybdopterin adenylyltransferase Mog	NA	NA	NA	NA	NA
AVG10830.1|376063_377074_+	molybdene to molybdopterin ligation enzyme-like protein	NA	NA	NA	NA	NA
AVG10831.1|377105_377369_+	twin-arginine translocation protein, TatA/E family subunit	NA	NA	NA	NA	NA
AVG10832.1|377368_378175_+	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.5e-12
AVG10833.1|378167_378422_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10834.1|378496_378778_+	10 kDa chaperonin	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
AVG10835.1|378867_380496_+	60 kDa chaperonin	NA	A0A219YK78	uncultured_virus	59.1	1.4e-158
AVG10836.1|380584_380920_-|integrase	integrase	integrase	A0A0C5AN64	Paenibacillus_phage	61.4	2.8e-29
AVG10837.1|381033_381147_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10838.1|381139_381448_-	helix-turn-helix family protein	NA	O03970	Lactobacillus_phage	34.1	1.5e-10
AVG10839.1|381602_381818_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10840.1|381732_382206_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10841.1|383023_383338_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG10842.1|383402_384626_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10843.1|384801_385296_-	spore germination receptor subunit-like protein	NA	NA	NA	NA	NA
AVG10844.1|385292_386393_-	spore germination protein YndE	NA	NA	NA	NA	NA
386286:386300	attR	TTGGGCAAGCTGGCT	NA	NA	NA	NA
AVG10845.1|386389_387817_-	spore germination protein KA	NA	NA	NA	NA	NA
386286:386300	attR	TTGGGCAAGCTGGCT	NA	NA	NA	NA
AVG10846.1|388716_389967_+	toxin-like protein	NA	NA	NA	NA	NA
AVG10847.1|390038_391520_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.4	2.3e-75
AVG10848.1|391486_391735_+	Clostridial binary toxin B/anthrax toxin PA	NA	A0A1V0E026	Clostridioides_phage	41.2	2.1e-05
AVG10849.1|391849_393073_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10850.1|393686_395165_+	amino acid antiporter	NA	NA	NA	NA	NA
AVG10851.1|395176_397045_+	decarboxylase	NA	NA	NA	NA	NA
AVG10852.1|397115_398504_+	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVG10853.1|399053_400316_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	1.3e-87
AVG10854.1|400347_401049_+	Replication protein	NA	NA	NA	NA	NA
AVG10855.1|401519_402743_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10856.1|403476_404925_+	putative transporter	NA	NA	NA	NA	NA
AVG10857.1|404982_406845_+	decarboxylase	NA	NA	NA	NA	NA
AVG10858.1|406954_407662_+	pyridoxine kinase PdxK	NA	NA	NA	NA	NA
AVG10859.1|407860_409246_+	putative tyrosine permease, NhaC family	NA	NA	NA	NA	NA
AVG10860.1|409532_409829_+	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVG10861.1|410084_410789_+	putative membrane protein	NA	NA	NA	NA	NA
AVG10862.1|411018_411834_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	D6QWP2	uncultured_phage	53.5	6.9e-42
AVG10863.1|413294_413852_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	7.1e-38
AVG10864.1|413848_414808_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	2.3e-76
AVG10865.1|414804_415659_+|coat	spore coat polysaccharide biosynthesis protein SpsK	coat	NA	NA	NA	NA
AVG10866.1|415915_416209_+	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVG10867.1|417275_418499_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10868.1|418491_418794_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10869.1|419722_420499_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVG10870.1|421636_422860_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10871.1|422924_423044_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG10872.1|423441_423708_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10873.1|423861_424743_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10874.1|424765_425698_+	CRISPR-associated RAMP Cmr1 family protein	NA	NA	NA	NA	NA
AVG10875.1|425697_427371_+	CRISPR-associated RAMP Crm2 family protein	NA	NA	NA	NA	NA
AVG10876.1|427373_428495_+	CRISPR-associated protein, Cmr3 family	NA	NA	NA	NA	NA
AVG10877.1|428487_428796_+	CRISPR-associated RAMP protein, Cmr4 family	NA	NA	NA	NA	NA
AVG10878.1|428831_429404_+	CRISPR-associated RAMP protein, Cmr4 family	NA	NA	NA	NA	NA
AVG10879.1|429387_429792_+	CRISPR-associated protein, Cmr5 family	NA	NA	NA	NA	NA
AVG10880.1|429754_430624_+	CRISPR-associated RAMP Cmr6 family protein	NA	NA	NA	NA	NA
AVG10881.1|430919_431084_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	56.8	5.0e-08
AVG10882.1|431080_431809_-|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	68.3	4.9e-15
AVG10883.1|432076_432634_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG10884.1|432651_433161_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG10885.1|433466_434138_+	ABC-transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
AVG10886.1|434134_434305_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10887.1|434324_434618_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	3.7e-14
AVG10888.1|434713_435088_-|transposase	putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	69.7	5.1e-48
AVG10889.1|436223_437447_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
AVG10890.1|437978_439235_+	sporulation protein YdcC	NA	NA	NA	NA	NA
AVG10891.1|439402_440590_+	alanine racemase Alr	NA	NA	NA	NA	NA
AVG10892.1|440824_441106_+	putative transcriptional regulator, CopG family	NA	NA	NA	NA	NA
AVG10893.1|441109_441460_+	mRNA interferase NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
AVG10894.1|441547_443836_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10895.1|444037_444619_-	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVG10896.1|445000_445459_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10897.1|445491_445629_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10898.1|446050_446278_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10899.1|446533_447538_+|protease	minor extracellular protease Epr	protease	A0A217EQY2	Bacillus_phage	38.4	7.5e-38
AVG10900.1|447534_447732_+	thermophilic serine proteinase	NA	NA	NA	NA	NA
AVG10901.1|448309_448666_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10902.1|448764_449235_+	SprT-like protein	NA	NA	NA	NA	NA
AVG10903.1|449955_450654_-|integrase	phage integrase-like protein	integrase	A0A2I7SC08	Paenibacillus_phage	58.0	3.6e-71
AVG10904.1|450723_450924_-|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	52.9	7.9e-08
AVG10905.1|450936_451545_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG10906.1|451609_452833_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10907.1|453396_453987_+	phage structural protein	NA	NA	NA	NA	NA
AVG10908.1|453998_454286_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	51.6	3.8e-19
AVG10909.1|454644_455868_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10910.1|455895_456168_+	DNA processing Smf single strand binding protein-like protein	NA	A0A0K2CZQ0	Paenibacillus_phage	96.8	2.7e-11
AVG10911.1|456263_456710_-	Thiol-disulfide oxidoreductase YkuV	NA	NA	NA	NA	NA
AVG10912.1|456724_456979_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10913.1|457040_457229_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10914.1|457198_458680_-|bacteriocin	putative bacteriocin-skfA transport system permease protein SkfF	bacteriocin	NA	NA	NA	NA
AVG10915.1|458672_459395_-	SkfA peptide export ATP-binding protein SkfE	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.9e-19
AVG10916.1|459407_459830_-	abortive infection protein	NA	NA	NA	NA	NA
AVG10917.1|459949_461173_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10918.1|461215_462298_-	Sporulation-killing factor biosynthesis protein SkfC	NA	NA	NA	NA	NA
AVG10919.1|462311_463526_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AVG10920.1|463599_463785_-	Sporulation-killing factor SkfA	NA	NA	NA	NA	NA
AVG10921.1|464159_464564_+	D-mannose binding lectin	NA	NA	NA	NA	NA
AVG10922.1|465349_465676_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVG10923.1|465814_466117_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10924.1|466756_468796_-	methyl-accepting chemotaxis protein signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
AVG10925.1|469079_470303_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10926.1|470407_471022_-	putative membrane protein	NA	NA	NA	NA	NA
AVG10927.1|471200_472424_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10928.1|472846_473059_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10929.1|473267_473702_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG10930.1|473698_476866_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVG10931.1|477064_477652_+	peptide deformylase 2	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
AVG10932.1|477706_478675_+	peptide methionine sulfoxide reductase MsrA/MsrB	NA	NA	NA	NA	NA
AVG10933.1|479000_479570_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
AVG10934.1|479379_479841_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG10935.1|480027_481092_+	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVG10936.1|481622_482051_+	transcriptional regulator, BadM/Rrf2 family	NA	NA	NA	NA	NA
AVG10937.1|482282_483008_+	transcriptional regulator, GntR family	NA	NA	NA	NA	NA
AVG10938.1|483216_483690_+	N-acetylgalactosamine-specific phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVG10939.1|483708_484476_+	putative N-acetylgalactosamine permease IIC component 2	NA	NA	NA	NA	NA
AVG10940.1|484465_485338_+	N-acetylgalactosamine permease IID component AgaD	NA	NA	NA	NA	NA
AVG10941.1|485355_485778_+	PTS system mannose-specific component IIAB-like protein	NA	NA	NA	NA	NA
AVG10942.1|485842_489538_-	amino acid adenylation protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
AVG10943.1|489622_491380_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.1e-15
AVG10944.1|492630_494265_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVG10945.1|494740_495970_-	acetyltransferase	NA	NA	NA	NA	NA
AVG10946.1|496414_497482_-	thiamine biosynthesis lipoprotein ApbE	NA	NA	NA	NA	NA
AVG10947.1|497781_498162_+	putative membrane protein	NA	NA	NA	NA	NA
AVG10948.1|498148_498709_+	heptaprenyl diphosphate synthase related protein	NA	NA	NA	NA	NA
AVG10949.1|498744_499578_+	energy-coupling factor transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	1.2e-20
AVG10950.1|499553_500420_+	energy-coupling factor transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
AVG10951.1|500436_501240_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVG10952.1|501372_503295_+	peptidase U32	NA	NA	NA	NA	NA
AVG10953.1|503330_504605_+	aminotransferase class-III	NA	A0A1V0SKB7	Klosneuvirus	27.4	8.9e-28
AVG10954.1|504618_506058_+	3-octaprenyl-4hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVG10955.1|506047_506914_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG10956.1|507261_507591_-	Two-component sensor histidine kinase YkoG-like protein	NA	NA	NA	NA	NA
AVG10957.1|507600_507906_-	heavy metal sensor kinase	NA	NA	NA	NA	NA
AVG10958.1|507902_508349_-	Two-component response regulator YkoH-like protein	NA	A0A0K2CZQ0	Paenibacillus_phage	96.8	7.7e-11
AVG10959.1|508376_509600_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10960.1|509684_510455_+	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
AVG10961.1|510441_512319_+	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVG10962.1|512362_513586_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10963.1|513650_513785_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG10964.1|514336_514591_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	95.3	4.5e-40
AVG10965.1|514721_515096_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	97.6	1.2e-65
AVG10966.1|515576_517559_+	peptidoglycan-N-acetylmuramate O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.2	2.9e-41
AVG10967.1|517575_518079_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10968.1|518520_518841_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	99.1	1.2e-50
AVG10969.1|518978_519731_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	6.4e-135
AVG10970.1|519807_520098_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10971.1|520338_520938_-	putative beta-lactamase	NA	NA	NA	NA	NA
AVG10972.1|521326_522223_+	Major membrane immunogen, membrane-anchored lipoprotein	NA	NA	NA	NA	NA
AVG10973.1|522368_524246_+	NADH dehydrogenase Ndh	NA	NA	NA	NA	NA
AVG10974.1|524371_524821_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10975.1|524836_525814_+	heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
AVG10976.1|526474_527308_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG10977.1|527791_528091_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	52.7	1.2e-23
AVG10978.1|527971_528325_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10979.1|528800_530024_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10980.1|530171_530435_+	lethal factor domain protein	NA	NA	NA	NA	NA
AVG10981.1|530530_530968_+	toxin-like protein	NA	NA	NA	NA	NA
AVG10982.1|531079_532303_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG10983.1|532614_532752_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVG10984.1|533448_535158_-|tRNA	arginine--tRNA ligase ArgS	tRNA	A0A2I2L3K1	Orpheovirus	32.3	3.1e-76
AVG10985.1|535700_536372_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.5e-66
AVG10986.1|536368_536854_+	queuosine biosynthesis protein QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
AVG10987.1|536846_537584_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
AVG10988.1|537637_538129_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.2e-49
AVG10989.1|538537_539341_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVG10990.1|539465_540908_+	putative dipeptidase YtjP	NA	NA	NA	NA	NA
AVG10991.1|541047_542271_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG10992.1|542560_542962_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVG10993.1|543067_544489_-	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVG10994.1|544724_545273_+	RNA polymerase sigma factor SigW-like protein	NA	NA	NA	NA	NA
AVG10995.1|545256_545877_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10996.1|546683_546788_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10997.1|546881_547394_+	Double zinc ribbon	NA	NA	NA	NA	NA
AVG10998.1|547805_548438_+	regulatory protein TenI	NA	NA	NA	NA	NA
AVG10999.1|548421_549234_+	FAD-dependent glycine oxidase-like protein	NA	NA	NA	NA	NA
AVG11000.1|549290_549494_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVG11001.1|549495_550296_+	thiazole synthase ThiG	NA	NA	NA	NA	NA
AVG11002.1|550292_551219_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ThiD	NA	NA	NA	NA	NA
AVG11003.1|551190_551337_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11004.1|551356_551617_+	Thiamine-phosphate synthase	NA	NA	NA	NA	NA
AVG11005.1|553544_553781_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11006.1|553885_555109_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11007.1|555307_555436_+	putative transposon DNA-invertase Bin3	NA	NA	NA	NA	NA
AVG11008.1|555464_555875_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.2	2.7e-10
AVG11009.1|556665_556833_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVG11010.1|556861_556963_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11011.1|557197_557575_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVG11012.1|558320_558440_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVG11013.1|558433_559129_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.3	7.8e-18
AVG11014.1|559125_559482_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11015.1|559846_561820_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11016.1|562160_562763_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	51.0	2.5e-44
AVG11017.1|562936_563626_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG11018.1|563736_564042_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11019.1|564366_565356_+	outer membrane protein RomA	NA	NA	NA	NA	NA
AVG11020.1|565531_566668_-	PBS lyase HEAT-like repeat protein	NA	NA	NA	NA	NA
AVG11021.1|566686_566788_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11022.1|566945_567530_-	guanylate kinase-like protein	NA	A0A0K2FM14	Brevibacillus_phage	27.8	2.9e-10
AVG11023.1|568083_569076_+	cytochrome c oxidase subunit 2	NA	NA	NA	NA	NA
AVG11024.1|569202_571689_+	cytochrome c oxidase subunit 1	NA	NA	NA	NA	NA
AVG11025.1|571693_572008_+	cytochrome C oxidase subunit IV	NA	NA	NA	NA	NA
AVG11026.1|572134_573001_+	putative cytochrome c oxidase assembly factor CtaG	NA	NA	NA	NA	NA
AVG11027.1|573234_573453_+|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVG11028.1|573620_574844_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11029.1|575792_576698_+	ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
AVG11030.1|576690_577959_+	putative membrane protein	NA	NA	NA	NA	NA
AVG11031.1|578293_579931_+	L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AVG11032.1|580155_580953_-	multidrug resistance protein	NA	NA	NA	NA	NA
AVG11033.1|580953_581439_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVG11034.1|581681_582800_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	NA	NA	NA	NA
AVG11035.1|582792_584016_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11036.1|584043_585438_+|transposase	transposase	transposase	A0A2I7SCM7	Paenibacillus_phage	96.9	4.9e-11
AVG11037.1|585486_586665_-	cystathionine beta-lyase PatB	NA	NA	NA	NA	NA
AVG11038.1|586847_587654_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG11039.1|588101_588935_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11040.1|589062_590301_+	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVG11041.1|590783_591353_+	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVG11042.1|591622_591919_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG11043.1|591939_593163_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 5
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	596280	637430	4023351	holin,transposase,lysis	Paenibacillus_phage(46.15%)	48	NA	NA
AVG11048.1|596280_597504_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11049.1|597734_597986_+	Sigma-O factor regulatory protein RsoA	NA	NA	NA	NA	NA
AVG11050.1|598605_599010_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
AVG11051.1|599366_599792_+	putative toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
AVG11052.1|599793_600165_+	transcriptional regulator, ArsR family	NA	NA	NA	NA	NA
AVG11053.1|600425_600743_+	methylated-DNA-protein- cysteinemethyltransferase	NA	NA	NA	NA	NA
AVG11054.1|600893_601118_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11055.1|601699_602185_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11056.1|602595_603078_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11057.1|603985_605026_+	putative oxidoreductase YvaA	NA	NA	NA	NA	NA
AVG11058.1|605303_606365_+	glyceraldehyde-3-phosphate dehydrogenase 2	NA	NA	NA	NA	NA
AVG11059.1|606488_607079_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVG11060.1|607144_608362_+	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVG11061.1|608619_609603_+	Homoserine kinase	NA	NA	NA	NA	NA
AVG11062.1|609934_610837_+	carboxylate/amino acid/amine transporter	NA	NA	NA	NA	NA
AVG11063.1|610833_611625_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11064.1|612024_612756_+	glyoxalase family protein	NA	NA	NA	NA	NA
AVG11065.1|612806_613289_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11066.1|613362_613884_-	putative cell-wall hydrolase	NA	NA	NA	NA	NA
AVG11067.1|614041_615421_-	sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	32.4	5.7e-20
AVG11068.1|615410_616112_-	response regulator ArlR	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
AVG11069.1|616313_617066_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	9.3e-134
AVG11070.1|617203_617887_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVG11071.1|617979_618573_-	undecaprenyl-diphosphatase BcrC	NA	NA	NA	NA	NA
AVG11072.1|618821_619529_+	ABC-type transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.2e-15
AVG11073.1|619574_619763_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG11074.1|620075_621089_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	30.6	1.3e-18
AVG11075.1|621346_621436_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11076.1|621544_622057_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG11077.1|622129_622498_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11078.1|622596_623820_-	tricarballylate dehydrogenase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.0e-28
AVG11079.1|623864_624887_-	Ser/Thr phosphatase family protein	NA	NA	NA	NA	NA
AVG11080.1|625026_625713_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11081.1|625972_626263_+	putative membrane protein	NA	NA	NA	NA	NA
AVG11082.1|626317_626983_+	phage shock protein A, PspA	NA	NA	NA	NA	NA
AVG11083.1|626989_627508_+	phage shock protein C, PspC	NA	NA	NA	NA	NA
AVG11084.1|627510_628233_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
AVG11085.1|628350_629217_+	prolipoprotein diacylglyceryl transferase Lgt	NA	NA	NA	NA	NA
AVG11086.1|629220_629574_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11087.1|629715_630147_+	bacillithiol system oxidoreductase, YphP/YqiW family	NA	NA	NA	NA	NA
AVG11088.1|630593_631400_+	NH(3)-dependent NAD(+) ligase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
AVG11089.1|631604_632531_+	putative ABC transporter ATP-binding protein YhcH	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
AVG11090.1|632514_633429_+	putative membrane protein	NA	NA	NA	NA	NA
AVG11091.1|633523_633916_+	holo-[acyl-carrier-protein] synthase AcpS	NA	NA	NA	NA	NA
AVG11092.1|633994_634483_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11093.1|634665_635889_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11094.1|636057_636186_+	site-specific recombinase XerD	NA	NA	NA	NA	NA
AVG11095.1|636206_637430_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
>prophage 6
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	646413	706018	4023351	holin,transposase,coat,lysis	Paenibacillus_phage(72.0%)	58	NA	NA
AVG11107.1|646413_647637_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11108.1|647862_648435_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11109.1|648615_649449_+	FeS assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
AVG11110.1|649516_650812_+	FeS assembly protein SufD	NA	NA	NA	NA	NA
AVG11111.1|650808_652035_+	putative cysteine desulfurase Csd	NA	Q2XUY6	environmental_halophage	46.2	2.1e-111
AVG11112.1|652021_652459_+	SUF system FeS assembly protein, NifU family	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
AVG11113.1|652483_653881_+	FeS cluster assembly protein SufB	NA	NA	NA	NA	NA
AVG11114.1|654458_655682_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11115.1|655743_656091_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11116.1|656361_656541_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11117.1|656559_657294_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11118.1|658503_658905_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVG11119.1|659180_659843_+	phage structural protein	NA	A0A2I7SC02	Paenibacillus_phage	46.7	5.1e-11
AVG11120.1|660308_660548_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
AVG11121.1|660544_661216_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	97.3	3.9e-131
AVG11122.1|661296_661539_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	90.0	6.2e-31
AVG11123.1|662188_662302_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVG11124.1|662328_662487_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVG11125.1|662525_663254_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG11126.1|663366_663639_+	hypothetical protein	NA	J7KJ12	Streptococcus_phage	47.9	1.1e-07
AVG11127.1|663743_664967_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	3.1e-227
AVG11128.1|665089_665848_+	cell wall-associated hydrolase	NA	NA	NA	NA	NA
AVG11129.1|665854_667078_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11130.1|667248_667485_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.7	2.2e-33
AVG11131.1|667526_668321_+|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	98.5	1.5e-145
AVG11132.1|668707_669034_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11133.1|669794_670838_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11134.1|670857_671163_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11135.1|671525_671924_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11136.1|672012_673236_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11137.1|673512_674481_-	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVG11138.1|674590_675814_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11139.1|676033_676366_-	putative membrane protein	NA	NA	NA	NA	NA
AVG11140.1|676558_677527_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11141.1|677711_679127_+	putative metallophosphoesterase YunD	NA	NA	NA	NA	NA
AVG11142.1|679271_680123_+	undecaprenyl-diphosphatase UppP	NA	NA	NA	NA	NA
AVG11143.1|680487_681711_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11144.1|681886_683011_+	radical SAM domain protein	NA	NA	NA	NA	NA
AVG11145.1|683063_684434_+	Magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVG11146.1|684597_685350_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	9.3e-134
AVG11147.1|685487_686171_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
AVG11148.1|686351_686564_+|coat	Spore coat associated protein JA (CotJA)	coat	NA	NA	NA	NA
AVG11149.1|686836_687103_+|coat	spore coat peptide assembly protein	coat	NA	NA	NA	NA
AVG11150.1|687144_687714_+	protein CotJC	NA	NA	NA	NA	NA
AVG11151.1|688106_688403_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
AVG11152.1|688632_689538_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVG11153.1|690741_690939_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11154.1|691430_692654_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
AVG11155.1|693081_694275_-	Collagen triple helix repeat (20 copies)	NA	NA	NA	NA	NA
AVG11156.1|696763_697321_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11157.1|697338_697848_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11158.1|698060_698501_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11159.1|700115_700295_-	dTDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
AVG11160.1|700291_701014_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	H9NC64	Sphingomonas_phage	41.0	7.8e-45
AVG11161.1|701994_702885_+	3D domain protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
AVG11162.1|702980_703991_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG11163.1|704427_705303_+	putative endopeptidase LytE	NA	D2KRB9	Lactobacillus_phage	33.0	2.6e-10
AVG11164.1|705619_706018_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 7
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	717998	773367	4023351	holin,transposase	Paenibacillus_phage(33.33%)	48	NA	NA
AVG11176.1|717998_719222_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11177.1|719358_720531_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVG11178.1|720639_720942_+	putative membrane protein	NA	NA	NA	NA	NA
AVG11179.1|721496_721673_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11180.1|721718_722942_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11181.1|723154_723364_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11182.1|723572_724796_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11183.1|724919_725867_+	spermidine/putrescine import ATP-binding protein potA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
AVG11184.1|725882_726659_+	putative pleiotropic drug resistance protein	NA	NA	NA	NA	NA
AVG11185.1|726655_727642_+	ABC-2 type transport system permease protein PotC	NA	NA	NA	NA	NA
AVG11186.1|727702_730321_+	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
AVG11187.1|730438_731053_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
AVG11188.1|731312_731423_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11189.1|731716_732721_+	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
AVG11190.1|732766_733741_+	Glucosamine kinase GspK	NA	NA	NA	NA	NA
AVG11191.1|733746_735048_+	putative 6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVG11192.1|735458_736619_+|holin	glycine betaine/carnitine/choline transport ATP-binding protein OpuCA	holin	G3M9Y6	Bacillus_virus	33.6	9.0e-27
AVG11193.1|736615_737272_+|holin	choline transport system permease protein OpuBB	holin	NA	NA	NA	NA
AVG11194.1|737288_738182_+|holin	choline-binding protein	holin	NA	NA	NA	NA
AVG11195.1|738225_738855_+|holin	glycine betaine/carnitine/choline transport system permease protein OpuCD	holin	NA	NA	NA	NA
AVG11196.1|739135_739564_+	Acetyltransferase YpeA	NA	NA	NA	NA	NA
AVG11197.1|739844_740432_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11198.1|740460_741630_+	putative iron-sulfur cluster binding protein	NA	NA	NA	NA	NA
AVG11199.1|741700_742735_+	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVG11200.1|742934_744158_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11201.1|744231_744441_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11202.1|744796_745387_+	GTP cyclohydrolase 1	NA	E7DN69	Pneumococcus_phage	54.4	5.5e-49
AVG11203.1|745607_746888_-	putative superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.8	8.1e-37
AVG11204.1|746961_747993_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11205.1|748330_749074_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11206.1|749181_750153_+	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVG11207.1|750312_753012_-	aconitate hydratase Acn	NA	NA	NA	NA	NA
AVG11208.1|753354_754374_+	two-component response regulator	NA	NA	NA	NA	NA
AVG11209.1|754396_755518_+	D-alanine--D-alanine ligase Ddl	NA	NA	NA	NA	NA
AVG11210.1|755641_755830_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11211.1|756030_757059_+	UV DNA damage endonuclease UvsE	NA	A0A2I2L3D9	Orpheovirus	27.5	7.7e-22
AVG11212.1|757247_758018_+	enoyl-[acyl-carrier-protein] reductase [NADH] FabI	NA	NA	NA	NA	NA
AVG11213.1|758151_758445_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11214.1|758952_759807_+	inositol-1-monophosphatase SuhB	NA	NA	NA	NA	NA
AVG11215.1|759910_760327_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AVG11216.1|760487_761492_+	biotin synthase BioB	NA	NA	NA	NA	NA
AVG11217.1|761567_766079_-	glutamate synthase [NADPH] large chain GltA	NA	NA	NA	NA	NA
AVG11218.1|766604_767918_-	glutamate-1-semialdehyde 2,1-aminomutase 1	NA	NA	NA	NA	NA
AVG11219.1|768009_769035_-	transcriptional regulator LytR	NA	NA	NA	NA	NA
AVG11220.1|769584_770055_+	peroxiredoxin-like protein	NA	NA	NA	NA	NA
AVG11221.1|770346_771702_+	putative polysaccharide deacetylase YheN	NA	NA	NA	NA	NA
AVG11222.1|771839_772466_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	53.8	2.7e-54
AVG11223.1|772692_773367_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	4.0e-35
>prophage 8
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	780289	846397	4023351	transposase,protease,integrase	Paenibacillus_phage(26.09%)	54	834175:834234	845053:846441
AVG11229.1|780289_781513_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11230.1|781685_781859_+	helix-turn-helix family protein	NA	NA	NA	NA	NA
AVG11231.1|781876_782908_-	vancomycin/teicoplanin A-type resistance protein VanA	NA	NA	NA	NA	NA
AVG11232.1|782900_783320_-	putative lactate dehydrogenase VanHE	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	42.9	2.5e-19
AVG11233.1|783600_784824_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11234.1|785158_786553_+	putative permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	1.9e-47
AVG11235.1|793239_794463_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11236.1|794540_795548_-	HTH-type transcriptional regulator DegA	NA	NA	NA	NA	NA
AVG11237.1|795741_796545_-	5-deoxy-glucuronate isomerase IolB	NA	NA	NA	NA	NA
AVG11238.1|796593_797613_-	oxidoreductase domain protein	NA	NA	NA	NA	NA
AVG11239.1|797966_799001_+	5-dehydro-2-deoxygluconokinase IolC	NA	NA	NA	NA	NA
AVG11240.1|799019_800471_+	methylmalonate semialdehyde dehydrogenase [acylating] 3	NA	NA	NA	NA	NA
AVG11241.1|800483_802418_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase	NA	NA	NA	NA	NA
AVG11242.1|802512_803409_+	inosose dehydratase 2	NA	NA	NA	NA	NA
AVG11243.1|803435_804503_+	Myo-inositol 2-dehydrogenase IolG	NA	NA	NA	NA	NA
AVG11244.1|804542_804983_+	putative symporter YidK	NA	NA	NA	NA	NA
AVG11245.1|805097_806321_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11246.1|806586_807525_+	putative symporter YidK	NA	NA	NA	NA	NA
AVG11247.1|807639_808617_+	nitrilase Nit	NA	NA	NA	NA	NA
AVG11248.1|809165_809657_+	N5-carboxyaminoimidazole ribonucleotide mutase PurE	NA	A0A2P0VNU7	Tetraselmis_virus	48.9	1.1e-21
AVG11249.1|809653_810949_+	N5-carboxyaminoimidazole ribonucleotide synthase PurK	NA	NA	NA	NA	NA
AVG11250.1|811016_812312_+	adenylosuccinate lyase PurB	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
AVG11251.1|812385_813270_+	phosphoribosylaminoimidazole-succinocarboxamide synthase PurC	NA	A0A0M4JBD3	Mollivirus	33.9	1.1e-37
AVG11252.1|813360_813603_+	phosphoribosylformylglycinamidine synthase PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	7.4e-08
AVG11253.1|813676_814372_+	phosphoribosylformylglycinamidine synthase 1	NA	NA	NA	NA	NA
AVG11254.1|814349_816593_+	phosphoribosylformylglycinamidine synthase 2	NA	A6N228	Microbacterium_phage	44.4	5.9e-168
AVG11255.1|816577_818152_+	amidophosphoribosyltransferase PurF	NA	A0A0M3SGR2	Mollivirus	31.6	1.5e-48
AVG11256.1|818246_819293_+	phosphoribosylformylglycinamidine cyclo-ligase PurM	NA	Q58MH8	Prochlorococcus_phage	44.7	3.3e-68
AVG11257.1|819289_819913_+	phosphoribosylglycinamide formyltransferase PurN	NA	M4QRX9	Synechococcus_phage	38.3	7.0e-26
AVG11258.1|820123_821671_+	bifunctional purine biosynthesis protein PurH	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
AVG11259.1|821689_822970_+	phosphoribosylamine--glycine ligase PurD	NA	NA	NA	NA	NA
AVG11260.1|824056_824539_+	NTP pyrophosphohydrolase-like protein	NA	NA	NA	NA	NA
AVG11261.1|824865_825300_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11262.1|825407_826481_-	putative lipoprotein YerB	NA	NA	NA	NA	NA
AVG11263.1|826821_827106_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11264.1|827679_827970_+	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVG11265.1|828137_828926_+	sirohydrochlorin cobaltochelatase CbiX	NA	NA	NA	NA	NA
AVG11266.1|829075_830020_+	diacylglycerol kinase DagK	NA	NA	NA	NA	NA
AVG11267.1|830016_831594_+	23S rRNA (uracil-C(5))-methyltransferase RlmCD	NA	A0A2K5B251	Erysipelothrix_phage	38.1	2.1e-95
AVG11268.1|831791_834068_-	phage related protein	NA	NA	NA	NA	NA
834175:834234	attL	TAGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATT	NA	NA	NA	NA
AVG11269.1|834295_835519_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11270.1|835683_836346_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG11271.1|836371_837040_+	DNA polymerase I - 3'-5' exonuclease	NA	A0A2K5B2B0	Erysipelothrix_phage	77.0	5.1e-99
AVG11272.1|837133_837607_+	putative phage antirepressor protein	NA	O48391	Streptococcus_phage	68.8	6.9e-18
AVG11273.1|837850_838210_+|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVG11274.1|838266_838449_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11275.1|838618_840613_-	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	1.3e-12
AVG11276.1|840797_841034_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11277.1|841216_841501_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVG11278.1|841797_842070_+	transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AVG11279.1|842066_843077_+|protease	intracellular serine protease	protease	A0A2H4PQH1	Staphylococcus_phage	28.6	9.9e-22
AVG11280.1|843092_843791_+	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
AVG11281.1|843796_844951_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG11282.1|845173_846397_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
845053:846441	attR	TAGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTCATAGCCCTCAGTTAGAATAATGTTGGGACACAAAATTCTAAATATACGAGGTGTTATGAAATGGCTCAATACCAGATTAACGTAGATTCGCAGCTTTTGCATCAACTATTTTTGGGAAATTCTCAGGATGCGGGTGTAGCCAAGCTGCTCGAGTCTGTACTGAACCAAGTCTTACAAGCACAGGTGAGTGAACAAGTGGAAGCAGATCGTTATGAACGAACAGAGAATCGAAAAGCGTACCGGAATGGATCGTATCCACATGGGCTGCATACGCGGGTGGGAACCATTACACTAAGTGTTCCGCGCATCCGTGGCGGGAAGTTCACGACAGAGCTCTTTAGTCGTTACCAGAGAAGTGAACAAGCGTTAATCTTAGCGATGATGGAAATGGTCGTAAACGGCGTCTCTACGCGTAAAGTCTCGCAAGTAACCGAAGAACTCTGCGGAACCGAGTTTTCTAAATCCACTGTTTCAGACCTTTGTAAGCGGCTGGATCCCATCGTAACTGCTTGGAATAATCGAAGCCTGGCAGACAGCCTCTTTCCGTTTGTTCTCGTAGATGCGATGTATCTCAAGGTCCGTGAAGACGGTCGTGTACGCTCACGAGGCATCATGATTGCCATTGGTGTAAACACCGAGGGCTATCGTGAAGTCCTTGGCCTGATGCTGGGTGACACAGAATCTGAAGCAAGCTGGAGTGAGTTTTTCAGCTCTCTAAAAGGACGTGGATTACGAGGTGTGGATCTCATTACCTCCGACGATCATGGCGGCCTTGTACGCGCGGTACGGCAGCAGCTGCAAGGGGTAACATGGCAGCGATGCCAGACTCACTTCACGCGAAATGTATTAGAAGCCTCACCCAAAGCCTTGAAGGATGAGATCCATGGCCGTCTACGGTCGATTCTAGATGCTCCTGATACTGGAACGGCAAGGTTTTTATTAAAACAGACCTTAGCGGCTTATGAAGATAAGGCGGGTAAGGCGATGGGCGTGCTGGAAAGCGGATTTGACGATGCTACCGCCGTCTTAATGCTGCCAGAGCGTTACCGAAAACGGCTGCGCACGACAAATAGCGTTGAGCGTCTCAACGAAGAGGTTAGACGCCGGGAACGTGTCATTCGCATCTTCCCAAACCGTGAATCCGTGATTCGTCTTATTGGTGCTCTATTGATGGAACAGGATGAAAAATGGGCAGCCGGCAAGAAATATCTCGACATGACCGAGTACATGGAATGGCGGAAGGATCGGCCAAAGTCCGATGCCAAAGTGACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATC	NA	NA	NA	NA
>prophage 9
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	853371	902650	4023351	transposase	Paenibacillus_phage(54.55%)	46	NA	NA
AVG11288.1|853371_854595_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11289.1|854659_854779_+	putative phage DNA-binding protein	NA	NA	NA	NA	NA
AVG11290.1|855004_856111_-	filamentation induced by cAMP protein Fic	NA	NA	NA	NA	NA
AVG11291.1|856447_857395_+	export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
AVG11292.1|857571_858726_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG11293.1|858731_859151_+	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVG11294.1|859147_860098_+	malonyl-CoA-[acyl-carrier-protein] transacylase	NA	NA	NA	NA	NA
AVG11295.1|860090_860837_+	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
AVG11296.1|861046_862270_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11297.1|862355_862643_+	acyl carrier protein	NA	NA	NA	NA	NA
AVG11298.1|862649_863138_+	(3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AVG11299.1|863134_865933_+	putative acetyltransferase	NA	NA	NA	NA	NA
AVG11300.1|865961_866519_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11301.1|866536_867046_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11302.1|867095_868142_+	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVG11303.1|868153_870601_+	3-oxoacyl-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AVG11304.1|870788_871001_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11305.1|870961_871534_+	toxin-like protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.2	4.3e-30
AVG11306.1|871586_871778_+	toxin-like protein	NA	NA	NA	NA	NA
AVG11307.1|871899_873249_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.8	9.7e-49
AVG11308.1|873464_874688_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11309.1|875147_875360_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11310.1|875520_875721_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
AVG11311.1|875911_876508_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11312.1|876609_877818_-	alcohol dehydrogenase GbsB	NA	NA	NA	NA	NA
AVG11313.1|877837_879310_-	betaine aldehyde dehydrogenase GbsA	NA	NA	NA	NA	NA
AVG11314.1|879374_879593_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVG11315.1|879657_880881_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11316.1|881180_881516_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG11317.1|881833_882640_+	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AVG11318.1|882775_882907_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11319.1|883319_884807_+	phosphohydrolase	NA	NA	NA	NA	NA
AVG11320.1|884799_886023_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG11321.1|887775_888999_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11322.1|889295_889769_+	Viral enhancin protein	NA	NA	NA	NA	NA
AVG11323.1|890414_891143_-	Endo-1,4-beta-xylanase Z precursor	NA	NA	NA	NA	NA
AVG11324.1|891328_892441_+	pyruvate dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AVG11325.1|892490_893471_+	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVG11326.1|893538_894837_+	pyruvate dehydrogenase E2 dihydrolipoamide acyltransferase component	NA	NA	NA	NA	NA
AVG11327.1|894841_896257_+	dihydrolipoyl dehydrogenase PdhD	NA	NA	NA	NA	NA
AVG11328.1|896501_897242_+	glycerophosphodiester phosphodiesterase-like protein	NA	NA	NA	NA	NA
AVG11329.1|897267_898245_+	glycerate dehydrogenase HprA	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	33.3	2.9e-26
AVG11330.1|898231_899137_-	phospholipid kinase-like protein	NA	NA	NA	NA	NA
AVG11331.1|899500_899833_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11332.1|901568_902078_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG11333.1|902095_902650_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	969818	1055777	4023351	terminase,tRNA,coat,integrase,transposase	Paenibacillus_phage(62.5%)	111	963365:963379	1044323:1045711
963365:963379	attL	ATTCCGTTTATTTTT	NA	NA	NA	NA
AVG11405.1|969818_972263_+|tRNA	leucine--tRNA ligase LeuS	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.7	0.0e+00
963365:963379	attL	ATTCCGTTTATTTTT	NA	NA	NA	NA
AVG11406.1|972266_973094_-	ComE operon protein 4	NA	NA	NA	NA	NA
AVG11407.1|973262_973796_+	membrane bound high-affinity DNA-binding receptor-like protein	NA	NA	NA	NA	NA
AVG11408.1|973894_975187_+	methionine gamma-lyase MdeA	NA	A0A0B5JD48	Pandoravirus	27.8	8.5e-18
AVG11409.1|975212_975725_+	DNA transport-associated-like protein	NA	A0A222YXY3	Mycobacterium_phage	44.9	3.5e-23
AVG11410.1|975866_977681_+	DNA internalization competence protein ComEC/Rec2-like protein	NA	NA	NA	NA	NA
AVG11411.1|977692_978925_-|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	75.1	4.8e-180
AVG11412.1|978992_979718_-	transcriptional regulator-like protein	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
AVG11413.1|979992_980202_+	putative phage protein	NA	Q786F1	Bacillus_phage	44.3	6.3e-08
AVG11414.1|980341_981166_+	putative antirepressor, phage associated	NA	A0A0C5AFE7	Paenibacillus_phage	94.7	1.1e-130
AVG11415.1|981374_981635_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11416.1|981611_981767_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11417.1|981967_982345_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.8e-59
AVG11418.1|982341_982563_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	91.8	5.6e-31
AVG11419.1|982700_982934_+	transition state regulatory protein AbrB	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
AVG11420.1|982963_983128_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11421.1|983156_983912_+	putative prophage antirepressor	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
AVG11422.1|983908_984217_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11423.1|984252_984441_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11424.1|984437_985214_+	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	73.8	1.8e-55
AVG11425.1|985228_985420_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11426.1|985456_985720_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.3	2.2e-13
AVG11427.1|985727_986159_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	53.7	8.5e-07
AVG11428.1|986155_986734_+	putative sporulation protein YyaC	NA	G3M9W0	Bacillus_virus	41.2	1.2e-24
AVG11429.1|986803_988432_+	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	76.6	3.8e-225
AVG11430.1|988435_989260_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.8	1.9e-87
AVG11431.1|989240_990053_+	phage related protein	NA	R9TMF6	Paenibacillus_phage	68.9	5.4e-111
AVG11432.1|990068_990401_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	98.2	5.3e-57
AVG11433.1|990449_991337_+	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	100.0	8.1e-153
AVG11434.1|991299_992049_+	phage-related protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.6	4.5e-120
AVG11435.1|992050_992161_+	hypothetical protein	NA	A0A0K2CYR7	Paenibacillus_phage	91.7	3.5e-10
AVG11436.1|992167_992377_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	5.0e-29
AVG11437.1|992378_992753_+	endodeoxyribonuclease RUS	NA	A0A0K2CYQ8	Paenibacillus_phage	66.1	7.6e-44
AVG11438.1|992759_992867_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11439.1|992943_993309_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	86.0	1.5e-57
AVG11440.1|993323_993845_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11441.1|993841_994585_+	adenine-specific DNA methylase-like protein	NA	A0A0E3IAX4	Synechococcus_phage	52.4	6.7e-68
994487:994501	attR	AAAAATAAACGGAAT	NA	NA	NA	NA
AVG11442.1|994678_994987_+	hypothetical protein	NA	NA	NA	NA	NA
994487:994501	attR	AAAAATAAACGGAAT	NA	NA	NA	NA
AVG11443.1|995449_995620_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11444.1|995588_995939_+	positive control sigma-like factor	NA	A0A0K2CNQ1	Brevibacillus_phage	57.6	1.1e-23
AVG11445.1|996261_996465_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.9e-26
AVG11446.1|996528_996702_+	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	59.6	5.6e-10
AVG11447.1|996736_996904_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11448.1|996962_997703_+|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	47.5	1.4e-44
AVG11449.1|997695_998853_+|terminase	phage-related terminase-like protein large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	64.2	1.9e-138
AVG11450.1|998845_1000069_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11451.1|1000675_1000816_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11452.1|1000805_1000907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11453.1|1000906_1002163_-	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	35.6	1.4e-62
AVG11454.1|1002402_1003362_+	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	89.9	2.6e-112
AVG11455.1|1003376_1003739_+	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	79.2	6.4e-48
AVG11456.1|1004207_1005431_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11457.1|1005495_1006071_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVG11458.1|1006189_1007413_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11459.1|1007541_1007841_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVG11460.1|1008094_1008619_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11461.1|1008746_1010279_-	NADH dehydrogenase AhpF	NA	A0A2I2L5E1	Orpheovirus	32.7	4.3e-37
AVG11462.1|1010287_1010851_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AVG11463.1|1010994_1011162_-	Virus attachment protein p12 family protein	NA	NA	NA	NA	NA
AVG11464.1|1011175_1011556_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVG11465.1|1011749_1012973_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11466.1|1013322_1013526_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
AVG11467.1|1013544_1013847_+|coat	Spore coat protein F precursor	coat	NA	NA	NA	NA
AVG11468.1|1014728_1015049_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVG11469.1|1015048_1015867_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVG11470.1|1016051_1016405_+	putative propanediol utilization protein	NA	NA	NA	NA	NA
AVG11471.1|1016416_1016818_+	putative ethanolamine/propanediol utilization protein	NA	NA	NA	NA	NA
AVG11472.1|1017082_1017655_+	response regulator-like protein	NA	NA	NA	NA	NA
AVG11473.1|1017647_1019072_+	putative sensor histidine kinase	NA	NA	NA	NA	NA
AVG11474.1|1019212_1019950_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AVG11475.1|1020042_1020642_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AVG11476.1|1020671_1022036_+	ethanolamine ammonia-lyase heavy chain EutB	NA	NA	NA	NA	NA
AVG11477.1|1022057_1023008_+	ethanolamine ammonia-lyase light chain EutC	NA	NA	NA	NA	NA
AVG11478.1|1023026_1023680_+	ethanolamine utilization protein EutL	NA	NA	NA	NA	NA
AVG11479.1|1023691_1024432_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVG11480.1|1024582_1026046_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVG11481.1|1026095_1026383_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVG11482.1|1026527_1027355_+	ethanolamine utilization cobalamin adenosyltransferase EutT	NA	NA	NA	NA	NA
AVG11483.1|1027366_1028005_+	phosphate propanoyltransferase PduL	NA	NA	NA	NA	NA
AVG11484.1|1028023_1028707_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
AVG11485.1|1028719_1028992_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AVG11486.1|1028984_1029530_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AVG11487.1|1029549_1030665_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
AVG11488.1|1031002_1031842_+	methyltransferase type 11	NA	NA	NA	NA	NA
AVG11489.1|1031969_1032134_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11490.1|1032181_1032343_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11491.1|1033495_1033708_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11492.1|1033806_1034268_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	2.0e-22
AVG11493.1|1034264_1034396_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11494.1|1035187_1035490_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11495.1|1035506_1036031_+	putative integral membrane protein	NA	NA	NA	NA	NA
AVG11496.1|1036100_1036514_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11497.1|1036785_1037088_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11498.1|1037473_1037911_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11499.1|1038185_1038824_+	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVG11500.1|1038823_1039006_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11501.1|1039112_1040174_+	selenide, water dikinase	NA	NA	NA	NA	NA
AVG11502.1|1040228_1041281_+|tRNA	tRNA 2-selenouridine synthase SelU	tRNA	NA	NA	NA	NA
AVG11503.1|1041541_1042012_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11504.1|1042074_1042452_+	Gas vesicle protein	NA	NA	NA	NA	NA
AVG11505.1|1043114_1044338_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11506.1|1044621_1045194_-	putative ribosomal-protein-alanine acetyltransferase YjcK	NA	D0R097	Streptococcus_phage	28.3	1.1e-06
AVG11507.1|1045363_1046047_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	32.7	2.6e-18
AVG11508.1|1046815_1048039_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11509.1|1049128_1050427_+	alpha-galactosidase MelA	NA	NA	NA	NA	NA
AVG11510.1|1050728_1050998_-	Exopolysaccharide biosynthesis protein related to N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AVG11511.1|1051175_1051322_+	hypothetical protein	NA	A0A0C5ABC9	Paenibacillus_phage	97.4	3.1e-09
AVG11512.1|1051539_1051737_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	NA	NA	NA	NA
AVG11513.1|1051729_1052953_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11514.1|1053833_1054526_-	ankyrin-repeat containing protein	NA	A0A2I7SC07	Paenibacillus_phage	90.1	8.9e-99
AVG11515.1|1054553_1055777_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
>prophage 11
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1062848	1113724	4023351	transposase,protease,coat	Paenibacillus_phage(40.0%)	54	NA	NA
AVG11525.1|1062848_1064072_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11526.1|1064233_1064581_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11527.1|1064678_1065794_-	permease-like protein	NA	NA	NA	NA	NA
AVG11528.1|1065807_1066560_-	methionine aminopeptidase Map	NA	NA	NA	NA	NA
AVG11529.1|1066817_1067120_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
AVG11530.1|1067119_1067344_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11531.1|1067874_1068948_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11532.1|1069057_1070212_-	putative RNA methyltransferase YpsC	NA	NA	NA	NA	NA
AVG11533.1|1070328_1070964_+	acyl-CoA O-methyltransferase-like protein	NA	NA	NA	NA	NA
AVG11534.1|1071015_1072233_-	multidrug resistance protein MdtG	NA	NA	NA	NA	NA
AVG11535.1|1072430_1073006_+|coat	spore coat protein	coat	NA	NA	NA	NA
AVG11536.1|1073223_1074447_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11537.1|1074474_1075158_+	ankyrin-repeat containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	96.8	6.9e-11
AVG11538.1|1075241_1075982_-	putative N-acetylmannosaminyltransferase TarA	NA	NA	NA	NA	NA
AVG11539.1|1076177_1077032_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11540.1|1077082_1077334_-	guanine/hypoxanthine permease PbuO	NA	NA	NA	NA	NA
AVG11541.1|1077330_1077576_-	guanine/hypoxanthine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	49.1	9.7e-08
AVG11542.1|1077575_1078382_-	guanine/hypoxanthine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	34.7	1.3e-21
AVG11543.1|1078474_1078834_-	putative integral membrane protein	NA	NA	NA	NA	NA
AVG11544.1|1078896_1080687_-	oligoendopeptidase F-like protein	NA	A0A1X9I5X5	Streptococcus_phage	26.8	1.9e-55
AVG11545.1|1081304_1082159_-	integral membrane protein, YjbE family	NA	W8EBD0	Pseudomonas_phage	36.3	1.2e-23
AVG11546.1|1082455_1082689_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11547.1|1082888_1083086_+	cold shock protein CspB	NA	Q9AZD3	Lactococcus_phage	67.7	7.5e-19
AVG11548.1|1083292_1084033_+	putative transcriptional regulatory protein	NA	NA	NA	NA	NA
AVG11549.1|1084090_1084735_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVG11550.1|1085084_1085381_+	serine hydroxymethyltransferase	NA	NA	NA	NA	NA
AVG11551.1|1085648_1086158_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11552.1|1086159_1087239_+	Tetraprenyl-beta-curcumene synthase	NA	NA	NA	NA	NA
AVG11553.1|1087283_1088249_+	6-phosphofructokinase PfkA	NA	NA	NA	NA	NA
AVG11554.1|1088482_1088692_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11555.1|1088724_1089276_+	oxidoreductase NAD-like protein	NA	NA	NA	NA	NA
AVG11556.1|1089685_1091092_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
AVG11557.1|1091075_1092092_+	cytochrome d ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
AVG11558.1|1092091_1093816_+	ATP-binding/permease protein CydC	NA	W8CYL7	Bacillus_phage	24.7	1.5e-25
AVG11559.1|1093812_1095570_+	ATP-binding/permease protein CydD	NA	W8CYL7	Bacillus_phage	26.3	6.3e-24
AVG11560.1|1095667_1095904_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVG11561.1|1096152_1096341_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11562.1|1096485_1097307_-	putative membrane protein	NA	NA	NA	NA	NA
AVG11563.1|1097493_1098717_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11564.1|1098926_1099502_+	putative HTH-type transcriptional regulator YhgD	NA	NA	NA	NA	NA
AVG11565.1|1099799_1100468_-	putative lipoprotein	NA	NA	NA	NA	NA
AVG11566.1|1100496_1101030_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11567.1|1101401_1102919_+	DEAD-box ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.9	2.4e-64
AVG11568.1|1103034_1103754_+	putative integral membrane protein	NA	NA	NA	NA	NA
AVG11569.1|1104213_1104870_+	putative transaldolase Tal	NA	A0A0E3F5V4	Synechococcus_phage	47.7	1.1e-50
AVG11570.1|1104905_1105913_+	fructose-1,6-bisphosphatase class 2	NA	NA	NA	NA	NA
AVG11571.1|1106147_1107299_+	putative manganese transport protein MntH	NA	NA	NA	NA	NA
AVG11572.1|1107536_1108760_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11573.1|1109108_1109498_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11574.1|1109582_1110101_-	putative thiol peroxidase Tpx	NA	NA	NA	NA	NA
AVG11575.1|1110246_1111176_+	HTH-type transcriptional regulator GltC	NA	NA	NA	NA	NA
AVG11576.1|1111193_1111886_-|protease	putative membrane protease YugP	protease	NA	NA	NA	NA
AVG11577.1|1111919_1112327_-	copper efflux transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG11578.1|1112500_1113724_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 12
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1151058	1194569	4023351	transposase	Paenibacillus_phage(23.08%)	52	NA	NA
AVG11613.1|1151058_1151649_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG11614.1|1151740_1152385_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11615.1|1152668_1153892_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11616.1|1154274_1154568_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11617.1|1154888_1155215_+	permease-like protein	NA	NA	NA	NA	NA
AVG11618.1|1155355_1156321_+	manganese-binding lipoprotein MntA	NA	NA	NA	NA	NA
AVG11619.1|1156357_1157089_+	manganese transport system ATP-binding protein MntB	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	1.3e-15
AVG11620.1|1157142_1158075_+	manganese transport system membrane protein MntC	NA	NA	NA	NA	NA
AVG11621.1|1158071_1158953_+	manganese transport system membrane protein MntD	NA	NA	NA	NA	NA
AVG11622.1|1159307_1160633_+	branched-chain amino acid transport system carrier protein BraB	NA	NA	NA	NA	NA
AVG11623.1|1161055_1162279_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11624.1|1162460_1162823_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11625.1|1162991_1163231_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11626.1|1163366_1163639_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11627.1|1163746_1163998_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11628.1|1164034_1164226_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11629.1|1164299_1164656_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVG11630.1|1164751_1165051_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11631.1|1165233_1166664_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AVG11632.1|1166763_1167762_+	2-oxoisovalerate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AVG11633.1|1167780_1168761_+	2-oxoisovalerate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AVG11634.1|1168781_1170143_+	branched-chain alpha-keto acid dehydrogenase component lipoamide acyltransferase	NA	NA	NA	NA	NA
AVG11635.1|1170321_1171446_+	peptidase T	NA	NA	NA	NA	NA
AVG11636.1|1171438_1172062_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	3.7e-35
AVG11637.1|1172254_1172914_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	54.3	2.2e-62
AVG11638.1|1173216_1174173_+	transcriptional regulator LytR-like protein	NA	NA	NA	NA	NA
AVG11639.1|1174192_1174369_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11640.1|1174484_1175039_+	ADP-ribose pyrophosphatase NudF	NA	A0A1S6L1P8	Vibrio_phage	30.8	3.5e-05
AVG11641.1|1175041_1176235_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11642.1|1176467_1177112_+	stage II sporulation protein M	NA	NA	NA	NA	NA
AVG11643.1|1177211_1177697_+	ferric uptake regulation protein Fur	NA	NA	NA	NA	NA
AVG11644.1|1178003_1179125_+	alanine dehydrogenase Ald	NA	NA	NA	NA	NA
AVG11645.1|1179190_1179424_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11646.1|1179520_1180417_+	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.4	4.6e-39
AVG11647.1|1180577_1181753_+	phosphopentomutase DeoB	NA	NA	NA	NA	NA
AVG11648.1|1181821_1182646_+	purine nucleoside phosphorylase 1	NA	Q5YFI9	Singapore_grouper_iridovirus	43.4	6.1e-62
AVG11649.1|1182662_1183520_+	purine nucleoside phosphorylase 1	NA	Q5YBA4	Grouper_iridovirus	38.4	1.4e-53
AVG11650.1|1183769_1184147_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AVG11651.1|1184206_1184443_+	pyrimidine-nucleoside phosphorylase Pdp	NA	A0A0H3UZD4	Geobacillus_virus	70.5	1.3e-09
AVG11652.1|1184492_1185176_-	putative membrane protein	NA	NA	NA	NA	NA
AVG11653.1|1185172_1186066_-	Nod factor export ATP-binding protein I	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	39.8	6.9e-27
AVG11654.1|1186049_1186868_-	putative membrane protein	NA	NA	NA	NA	NA
AVG11655.1|1186842_1187412_-	RNA polymerase, sigma-24 subunit, ECF subfamily	NA	NA	NA	NA	NA
AVG11656.1|1187568_1188747_+	D-alanyl-D-alanine carboxypeptidase DacF	NA	NA	NA	NA	NA
AVG11657.1|1188862_1189222_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
AVG11658.1|1189218_1189674_+	anti-sigma F factor	NA	NA	NA	NA	NA
AVG11659.1|1189685_1190441_+	RNA polymerase sigma-F factor SigF	NA	A0A0A0RV91	Bacillus_phage	54.5	1.0e-63
AVG11660.1|1191280_1191721_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11661.1|1191710_1191812_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11662.1|1192088_1192370_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11663.1|1192362_1193226_+	nitrate reductase alpha chain NarG	NA	NA	NA	NA	NA
AVG11664.1|1193345_1194569_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 13
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1206022	1214111	4023351	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
AVG11673.1|1206022_1207246_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11674.1|1207355_1207793_+	peptidyl-prolyl cis-trans isomerase B	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
AVG11675.1|1208716_1209850_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.6e-52
AVG11676.1|1209853_1210519_+	riboflavin synthase alpha chain RibE	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
AVG11677.1|1210553_1211783_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	8.1e-111
AVG11678.1|1211817_1212288_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
AVG11679.1|1212718_1213501_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	9.7e-09
AVG11680.1|1213466_1214111_+	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 14
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1230139	1280721	4023351	transposase,protease	Paenibacillus_phage(40.0%)	59	NA	NA
AVG11697.1|1230139_1230760_+|protease	CAAX amino terminal protease self- immunity	protease	NA	NA	NA	NA
AVG11698.1|1230765_1230978_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11699.1|1231160_1231460_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11700.1|1231684_1232293_+	adaptor-like protein	NA	NA	NA	NA	NA
AVG11701.1|1232429_1233680_+	NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AVG11702.1|1233720_1234410_+|protease	protease PrsW	protease	NA	NA	NA	NA
AVG11703.1|1234473_1234632_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11704.1|1234811_1236164_+	sporulation protein YpeB	NA	NA	NA	NA	NA
AVG11705.1|1236341_1237565_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11706.1|1237795_1237984_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11707.1|1237990_1239214_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG11708.1|1239372_1239846_+	cyclic diGMP binding-like domain-containing protein	NA	NA	NA	NA	NA
AVG11709.1|1239910_1240153_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11710.1|1240258_1240939_+	cytidylate kinase Cmk	NA	NA	NA	NA	NA
AVG11711.1|1240941_1241526_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVG11712.1|1241666_1242902_+	30S ribosomal S1-like protein	NA	NA	NA	NA	NA
AVG11713.1|1242938_1243988_+	isopentenyl-diphosphate delta-isomerase Fni	NA	NA	NA	NA	NA
AVG11714.1|1244149_1244773_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11715.1|1244772_1245672_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11716.1|1245686_1245866_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11717.1|1245970_1247293_+	ribosome-associated GTPase	NA	NA	NA	NA	NA
AVG11718.1|1247305_1247899_+	glycerol-3-phosphate acyltransferase PlsY	NA	NA	NA	NA	NA
AVG11719.1|1247946_1248993_+	glycerol-3-phosphate dehydrogenase (NAD(P)+)	NA	NA	NA	NA	NA
AVG11720.1|1249073_1249355_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11721.1|1249544_1249844_+	Benzoate 1,2-dioxygenase electron transfer component	NA	NA	NA	NA	NA
AVG11722.1|1250507_1250861_+	Na(+)-translocating NADH-quinone reductase subunit F	NA	NA	NA	NA	NA
AVG11723.1|1250854_1251649_+	putative lipoprotein	NA	NA	NA	NA	NA
AVG11724.1|1252206_1253685_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
AVG11725.1|1253975_1254248_+	DNA-binding protein HU 1	NA	A7KV42	Bacillus_phage	72.2	1.2e-27
AVG11726.1|1254747_1254906_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11727.1|1255006_1255225_+	MtrB-like protein	NA	NA	NA	NA	NA
AVG11728.1|1255356_1255899_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11729.1|1255986_1256850_+	heptaprenyl diphosphate synthase component I-like protein	NA	NA	NA	NA	NA
AVG11730.1|1256861_1257569_+	demethylmenaquinone methyltransferase UbiE	NA	NA	NA	NA	NA
AVG11731.1|1257638_1258517_+	putative 4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG11732.1|1258517_1259117_+	phenolic acid decarboxylase subunit B	NA	NA	NA	NA	NA
AVG11733.1|1259106_1259949_+	putative periplasmic solute-binding protein	NA	NA	NA	NA	NA
AVG11734.1|1259970_1260945_+	heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
AVG11735.1|1260999_1262223_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11736.1|1262449_1262893_+	nucleoside diphosphate kinase Ndk	NA	D2E8E1	Anguillid_herpesvirus	44.3	8.4e-26
AVG11737.1|1263038_1263821_+	chemotaxis protein methyltransferase CheR	NA	NA	NA	NA	NA
AVG11738.1|1263917_1264085_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11739.1|1264262_1265426_+	chorismate synthase AroC	NA	A0A291AU41	Pandoravirus	36.0	3.8e-41
AVG11740.1|1265427_1266534_+	3-dehydroquinate synthase AroB	NA	NA	NA	NA	NA
AVG11741.1|1266536_1266914_+	chorismate mutase AroH	NA	NA	NA	NA	NA
AVG11742.1|1267250_1268807_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
AVG11743.1|1268827_1269874_+	anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	41.8	1.1e-68
AVG11744.1|1269863_1270661_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	42.8	8.3e-48
AVG11745.1|1270707_1271412_+	N-(5'-phosphoribosyl)anthranilate isomerase TrpF	NA	NA	NA	NA	NA
AVG11746.1|1271404_1272601_+	tryptophan synthase beta chain TrpB	NA	NA	NA	NA	NA
AVG11747.1|1272597_1273410_+	tryptophan synthase alpha chain TrpA	NA	NA	NA	NA	NA
AVG11748.1|1273431_1274532_+	histidinol-phosphate aminotransferase HisC	NA	A0A1X6WGT4	Pacmanvirus	28.1	4.0e-24
AVG11749.1|1274528_1275614_+	prephenate dehydrogenase TyrA	NA	NA	NA	NA	NA
AVG11750.1|1275919_1276516_+	putative phosphatase PhoE	NA	NA	NA	NA	NA
AVG11751.1|1276694_1277825_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11752.1|1277883_1278405_+	bacterial transferase hexapeptide repeat protein	NA	NA	NA	NA	NA
AVG11753.1|1278456_1278642_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11754.1|1278714_1279392_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11755.1|1279548_1280721_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.7	5.6e-218
>prophage 15
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1304092	1426642	4023351	tRNA,transposase,protease	Paenibacillus_phage(40.0%)	113	NA	NA
AVG11781.1|1304092_1305643_+|protease	ATP-dependent zinc metalloprotease FtsH 1	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	41.2	1.8e-78
AVG11782.1|1305873_1306746_+	3-hydroxybutyryl-CoA dehydrogenase Hbd	NA	NA	NA	NA	NA
AVG11783.1|1306742_1307948_+	acetate kinase AckA	NA	NA	NA	NA	NA
AVG11784.1|1308021_1309320_+|tRNA	asparagine--tRNA ligase AsnS	tRNA	A0A2P1EMB4	Moumouvirus	30.5	1.3e-61
AVG11785.1|1309344_1310016_+	DNA-remodelling primosomal-like protein	NA	A0A0N7AE27	Bacillus_phage	46.1	8.9e-19
AVG11786.1|1310100_1310769_-	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
AVG11787.1|1310876_1310993_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG11788.1|1311057_1312281_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11789.1|1312356_1313022_-	methylthioribulose-1-phosphate dehydratase MtnB	NA	NA	NA	NA	NA
AVG11790.1|1313035_1313671_-	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase MtnX	NA	NA	NA	NA	NA
AVG11791.1|1313667_1315005_-	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
AVG11792.1|1315008_1315866_-	pyrroline-5-carboxylate reductase 1	NA	NA	NA	NA	NA
AVG11793.1|1316008_1317256_-	gamma-glutamyl phosphate reductase ProA	NA	A0A1X9I5D4	Streptococcus_phage	50.4	8.3e-103
AVG11794.1|1317277_1318399_-	glutamate 5-kinase ProB	NA	A0A1X9I5D0	Streptococcus_phage	43.1	4.4e-79
AVG11795.1|1318820_1319885_-	LL-diaminopimelate aminotransferase DapL	NA	NA	NA	NA	NA
AVG11796.1|1319886_1320015_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11797.1|1320167_1321013_+	nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AVG11798.1|1321083_1321266_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11799.1|1321222_1321444_+	stage II sporulation protein E	NA	W8CYM9	Bacillus_phage	37.1	4.1e-05
AVG11800.1|1321430_1322528_+	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	A0A1V0SGX0	Hokovirus	48.8	3.8e-51
AVG11801.1|1322957_1323380_+	putative protein containing a divergent version of the methyl-accepting chemotaxis-like domain protein	NA	NA	NA	NA	NA
AVG11802.1|1323460_1323796_+	stage II sporulation protein	NA	NA	NA	NA	NA
AVG11803.1|1323816_1324266_+	putative anti-sigma B factor	NA	NA	NA	NA	NA
AVG11804.1|1324262_1325045_+	RNA polymerase sigma-B factor SigB	NA	A0A173GBT3	Bacillus_phage	26.0	1.2e-14
AVG11805.1|1325365_1326274_-	LysR substrate binding domain protein	NA	NA	NA	NA	NA
AVG11806.1|1326421_1327843_+	3-isopropylmalate dehydratase large subunit LeuC	NA	NA	NA	NA	NA
AVG11807.1|1327872_1328481_+	3-isopropylmalate dehydratase small subunit LeuD	NA	NA	NA	NA	NA
AVG11808.1|1328698_1330033_+	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	39.7	1.4e-20
AVG11809.1|1330046_1330634_+	Spore germination protein	NA	NA	NA	NA	NA
AVG11810.1|1330853_1331519_+	putative endonuclease III	NA	NA	NA	NA	NA
AVG11811.1|1331580_1331853_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11812.1|1331906_1335587_+	dynamin family protein	NA	NA	NA	NA	NA
AVG11813.1|1336653_1336938_+	Lipid A export ATP-binding/permease protein MsbA	NA	NA	NA	NA	NA
AVG11814.1|1337258_1338071_+	exported lipase-like protein	NA	NA	NA	NA	NA
AVG11815.1|1338118_1339096_+	bacitracin ABC transporter, ATP-binding protein BcrA	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	4.0e-36
AVG11816.1|1339088_1340081_+	putative membrane protein	NA	NA	NA	NA	NA
AVG11817.1|1340108_1342082_+	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	42.5	1.7e-126
AVG11818.1|1342143_1344603_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	35.0	4.3e-111
AVG11819.1|1344667_1345531_-	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVG11820.1|1345720_1346299_+	putative oxidoreductase	NA	NA	NA	NA	NA
AVG11821.1|1346305_1347529_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11822.1|1347556_1348120_+	putative transcriptional regulatory protein YclJ	NA	A0A0K2CZQ0	Paenibacillus_phage	96.8	4.4e-11
AVG11823.1|1348164_1349097_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVG11824.1|1349116_1350265_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG11825.1|1350282_1351068_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	5.7e-17
AVG11826.1|1351064_1351205_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11827.1|1351236_1351992_-	ABC-type transport system involved in multi-copper enzyme maturation, permease component	NA	NA	NA	NA	NA
AVG11828.1|1352007_1352706_-	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.5	6.4e-12
AVG11829.1|1352702_1353095_-	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVG11830.1|1353282_1353519_-	Bifunctional aspartate aminotransferase and L-aspartate beta-decarboxylase	NA	NA	NA	NA	NA
AVG11831.1|1353757_1353982_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11832.1|1353978_1354509_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11833.1|1356225_1357449_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11834.1|1357682_1366079_+	glycosyltransferase family 36 protein	NA	NA	NA	NA	NA
AVG11835.1|1366387_1367107_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.2	7.8e-130
AVG11836.1|1367087_1367600_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	7.3e-82
AVG11837.1|1367664_1367805_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVG11838.1|1367836_1368175_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11839.1|1368351_1369575_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11840.1|1370370_1370775_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG11841.1|1370785_1371517_-	pseudouridine synthase, RluA family	NA	NA	NA	NA	NA
AVG11842.1|1371520_1372387_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVG11843.1|1372590_1374525_+	1,4-alpha-glucan-branching enzyme	NA	NA	NA	NA	NA
AVG11844.1|1374521_1375670_+	glucose-1-phosphate adenylyltransferase GlgC	NA	NA	NA	NA	NA
AVG11845.1|1375676_1376786_+	glycogen biosynthesis protein GlgD	NA	NA	NA	NA	NA
AVG11846.1|1376816_1378262_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AVG11847.1|1378434_1378569_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11848.1|1378737_1378968_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11849.1|1379106_1380330_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11850.1|1380688_1380979_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG11851.1|1381021_1382245_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11852.1|1382725_1383301_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11853.1|1383430_1383616_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11854.1|1383890_1385495_-	Alpha-galactosidase	NA	NA	NA	NA	NA
AVG11855.1|1385760_1386984_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11856.1|1387152_1387569_+	Nitric oxide dioxygenase	NA	NA	NA	NA	NA
AVG11857.1|1387569_1388376_+	Nitric oxide dioxygenase	NA	NA	NA	NA	NA
AVG11858.1|1388711_1389953_+	arginine deiminase ArcA	NA	NA	NA	NA	NA
AVG11859.1|1389970_1390969_+	ornithine carbamoyltransferase, catabolic	NA	NA	NA	NA	NA
AVG11860.1|1391065_1392481_+	arginine/ornithine antiporter ArcD	NA	NA	NA	NA	NA
AVG11861.1|1392497_1393451_+	carbamate kinase ArcC	NA	NA	NA	NA	NA
AVG11862.1|1393489_1394176_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVG11863.1|1394231_1394729_-	cAMP-binding protein	NA	NA	NA	NA	NA
AVG11864.1|1395222_1395390_+	L-gulono-1,4-lactone dehydrogenase	NA	NA	NA	NA	NA
AVG11865.1|1395463_1395889_-	putative ribosomal protein	NA	NA	NA	NA	NA
AVG11866.1|1396017_1396881_-	copper amine oxidase-like protein	NA	NA	NA	NA	NA
AVG11867.1|1397222_1398254_-	putative membrane protein	NA	NA	NA	NA	NA
AVG11868.1|1398486_1398921_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11869.1|1399026_1399350_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11870.1|1400144_1400411_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11871.1|1400575_1402339_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11872.1|1402653_1403316_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.4e-13
AVG11873.1|1403321_1403483_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11874.1|1403533_1405204_+	HTH-type transcriptional activator Btr	NA	NA	NA	NA	NA
AVG11875.1|1405300_1406278_+	iron-uptake system-binding protein FeuA	NA	NA	NA	NA	NA
AVG11876.1|1406285_1407296_+	iron-uptake system permease protein FeuB	NA	NA	NA	NA	NA
AVG11877.1|1407288_1408317_+	iron-uptake system permease protein FeuC	NA	NA	NA	NA	NA
AVG11878.1|1408499_1409723_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11879.1|1410059_1411241_+	GlcNAc-binding protein A	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
AVG11880.1|1411408_1412245_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AVG11881.1|1412307_1413183_-	ferri-bacillibactin esterase BesA	NA	NA	NA	NA	NA
AVG11882.1|1413330_1414548_-	cytochrome P450	NA	NA	NA	NA	NA
AVG11883.1|1415031_1416912_+	ATP-dependent OLD family endonuclease	NA	NA	NA	NA	NA
AVG11884.1|1416998_1417319_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11885.1|1417688_1417928_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVG11886.1|1417924_1418488_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVG11887.1|1418484_1419717_+	type-1 restriction enzyme StySJI specificity protein HsdS	NA	NA	NA	NA	NA
AVG11888.1|1420448_1420790_+	hypothetical protein	NA	NA	NA	NA	NA
AVG11889.1|1420930_1422154_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG11890.1|1422275_1424357_+	Thioredoxin-related protein	NA	NA	NA	NA	NA
AVG11891.1|1424511_1425243_-	hypothetical protein	NA	NA	NA	NA	NA
AVG11892.1|1425290_1426040_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG11893.1|1426129_1426642_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
>prophage 16
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1543073	1649462	4023351	protease,tRNA,coat,integrase,transposase	Paenibacillus_phage(56.0%)	113	1586387:1586446	1594149:1595536
AVG12011.1|1543073_1544363_-|tRNA	seryl-tRNA ligase SerS	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
AVG12012.1|1545300_1546743_+	lysine-specific permease LysP	NA	NA	NA	NA	NA
AVG12013.1|1547080_1547347_+|coat	inner spore coat-like protein	coat	NA	NA	NA	NA
AVG12014.1|1547734_1548358_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12015.1|1548466_1548685_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12016.1|1549494_1550391_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG12017.1|1550550_1551756_+	efflux transporter-like protein	NA	A0A2H4PQR6	Staphylococcus_phage	45.1	3.1e-99
AVG12018.1|1551827_1552499_-	Yip1 domain protein	NA	NA	NA	NA	NA
AVG12019.1|1552515_1553043_-	integral membrane protein	NA	NA	NA	NA	NA
AVG12020.1|1553039_1553234_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12021.1|1553234_1553987_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.9e-23
AVG12022.1|1553974_1554619_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12023.1|1554851_1556075_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12024.1|1556545_1556980_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12025.1|1557053_1557701_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12026.1|1557856_1558120_+	uridylate kinase-like protein	NA	NA	NA	NA	NA
AVG12027.1|1558343_1559081_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12028.1|1559365_1560655_+	Hemolysin C	NA	NA	NA	NA	NA
AVG12029.1|1561087_1561990_+	phenazine biosynthesis protein PhzF	NA	NA	NA	NA	NA
AVG12030.1|1562410_1562773_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12031.1|1562857_1563637_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVG12032.1|1563725_1564559_+	HAD-superfamily hydrolase	NA	NA	NA	NA	NA
AVG12033.1|1564767_1565202_+	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
AVG12034.1|1565797_1566487_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG12035.1|1566585_1567617_-	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
AVG12036.1|1568016_1569300_+	maltose/maltodextrin-binding protein MalX	NA	NA	NA	NA	NA
AVG12037.1|1569382_1570696_+	putative arabinogalactan oligomer transport system permease protein GanP	NA	NA	NA	NA	NA
AVG12038.1|1570692_1571538_+	putative arabinogalactan oligomer transport system permease protein GanQ	NA	NA	NA	NA	NA
AVG12039.1|1571603_1572020_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12040.1|1572204_1572699_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
AVG12041.1|1572765_1573839_+	putative nitronate monooxygenase	NA	NA	NA	NA	NA
AVG12042.1|1574070_1575351_+	hydroxylamine reductase Hcp	NA	NA	NA	NA	NA
AVG12043.1|1575455_1576679_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12044.1|1576873_1577800_-	UDP-N-acetylenolpyruvoylglucosamine reductase MurB	NA	NA	NA	NA	NA
AVG12045.1|1578012_1578237_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12046.1|1578725_1579088_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12047.1|1579124_1580600_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AVG12048.1|1580790_1581072_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12049.1|1581032_1581743_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	31.5	1.7e-07
AVG12050.1|1581821_1581995_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12051.1|1582106_1582985_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVG12052.1|1583042_1584476_-	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVG12053.1|1584475_1585405_-	1-phosphofructokinase FruK	NA	NA	NA	NA	NA
AVG12054.1|1585575_1586358_+	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
1586387:1586446	attL	GATCAAGTCCAAATTTGTGTGTAAATTCCCTCAGCTAGACTGTGCTACATAATGCGAGTC	NA	NA	NA	NA
AVG12055.1|1586430_1587654_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12056.1|1587718_1587841_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG12057.1|1587837_1588395_+	MutX-like protein	NA	NA	NA	NA	NA
AVG12058.1|1588389_1588794_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVG12059.1|1588786_1589119_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVG12060.1|1589124_1589664_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVG12061.1|1589775_1589898_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12062.1|1589989_1590340_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12063.1|1590701_1591460_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG12064.1|1592191_1592629_-|integrase	putative integrase	integrase	S5MNZ2	Brevibacillus_phage	53.8	1.5e-27
AVG12065.1|1592940_1594164_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12066.1|1594170_1594338_-	Helix-turn-helix domain protein	NA	A0A0K2CZS1	Paenibacillus_phage	93.0	5.2e-13
AVG12067.1|1594536_1596060_+|protease	minor extracellular protease Epr	protease	NA	NA	NA	NA
1594149:1595536	attR	GACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATCCATAACTGGATACGGTAGCCCGGTTTTTCATCTTAAGCATTTCCGCCAATTCATCTTGCGTAAGGCCTTTTTCTTCACGTAATTTTTTAATCCTTAGTCCCATTTGTTTTTTCTCAAGATTATTCAACATTATCACCTTTCAGAAAATTTTCATCAATGGGTGAAAACTCTATGCTTTTTTAGACATTTTTAAAGTTATATTTTAAGTGTAAACGAAAGGAGGATTGATTTTTATGTAGGCACTAAAATGATTAGTCTTACATAGCAATAGGAAATTTAAAGGGATTTATTTGTAATTATATGAAAAGAAAACGAAGGAGAAGAAAAAATGAATAGTAGAACATTAACAGAACAAGATGAATATACCAACCTTATTGTAAAGTTTAAGGATGAGGTACTACAATCTACACCTCTAGTTTTAGAAGAAGAGAATATCTTGACCCAAGGTCATGTTGATTTTTTTAGTGACTTTTCTGGCTTGGAATTTAATCGTCTCATTTTTACAGTATCACCGGAAGATATGATTCAAGATTTGAAAACCTATAACCTACCCAAAGATTTGAGTTTATTTCATTATTATTCGATACAAGTTTCAAAAGATCAAGGAGATCCTCAGTCTATTGTGGACAGACTCAAACAATCTCCTTTTGTTGAAACGGCCTACATTGAAATGCCCCATGTTGAATTTGAAGGGTCGGATTCAGTTATTCCAAAGGACGATCTAACGAAACATGGGGATGTATACGCTCAACCTGATCGTAATCCTCTATTCAAAAAACAAGGGTACCTAAAAGCTGCCCCCCATGGAATTGATGCCCGATATGCATGGACTATACCTGGAGGGGAAGGGGAAGGGGAAGGGATTACCTTTGTAGATATGGAAAATGGTTGGCTGCTGGATCATGAAGATCTAGTCGATCAGCAAATTACGCTCGTTACAGGCAGTATTAACCTTATTGACCAAGCAAGCCACGGTACTGCTGTTTTAGGAGAAGTTGTAGGAACTGATAATGAAATAGGTATTATTGGAGCTTCACCAAAAGCACGAGCAAAAGTAACATCTACAACAAGAGCCAATGGCGTAGGAAGCATGGTCGATGCCATTGTAAGTGCAGTGCATGAGATGACCCCTGGGGATGTTCTTCTACTGGAAATGCAAGTTACGCCAGGAGGTGTCTTGGTTCCAATAGAATATGATCAAGATAAATTTGATGCCATTAAATATGCGGTAAATAAAGGTATTACAGTTGTGGAAGCAGGAGCAAATGGAAGTGTAAACCTGGATACTTTTACAAAGGACGGGAAGTATATTTTCAATCGAAACAGCC	NA	NA	NA	NA
AVG12068.1|1596052_1597276_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12069.1|1597303_1598014_+	putative transcriptional regulatory protein YclJ	NA	A0A2I7SCM7	Paenibacillus_phage	81.6	7.2e-11
AVG12070.1|1598467_1599016_+	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	87.9	1.1e-78
AVG12071.1|1599027_1599288_+	hypothetical protein	NA	A0A2I7SC12	Paenibacillus_phage	86.0	3.8e-34
AVG12072.1|1599660_1599864_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	91.0	1.2e-27
AVG12073.1|1600155_1601568_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	NA	NA	NA	NA
AVG12074.1|1602360_1602603_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12075.1|1602926_1603439_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG12076.1|1603528_1604278_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG12077.1|1604389_1604635_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AVG12078.1|1605044_1605713_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12079.1|1605807_1606674_+	cystine-binding periplasmic protein	NA	NA	NA	NA	NA
AVG12080.1|1607375_1608122_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.6	1.2e-35
AVG12081.1|1608166_1608589_+	peroxiredoxin, OsmC subfamily	NA	NA	NA	NA	NA
AVG12082.1|1608873_1609083_+	cyanate hydratase CynS	NA	NA	NA	NA	NA
AVG12083.1|1609331_1609475_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12084.1|1609508_1610432_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AVG12085.1|1611441_1611636_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12086.1|1611747_1612971_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG12087.1|1613141_1614365_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12088.1|1614591_1615224_+	pyridoxamine 5'-phosphate oxidase, FMN-binding family	NA	NA	NA	NA	NA
AVG12089.1|1616566_1616989_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVG12090.1|1617298_1617619_-|transposase	transposase IS3/IS911 family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	48.1	7.2e-19
AVG12091.1|1617676_1617976_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVG12092.1|1618066_1618627_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12093.1|1619105_1619462_-	group I intron endonuclease	NA	NA	NA	NA	NA
AVG12094.1|1619482_1620241_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12095.1|1620829_1621384_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12096.1|1622883_1625832_+	formate dehydrogenase, alpha subunit	NA	NA	NA	NA	NA
AVG12097.1|1625834_1626326_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12098.1|1626342_1627146_+	FdhD-like protein	NA	NA	NA	NA	NA
AVG12099.1|1627448_1628402_+	iron-siderophore ABC transporter-like protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
AVG12100.1|1628391_1629345_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVG12101.1|1629338_1630097_+	iron-siderophore ABC transporter-like protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
AVG12102.1|1630223_1631141_+	iron-siderophore ABC transporter-like protein	NA	NA	NA	NA	NA
AVG12103.1|1631142_1631310_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12104.1|1631363_1631621_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12105.1|1631642_1632791_+	6-phosphogluconolactonase-like protein	NA	NA	NA	NA	NA
AVG12106.1|1633347_1633662_+	MIP18 family protein YitW	NA	NA	NA	NA	NA
AVG12107.1|1633820_1634300_+	Cysteine dioxygenase	NA	NA	NA	NA	NA
AVG12108.1|1634456_1635218_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG12109.1|1635270_1635426_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12110.1|1635443_1636109_+	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
AVG12111.1|1636254_1636668_+	penicillinase repressor	NA	NA	NA	NA	NA
AVG12112.1|1636670_1637486_+	peptidase, M56 family	NA	NA	NA	NA	NA
AVG12113.1|1637573_1638290_+	disulfide bond formation protein D	NA	NA	NA	NA	NA
AVG12114.1|1638298_1638733_+	thiol-disulfide oxidoreductase-like protein	NA	NA	NA	NA	NA
AVG12115.1|1638775_1639498_-	oxidoreductase, short chain dehydrogenase/reductase family protein	NA	A0A0M4JSW6	Mollivirus	26.2	2.6e-08
AVG12116.1|1639941_1640316_-	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVG12117.1|1641123_1641579_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG12118.1|1641760_1642594_+	putative permease	NA	NA	NA	NA	NA
AVG12119.1|1642590_1642986_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12120.1|1643167_1645099_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AVG12121.1|1645169_1646687_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AVG12122.1|1646673_1647900_+	aminoacyltransferase FemX	NA	NA	NA	NA	NA
AVG12123.1|1648238_1649462_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 17
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1652610	1695666	4023351	transposase	Paenibacillus_phage(50.0%)	35	NA	NA
AVG12126.1|1652610_1653834_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG12127.1|1653915_1655583_+	lipoprotein-like protein	NA	NA	NA	NA	NA
AVG12128.1|1657409_1659011_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVG12129.1|1659793_1660951_+	stage V sporulation protein E	NA	NA	NA	NA	NA
AVG12130.1|1660930_1661581_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVG12131.1|1661711_1662338_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12132.1|1662490_1663012_-	peptide methionine sulfoxide reductase MsrA	NA	NA	NA	NA	NA
AVG12133.1|1663470_1664193_+	trehalose operon transcriptional repressor	NA	NA	NA	NA	NA
AVG12134.1|1664612_1666046_+	PTS system trehalose-specific EIIBC component TreP	NA	NA	NA	NA	NA
AVG12135.1|1666062_1667745_+	trehalose-6-phosphate hydrolase TreA	NA	NA	NA	NA	NA
AVG12136.1|1668057_1668372_-	Alpha-keto-acid decarboxylase	NA	NA	NA	NA	NA
AVG12137.1|1668857_1670081_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
AVG12138.1|1670823_1671927_-	RNA polymerase sigma factor rpoD	NA	M4SMP8	Cyanophage	37.9	3.0e-40
AVG12139.1|1672380_1673283_+	putative oxidoreductase YhdF	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.9	3.9e-54
AVG12140.1|1673378_1673915_-	putative membrane-associated phospholipid phosphatase	NA	NA	NA	NA	NA
AVG12141.1|1674346_1675936_-	bacillolysin	NA	NA	NA	NA	NA
AVG12142.1|1676210_1676438_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	75.6	2.4e-08
AVG12143.1|1676452_1677172_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	78.9	2.0e-101
AVG12144.1|1677164_1678388_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG12145.1|1678492_1679047_-	spore germination protein GerPC	NA	NA	NA	NA	NA
AVG12146.1|1679329_1679563_-	spore germination protein GerPA/GerPF	NA	NA	NA	NA	NA
AVG12147.1|1679681_1680122_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12148.1|1680534_1681161_+	Futalosine hydrolase	NA	NA	NA	NA	NA
AVG12149.1|1681157_1681988_+	putative periplasmic solute-binding protein	NA	NA	NA	NA	NA
AVG12150.1|1682091_1683162_-	branched-chain-amino-acid aminotransferase 2	NA	NA	NA	NA	NA
AVG12151.1|1683286_1684177_+	HTH-type transcriptional regulator BsdA	NA	NA	NA	NA	NA
AVG12152.1|1684422_1684761_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12153.1|1684938_1685880_-	glutaminase GlsA	NA	NA	NA	NA	NA
AVG12154.1|1687517_1687952_+	Two-component sensor histidine kinase-like protein	NA	W8CYF6	Bacillus_phage	35.8	5.0e-15
AVG12155.1|1688017_1688347_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12156.1|1688660_1688858_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG12157.1|1688922_1690146_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12158.1|1690262_1692188_+	Alkyl hydroperoxide reductase, large subunit	NA	NA	NA	NA	NA
AVG12159.1|1692611_1693970_-	putative manganese transport protein MntH	NA	NA	NA	NA	NA
AVG12160.1|1694442_1695666_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 18
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1770599	1865034	4023351	transposase,coat	Paenibacillus_phage(57.14%)	55	NA	NA
AVG12188.1|1770599_1771358_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG12189.1|1771379_1772279_+	phosphoenolpyruvate phosphomutase BcpB	NA	NA	NA	NA	NA
AVG12190.1|1772275_1773172_+	phosphonopyruvate decarboxylase BcpC	NA	NA	NA	NA	NA
AVG12191.1|1773276_1774500_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12192.1|1775658_1775901_+	magnesium transporter-like protein	NA	NA	NA	NA	NA
AVG12193.1|1775966_1779437_+	CoA-substrate-specific enzyme activase	NA	NA	NA	NA	NA
AVG12194.1|1781450_1781825_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12195.1|1782465_1783848_+	putative transporter	NA	NA	NA	NA	NA
AVG12196.1|1784006_1785209_-	multidrug resistance protein	NA	NA	NA	NA	NA
AVG12197.1|1785231_1785813_-	fatty acid metabolism regulator protein FadR	NA	NA	NA	NA	NA
AVG12198.1|1785985_1786570_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVG12199.1|1786834_1788058_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12200.1|1788211_1788535_+	small multidrug resistance protein	NA	NA	NA	NA	NA
AVG12201.1|1788537_1788852_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12202.1|1789252_1789477_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12203.1|1789454_1790261_+	amidinotransferase family protein	NA	NA	NA	NA	NA
AVG12204.1|1790594_1791266_+	alcohol dehydrogenase, zinc-dependent	NA	NA	NA	NA	NA
AVG12205.1|1792001_1792874_-	alpha/beta hydrolase FolD protein	NA	NA	NA	NA	NA
AVG12206.1|1793208_1793781_-	monogalactosyldiacylglycerol synthase-like protein	NA	NA	NA	NA	NA
AVG12207.1|1794134_1794293_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12208.1|1794712_1795495_+	putative nitrite transporter NirC	NA	NA	NA	NA	NA
AVG12209.1|1796258_1796462_+	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVG12210.1|1796695_1797919_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12211.1|1798100_1798568_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12212.1|1798635_1799448_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12213.1|1799434_1800241_+	putative membrane protein	NA	NA	NA	NA	NA
AVG12214.1|1800237_1801041_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12215.1|1801053_1801704_+	putative ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	3.4e-31
AVG12216.1|1801700_1802699_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12217.1|1802949_1804173_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12218.1|1804615_1804924_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12219.1|1805119_1807612_-	putative phosphoenolpyruvate synthase Pps	NA	A0A1V0SGR7	Hokovirus	35.4	3.3e-34
AVG12220.1|1807797_1808550_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	9.3e-134
AVG12221.1|1808687_1809371_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.4	3.4e-119
AVG12222.1|1809475_1817281_-	nonribosomal peptide ligase subunit	NA	A0A2K9KZV5	Tupanvirus	27.5	3.4e-77
AVG12223.1|1817417_1833527_-	nonribosomal peptide ligase subunit	NA	A0A2K9KZV5	Tupanvirus	22.7	1.9e-119
AVG12224.1|1833570_1845525_-	putative non-ribosomal peptide ligase/ polyketide synthase hybrid	NA	A0A2K9KZV5	Tupanvirus	27.8	7.2e-111
AVG12225.1|1845555_1846755_-	putative malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AVG12226.1|1847847_1848273_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVG12227.1|1848373_1849273_+	transcriptional regulator, LysR family	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	5.5e-08
AVG12228.1|1850931_1851444_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG12229.1|1851440_1851971_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG12230.1|1852047_1853271_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12231.1|1853335_1854829_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVG12232.1|1854912_1855476_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12233.1|1855600_1856497_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVG12234.1|1857134_1857281_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12235.1|1857479_1857848_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12236.1|1858038_1858773_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG12237.1|1858828_1859614_-	N-acetylmuramic acid deacetylase-like protein	NA	NA	NA	NA	NA
AVG12238.1|1859727_1861245_-	membrane protein	NA	NA	NA	NA	NA
AVG12239.1|1861323_1862442_-	two-component response regulator	NA	NA	NA	NA	NA
AVG12240.1|1862914_1863187_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
AVG12241.1|1863327_1863627_-	ribonuclease	NA	NA	NA	NA	NA
AVG12242.1|1863810_1865034_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 19
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1868440	1920097	4023351	transposase	Paenibacillus_phage(68.75%)	47	NA	NA
AVG12245.1|1868440_1869124_-|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	32.3	2.9e-17
AVG12246.1|1869265_1870489_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12247.1|1870603_1870789_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG12248.1|1871886_1872945_+	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVG12249.1|1873059_1874076_+	glucose-1-phosphate thymidylyltransferase StrD	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
AVG12250.1|1874144_1875368_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12251.1|1876083_1876269_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVG12252.1|1876413_1876734_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12253.1|1876730_1877504_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AVG12254.1|1877781_1878996_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	8.3e-225
AVG12255.1|1879226_1879748_-	transcriptional regulator, RpiR family	NA	NA	NA	NA	NA
AVG12256.1|1879812_1881036_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12257.1|1881078_1881414_-	MurPQ operon repressor	NA	NA	NA	NA	NA
AVG12258.1|1881449_1882130_-	putative N-acetylmannosamine-6-phosphate 2-epimerase NanE	NA	NA	NA	NA	NA
AVG12259.1|1882134_1883667_-	PTS system glucose-specific EIICBA component PtsG	NA	NA	NA	NA	NA
AVG12260.1|1883876_1885100_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12261.1|1885435_1886554_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVG12262.1|1886730_1887558_+	metallophosphoesterase-like protein	NA	NA	NA	NA	NA
AVG12263.1|1888005_1889568_-	gluconokinase GntK	NA	NA	NA	NA	NA
AVG12264.1|1889602_1890964_-	gluconate permease GnuT	NA	NA	NA	NA	NA
AVG12265.1|1891074_1891752_-	gluconate operon transcriptional repressor	NA	NA	NA	NA	NA
AVG12266.1|1891865_1892540_-	6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	38.7	9.1e-48
AVG12267.1|1892536_1892749_-	6-phosphogluconate dehydrogenase-like protein	NA	NA	NA	NA	NA
AVG12268.1|1892929_1893247_-	hypothetical protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	5.8e-13
AVG12269.1|1893887_1895111_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12270.1|1895199_1896096_-	group-specific protein	NA	NA	NA	NA	NA
AVG12271.1|1896164_1896380_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12272.1|1896816_1896918_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12273.1|1897204_1898428_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12274.1|1898594_1899365_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
AVG12275.1|1899981_1901205_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12276.1|1901867_1902074_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12277.1|1902451_1903000_+	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVG12278.1|1903233_1904406_+	oxalate decarboxylase OxdD	NA	NA	NA	NA	NA
AVG12279.1|1904489_1904918_-	cell wall hydrolase CwlJ	NA	NA	NA	NA	NA
AVG12280.1|1905084_1905474_-	Putative oxidoreductase CatD	NA	NA	NA	NA	NA
AVG12281.1|1906674_1906980_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
AVG12282.1|1907614_1908838_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12283.1|1909120_1909627_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12284.1|1910662_1912072_+	putative multidrug resistance protein YoeA	NA	NA	NA	NA	NA
AVG12285.1|1912164_1913052_-	putative membrane protein	NA	NA	NA	NA	NA
AVG12286.1|1913257_1913542_-	D-proline reductase proprotein PrdA	NA	NA	NA	NA	NA
AVG12287.1|1913959_1915183_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12288.1|1915592_1916423_+	acid phosphatase	NA	NA	NA	NA	NA
AVG12289.1|1916676_1917033_-	transcriptional activator FtrA	NA	NA	NA	NA	NA
AVG12290.1|1917113_1918481_-	putative integral membrane protein	NA	NA	NA	NA	NA
AVG12291.1|1918873_1920097_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 20
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1951612	1988348	4023351	tRNA,transposase	Paenibacillus_phage(71.43%)	25	NA	NA
AVG12312.1|1951612_1952836_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG12313.1|1953111_1953594_-	protein-tyrosine-phosphatase-like protein	NA	NA	NA	NA	NA
AVG12314.1|1953953_1955177_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12315.1|1955591_1956557_-	putative C4-dicarboxylate response regulator DctR	NA	NA	NA	NA	NA
AVG12316.1|1958333_1959392_+	C4-dicarboxylate-binding protein DctB	NA	NA	NA	NA	NA
AVG12317.1|1959649_1960927_+	C4-dicarboxylate transport protein DctA	NA	NA	NA	NA	NA
AVG12318.1|1961095_1962022_-	band 7 family protein	NA	NA	NA	NA	NA
AVG12319.1|1962025_1962457_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12320.1|1962653_1963646_-	putative transporter	NA	NA	NA	NA	NA
AVG12321.1|1963659_1963845_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12322.1|1964124_1965348_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12323.1|1965572_1966454_-	putative L-serine dehydratase, alpha chain	NA	NA	NA	NA	NA
AVG12324.1|1966480_1967143_-	putative L-serine dehydratase, beta chain	NA	NA	NA	NA	NA
AVG12325.1|1967357_1967522_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12326.1|1967611_1976002_-	putative non-ribosomal peptide ligase domain protein	NA	A0A2K9KZV5	Tupanvirus	26.1	1.4e-92
AVG12327.1|1976026_1979269_-	putative non-ribosomal peptide ligase domain protein	NA	A0A2K9KZV5	Tupanvirus	26.2	1.3e-83
AVG12328.1|1979674_1979854_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12329.1|1980674_1980884_-|tRNA	Tryptophan--tRNA ligase 2	tRNA	NA	NA	NA	NA
AVG12330.1|1980976_1981258_-|tRNA	Tryptophan--tRNA ligase 2	tRNA	NA	NA	NA	NA
AVG12331.1|1982167_1982353_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12332.1|1982859_1983759_+	cyclic peptide transporter	NA	NA	NA	NA	NA
AVG12333.1|1983986_1985210_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12334.1|1985597_1986599_+	phosphohydrolase	NA	NA	NA	NA	NA
AVG12335.1|1986780_1987485_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	1.1e-56
AVG12336.1|1987658_1988348_-|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 21
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2019050	2072761	4023351	tRNA,transposase	Paenibacillus_phage(56.25%)	47	NA	NA
AVG12365.1|2019050_2020274_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG12366.1|2020596_2021559_+	putative UDP-glucose 4-epimerase	NA	A0A2K9L0I7	Tupanvirus	34.0	2.5e-38
AVG12367.1|2021705_2022725_+	oligopeptide transport ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.2	9.7e-17
AVG12368.1|2022711_2023638_+	oligopeptide transport ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-20
AVG12369.1|2023651_2024617_+	oligopeptide transport system permease protein OppB	NA	NA	NA	NA	NA
AVG12370.1|2024635_2025541_+	oligopeptide transport system permease protein OppC	NA	NA	NA	NA	NA
AVG12371.1|2025555_2027355_+	oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
AVG12372.1|2027515_2028547_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	46.7	1.3e-90
AVG12373.1|2028601_2030887_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	65.1	1.5e-267
AVG12374.1|2031117_2031627_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG12375.1|2031644_2032202_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG12376.1|2032785_2033970_-	putative tagatose-6-phosphate ketose/aldose isomerase AgaS	NA	NA	NA	NA	NA
AVG12377.1|2034023_2034794_-	transcriptional regulator, GntR family	NA	NA	NA	NA	NA
AVG12378.1|2034858_2036082_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12379.1|2036405_2037629_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12380.1|2037621_2038515_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12381.1|2038700_2041247_+	O-GlcNAcase NagJ	NA	NA	NA	NA	NA
AVG12382.1|2041334_2041439_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12383.1|2041690_2042998_+	cell volume regulation protein A	NA	NA	NA	NA	NA
AVG12384.1|2043307_2044120_-	hypothetical protein	NA	A0A2I2L551	Orpheovirus	37.2	7.9e-38
AVG12385.1|2044261_2045665_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AVG12386.1|2045741_2046020_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12387.1|2046218_2046908_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG12388.1|2047081_2047786_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	1.1e-56
AVG12389.1|2047935_2049663_-	glycine betaine transport system permease protein OpuAB	NA	NA	NA	NA	NA
AVG12390.1|2049659_2050859_-	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	39.5	1.8e-30
AVG12391.1|2051158_2051737_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12392.1|2052003_2053488_+	putative aldehyde dehydrogenase DhaS	NA	NA	NA	NA	NA
AVG12393.1|2053537_2054710_-	spore autolysin-like protein	NA	NA	NA	NA	NA
AVG12394.1|2054725_2054905_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12395.1|2054955_2055066_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12396.1|2055960_2056806_-	carbohydrate kinase, YjeF related protein	NA	NA	NA	NA	NA
AVG12397.1|2056821_2057781_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
AVG12398.1|2057978_2059202_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG12399.1|2059387_2060476_-	putative dipeptidase YkvY	NA	NA	NA	NA	NA
AVG12400.1|2060672_2061671_-	Phosphate/sulfate permease	NA	NA	NA	NA	NA
AVG12401.1|2062004_2062172_+	thioredoxin-disulfide reductase	NA	NA	NA	NA	NA
AVG12402.1|2062216_2062858_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AVG12403.1|2062999_2063197_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	66.2	1.9e-17
AVG12404.1|2063338_2063671_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12405.1|2063667_2063844_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.7	8.5e-22
AVG12406.1|2064044_2065268_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12407.1|2066969_2067401_+	UspA domain-containing protein	NA	NA	NA	NA	NA
AVG12408.1|2067639_2068941_-	cell envelope-like function transcriptional attenuator common domain protein	NA	NA	NA	NA	NA
AVG12409.1|2069160_2070384_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12410.1|2070825_2071248_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12411.1|2071279_2072761_-|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 22
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2164924	2219461	4023351	tRNA,transposase,protease,integrase	Paenibacillus_phage(36.36%)	62	2203846:2203860	2219475:2219489
AVG12504.1|2164924_2166319_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
AVG12505.1|2166488_2167031_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AVG12506.1|2167209_2168538_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil-5-)- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVG12507.1|2168550_2170641_-	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
AVG12508.1|2170788_2171064_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12509.1|2171259_2172483_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12510.1|2172571_2173333_-	DNA processing Smf single strand binding protein-like protein	NA	S6BFL3	Thermus_phage	42.9	4.5e-27
AVG12511.1|2173360_2174584_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12512.1|2174792_2175728_-	succinyl-CoA ligase [ADP-forming] subunit alpha	NA	NA	NA	NA	NA
AVG12513.1|2175784_2176945_-	succinyl-CoA ligase [ADP-forming] subunit beta	NA	NA	NA	NA	NA
AVG12514.1|2177332_2177593_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12515.1|2177624_2178020_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12516.1|2178235_2179759_+	Mg chelatase-like protein	NA	NA	NA	NA	NA
AVG12517.1|2179856_2180261_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12518.1|2180270_2180603_-	flagellar biosynthesis-like protein	NA	NA	NA	NA	NA
AVG12519.1|2180599_2182411_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVG12520.1|2182465_2183149_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	9.7e-21
AVG12521.1|2183441_2184323_-	ribosome biogenesis GTPase A	NA	NA	NA	NA	NA
AVG12522.1|2184414_2185017_-	signal peptidase I	NA	NA	NA	NA	NA
AVG12523.1|2185128_2185470_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVG12524.1|2185612_2186365_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVG12525.1|2186361_2186883_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVG12526.1|2187108_2187339_-	RNA binding-like protein	NA	NA	NA	NA	NA
AVG12527.1|2187361_2187634_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVG12528.1|2187675_2189043_-	signal recognition particle protein Ffh	NA	NA	NA	NA	NA
AVG12529.1|2189072_2189435_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVG12530.1|2189568_2190576_-	cell division protein, FtsY-like protein	NA	NA	NA	NA	NA
AVG12531.1|2190660_2194239_-	chromosome partition protein SMC	NA	NA	NA	NA	NA
AVG12532.1|2194407_2195271_-	ribonuclease 3	NA	A0A167RGU4	Powai_lake_megavirus	30.0	8.7e-27
AVG12533.1|2195288_2196524_-	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVG12534.1|2196613_2196847_-	acyl carrier protein AcpP	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
AVG12535.1|2196965_2197706_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
AVG12536.1|2197805_2198741_-	malonyl CoA-acyl carrier protein transacylase FabD	NA	NA	NA	NA	NA
AVG12537.1|2198772_2199759_-	3-oxoacyl-[acyl-carrier-protein] synthase 3	NA	NA	NA	NA	NA
AVG12538.1|2199769_2200756_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AVG12539.1|2200757_2201348_-	transcription factor FapR	NA	NA	NA	NA	NA
AVG12540.1|2201523_2201697_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVG12541.1|2201815_2202328_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12542.1|2202415_2203534_-	peptidase Do	NA	NA	NA	NA	NA
AVG12543.1|2203673_2205023_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
2203846:2203860	attL	TTATTTTATCTGAAA	NA	NA	NA	NA
AVG12544.1|2205033_2205543_-	phosphopantetheine adenylyltransferase CoaD	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
AVG12545.1|2205560_2206118_-	putative rRNA methyltransferase YlbH	NA	NA	NA	NA	NA
AVG12546.1|2206667_2206865_-	Helix-turn-helix domain protein	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
AVG12547.1|2206929_2207343_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
AVG12548.1|2207490_2207880_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12549.1|2208324_2208603_-	amidinotransferase family protein	NA	NA	NA	NA	NA
AVG12550.1|2209141_2210473_-	GlcNAc-binding protein A	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
AVG12551.1|2210863_2211106_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	97.5	7.3e-32
AVG12552.1|2211115_2211787_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	95.5	1.5e-127
AVG12553.1|2211783_2212023_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
AVG12554.1|2212050_2212179_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12555.1|2212434_2212746_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVG12556.1|2212844_2213315_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG12557.1|2214994_2215345_-	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.0	8.4e-29
AVG12558.1|2216039_2216555_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12559.1|2216637_2216841_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
AVG12560.1|2217326_2217437_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12561.1|2217436_2217661_-	helix-turn-helix protein	NA	NA	NA	NA	NA
AVG12562.1|2217807_2218251_+	LexA repressor-like protein	NA	A6XML9	Bacillus_virus	37.5	1.0e-10
AVG12563.1|2218257_2218506_+	putative repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	53.7	1.0e-17
AVG12564.1|2218525_2218861_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	43.2	6.8e-12
AVG12565.1|2218975_2219461_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	57.9	1.7e-27
2219475:2219489	attR	TTATTTTATCTGAAA	NA	NA	NA	NA
>prophage 23
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2297906	2416900	4023351	tail,tRNA,integrase,capsid,transposase	Paenibacillus_phage(40.91%)	140	2377105:2377147	2390875:2390917
AVG12639.1|2297906_2299130_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12640.1|2299194_2299644_+	putative phage DNA-binding protein	NA	NA	NA	NA	NA
AVG12641.1|2299842_2300268_-	CoA binding domain protein	NA	NA	NA	NA	NA
AVG12642.1|2300286_2301099_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12643.1|2301118_2302411_-	3-phosphoshikimate 1-carboxyvinyltransferase AroA	NA	NA	NA	NA	NA
AVG12644.1|2302537_2302900_-	CrcB-like protein	NA	NA	NA	NA	NA
AVG12645.1|2302892_2303279_-	CrcB-like protein	NA	NA	NA	NA	NA
AVG12646.1|2303382_2303901_-	shikimate kinase AroK	NA	NA	NA	NA	NA
AVG12647.1|2304031_2305267_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG12648.1|2305272_2305977_-	putative ABC transporter ATP-binding protein YthP	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.2e-13
AVG12649.1|2306004_2306187_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12650.1|2306314_2306932_-	ankyrin-repeat containing protein	NA	A0A2I7SCM7	Paenibacillus_phage	93.8	4.8e-11
AVG12651.1|2306959_2308183_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12652.1|2308175_2308940_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12653.1|2309234_2309363_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12654.1|2310218_2310527_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12655.1|2310528_2311941_-	6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	29.4	3.9e-32
AVG12656.1|2312617_2312857_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	67.5	1.0e-22
AVG12657.1|2313617_2315180_-	bacillolysin	NA	NA	NA	NA	NA
AVG12658.1|2315995_2316481_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	66.2	1.5e-52
AVG12659.1|2316691_2317441_+	putative phage-associated protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
AVG12660.1|2317648_2318872_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	5.8e-226
AVG12661.1|2319184_2319736_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12662.1|2319937_2320420_-	putative phage protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
AVG12663.1|2320716_2321001_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12664.1|2320954_2321893_-	putative phage DNA-binding protein	NA	A0A0A7RTT7	Clostridium_phage	32.8	1.1e-38
AVG12665.1|2321957_2323181_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12666.1|2323173_2323578_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	NA	NA	NA	NA
AVG12667.1|2323597_2324710_-	AAA ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	28.8	1.5e-15
AVG12668.1|2325022_2325265_-	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	96.2	9.5e-32
AVG12669.1|2325277_2325556_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	4.2e-39
AVG12670.1|2325573_2326038_-	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	71.4	6.9e-63
AVG12671.1|2326044_2326725_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	95.1	2.1e-129
AVG12672.1|2326721_2326961_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
AVG12673.1|2326996_2327155_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12674.1|2327147_2327543_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12675.1|2327555_2328959_-	phage structural protein	NA	S5MNY5	Brevibacillus_phage	37.5	5.4e-10
AVG12676.1|2328962_2329241_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12677.1|2329237_2329819_-	putative phage protein	NA	S5MA71	Brevibacillus_phage	45.9	4.8e-37
AVG12678.1|2329811_2330888_-|capsid	phage capsid assembly-like protein	capsid	A0A0K2CP27	Brevibacillus_phage	52.4	2.5e-100
AVG12679.1|2330880_2331291_-	phage protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	1.1e-27
AVG12680.1|2331293_2331536_-	hypothetical protein	NA	S5MC71	Brevibacillus_phage	37.6	9.9e-13
AVG12681.1|2331535_2332519_-	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	55.6	1.0e-103
AVG12682.1|2332523_2333162_-	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	50.5	4.4e-52
AVG12683.1|2333158_2335135_-|tail	putative tail length tape measure protein	tail	S5MNW9	Brevibacillus_phage	46.9	8.7e-139
AVG12684.1|2335320_2335491_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12685.1|2335490_2335916_-	phage protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
AVG12686.1|2335942_2336407_-	putative phage protein	NA	A0A0K2CNG3	Brevibacillus_phage	62.1	2.7e-51
AVG12687.1|2336408_2337740_-	phage protein	NA	A0A0K2CNL4	Brevibacillus_phage	48.7	2.5e-113
AVG12688.1|2337740_2337923_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12689.1|2337915_2338326_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	46.8	7.8e-26
AVG12690.1|2338322_2338733_-	phage protein	NA	S5MNW5	Brevibacillus_phage	61.1	1.4e-38
AVG12691.1|2338732_2339092_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	54.7	3.7e-32
AVG12692.1|2339093_2339468_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	55.8	2.1e-30
AVG12693.1|2339448_2339682_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12694.1|2339693_2340644_-|capsid	putative major capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	86.6	5.1e-137
AVG12695.1|2340671_2341895_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12696.1|2342013_2342298_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12697.1|2342306_2342918_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVG12698.1|2342890_2345293_-	hyaluronate lyase	NA	NA	NA	NA	NA
AVG12699.1|2345305_2346055_-	putative sugar isomerase	NA	NA	NA	NA	NA
AVG12700.1|2346068_2347241_-	unsaturated glucuronyl hydrolase Ugl	NA	NA	NA	NA	NA
AVG12701.1|2347254_2347971_-	putative phosphosugar isomerase/binding protein	NA	NA	NA	NA	NA
AVG12702.1|2347990_2348476_-	sorbose PTS system IIB-like component	NA	NA	NA	NA	NA
AVG12703.1|2348489_2349281_-	PTS system, IID component	NA	NA	NA	NA	NA
AVG12704.1|2349273_2350053_-	PTS system, IIC component	NA	NA	NA	NA	NA
AVG12705.1|2350064_2350511_-	PTS system, IIA component	NA	NA	NA	NA	NA
AVG12706.1|2350507_2351212_-	HTH-type transcriptional repressor YvoA	NA	NA	NA	NA	NA
AVG12707.1|2351424_2352048_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12708.1|2352559_2353843_-	transporter, major facilitator family protein	NA	NA	NA	NA	NA
AVG12709.1|2354103_2355474_+	arginine decarboxylase SpeA	NA	NA	NA	NA	NA
AVG12710.1|2355617_2356037_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12711.1|2356111_2356426_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12712.1|2356483_2357494_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12713.1|2357595_2357778_+	Spo0E like sporulation regulatory protein	NA	NA	NA	NA	NA
AVG12714.1|2357784_2358297_-	putative membrane protein	NA	NA	NA	NA	NA
AVG12715.1|2358425_2359184_+	ribonuclease Z	NA	U5PU04	Bacillus_phage	39.2	1.6e-45
AVG12716.1|2359314_2359542_-	hypothetical protein	NA	G3MB34	Bacillus_virus	38.9	4.9e-06
AVG12717.1|2359719_2361348_+	sporulation kinase C	NA	NA	NA	NA	NA
AVG12718.1|2361353_2361791_-	acetyltransferase-like protein	NA	NA	NA	NA	NA
AVG12719.1|2362133_2363357_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12720.1|2363550_2364003_-	acid phosphatase/vanadium-dependent haloperoxidase YuiD	NA	NA	NA	NA	NA
AVG12721.1|2364158_2364584_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AVG12722.1|2364528_2364681_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12723.1|2364892_2365300_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
AVG12724.1|2365248_2366112_+	oligopeptide transport ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	31.3	3.7e-17
AVG12725.1|2366209_2366932_+	oligopeptide ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	6.2e-18
AVG12726.1|2367095_2367233_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12727.1|2367402_2367924_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12728.1|2367998_2368370_-	acetyltransferase-like protein	NA	NA	NA	NA	NA
AVG12729.1|2368545_2369769_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12730.1|2369939_2371163_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12731.1|2371254_2372682_+	guanine/hypoxanthine permease PbuO	NA	NA	NA	NA	NA
AVG12732.1|2372963_2373350_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12733.1|2373494_2374718_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12734.1|2375336_2376530_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	3.2e-27
2377105:2377147	attL	ATGACCTGAGCGGGGATCGAACCCACGACCTCTACCCTGTCAA	NA	NA	NA	NA
AVG12735.1|2377185_2377518_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	89.2	1.6e-29
AVG12736.1|2377667_2378057_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	49.3	6.5e-06
AVG12737.1|2378526_2378646_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12738.1|2379074_2379407_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12739.1|2379413_2380637_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12740.1|2380701_2381115_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG12741.1|2381150_2381264_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12742.1|2381693_2381927_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12743.1|2382000_2382222_-	putative transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
AVG12744.1|2382718_2382910_+	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
AVG12745.1|2382906_2383176_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	98.8	9.0e-39
AVG12746.1|2383179_2383392_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	78.8	6.4e-24
AVG12747.1|2383728_2384277_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	81.4	1.3e-73
AVG12748.1|2384613_2385114_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
AVG12749.1|2385668_2386226_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG12750.1|2386243_2386753_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG12751.1|2387285_2387696_+	helix-turn-helix family protein	NA	F8J1E0	Lactobacillus_phage	38.8	6.6e-09
AVG12752.1|2387727_2388144_+	Metallopeptidase ImmA	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
AVG12753.1|2388281_2389505_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12754.1|2389666_2390101_+	putative phage protein	NA	A0A1B0T6A8	Bacillus_phage	43.4	1.2e-24
AVG12755.1|2390097_2390787_+|integrase	phage integrase-like protein	integrase	A0A1B0T6A8	Bacillus_phage	46.5	1.3e-52
AVG12756.1|2391051_2391579_-	hypothetical protein	NA	NA	NA	NA	NA
2390875:2390917	attR	ATGACCTGAGCGGGGATCGAACCCACGACCTCTACCCTGTCAA	NA	NA	NA	NA
AVG12757.1|2391698_2392655_-	proline-specific peptidase	NA	NA	NA	NA	NA
AVG12758.1|2392898_2394122_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12759.1|2394708_2394873_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12760.1|2394975_2395149_-	phosphatidylglycerophosphatase A-like protein	NA	NA	NA	NA	NA
AVG12761.1|2395392_2395905_+	2'-5' RNA ligase	NA	NA	NA	NA	NA
AVG12762.1|2396004_2396754_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG12763.1|2396843_2397356_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG12764.1|2397492_2398971_-	Maltose-binding periplasmic protein/domain	NA	NA	NA	NA	NA
AVG12765.1|2399377_2400751_+	peptidase M20	NA	NA	NA	NA	NA
AVG12766.1|2400930_2401581_-	orotate phosphoribosyltransferase PyrE	NA	Q58MW1	Prochlorococcus_phage	29.2	5.4e-05
AVG12767.1|2401630_2402356_-	orotidine 5'-phosphate decarboxylase PyrF	NA	NA	NA	NA	NA
AVG12768.1|2402433_2405643_-	carbamoyl-phosphate synthase pyrimidine-specific large chain	NA	NA	NA	NA	NA
AVG12769.1|2405629_2406808_-	carbamoyl-phosphate synthase small chain CarA	NA	R4TGJ8	Halovirus	37.1	2.6e-58
AVG12770.1|2406830_2408147_-	dihydroorotase PyrC	NA	NA	NA	NA	NA
AVG12771.1|2408199_2409108_-	aspartate carbamoyltransferase PyrB	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	2.9e-33
AVG12772.1|2409109_2409655_-	bifunctional protein PyrR	NA	NA	NA	NA	NA
AVG12773.1|2409996_2411247_-	LL-diaminopimelate aminotransferase DapL	NA	NA	NA	NA	NA
AVG12774.1|2411401_2412337_-	putative RNA pseudouridine synthase YlyB	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	2.5e-11
AVG12775.1|2412326_2412848_-	lipoprotein signal peptidase LspA	NA	NA	NA	NA	NA
AVG12776.1|2412992_2413724_+	transcriptional regulator, TraR/DksA family	NA	NA	NA	NA	NA
AVG12777.1|2413735_2414056_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12778.1|2414131_2416900_-|tRNA	isoleucine--tRNA ligase IleS	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.7	2.0e-77
>prophage 24
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2468126	2713146	4023351	holin,protease,portal,tail,tRNA,coat,integrase,lysis,capsid,transposase	Paenibacillus_phage(68.61%)	266	2566595:2566654	2699739:2701127
AVG12827.1|2468126_2469335_-|tRNA	putative tRNA sulfurtransferase ThiI	tRNA	NA	NA	NA	NA
AVG12828.1|2469337_2470510_-	putative cysteine desulfurase IscS	NA	NA	NA	NA	NA
AVG12829.1|2470641_2471427_-	transglycosylase SLT domain protein	NA	A0A0H3V0Q1	Geobacillus_virus	43.8	5.3e-23
AVG12830.1|2471548_2472325_-	putative membrane protein	NA	NA	NA	NA	NA
AVG12831.1|2472321_2473245_-	ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	4.9e-36
AVG12832.1|2473388_2473694_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12833.1|2473727_2473937_-	ABC transporter, permease protein, putative	NA	NA	NA	NA	NA
AVG12834.1|2474120_2474621_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12835.1|2476799_2478023_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG12836.1|2478193_2479417_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
AVG12837.1|2480057_2481173_-	metal-binding protein	NA	NA	NA	NA	NA
AVG12838.1|2481148_2481907_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
AVG12839.1|2481910_2482741_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12840.1|2482884_2484012_-	RNA polymerase sigma factor rpoD	NA	M4SMP8	Cyanophage	37.2	3.8e-38
AVG12841.1|2484058_2485885_-	DNA primase DnaG	NA	A0A1S5REW9	Helicobacter_phage	32.7	1.8e-42
AVG12842.1|2485927_2486401_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12843.1|2486482_2487310_-	putative phosphotransferase	NA	NA	NA	NA	NA
AVG12844.1|2487535_2488288_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVG12845.1|2488586_2489489_-	GTPase Era	NA	NA	NA	NA	NA
AVG12846.1|2489534_2489945_-	cytidine deaminase	NA	NA	NA	NA	NA
AVG12847.1|2489961_2490678_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AVG12848.1|2490674_2491187_-	putative rRNA maturation factor	NA	NA	NA	NA	NA
AVG12849.1|2491278_2493561_-	membrane-associated hydrolase-like protein	NA	NA	NA	NA	NA
AVG12850.1|2493557_2494529_-	PhoH-like protein PhoH	NA	A0A0S0MVD6	Pseudomonas_phage	47.4	1.8e-49
AVG12851.1|2494547_2495726_-	putative stage IV sporulation protein	NA	NA	NA	NA	NA
AVG12852.1|2495749_2496031_-	YqfC	NA	NA	NA	NA	NA
AVG12853.1|2496224_2496665_-	YqeY-like protein	NA	A0A292GL36	Xanthomonas_phage	40.4	1.2e-19
AVG12854.1|2496999_2497347_-	Hit-like protein	NA	NA	NA	NA	NA
AVG12855.1|2499763_2501185_-	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	W8CYF6	Bacillus_phage	32.9	3.6e-38
AVG12856.1|2501171_2501882_-	putative transcriptional regulatory protein OmpR	NA	W8CYM9	Bacillus_phage	35.7	4.6e-34
AVG12857.1|2501910_2503281_-	putative lipoprotein	NA	NA	NA	NA	NA
AVG12858.1|2503476_2504436_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG12859.1|2504683_2505427_-	pyruvate formate-lyase 1-activating enzyme PflA	NA	NA	NA	NA	NA
AVG12860.1|2505595_2507860_-	formate acetyltransferase PflB	NA	A0A2P0VNR5	Tetraselmis_virus	44.7	2.1e-189
AVG12861.1|2507985_2510601_-	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVG12862.1|2510818_2512042_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12863.1|2512282_2512813_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12864.1|2512955_2513567_-	molybdopterin-guanine dinucleotide biosynthesis protein A	NA	NA	NA	NA	NA
AVG12865.1|2513787_2514510_+	anaerobic regulatory protein Fnr	NA	NA	NA	NA	NA
AVG12866.1|2514676_2515015_-	assimilatory nitrite reductase subunit	NA	NA	NA	NA	NA
AVG12867.1|2515029_2517474_-	nitrite reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVG12868.1|2517647_2518871_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	3.4e-226
AVG12869.1|2518935_2519205_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVG12870.1|2519113_2519338_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12871.1|2519442_2522895_-	nuclease sbcCD subunit C	NA	A0A1D8KRV2	Synechococcus_phage	32.0	3.5e-10
AVG12872.1|2522908_2524084_-	nuclease sbcCD subunit D	NA	NA	NA	NA	NA
AVG12873.1|2524097_2528273_-	ATP-dependent helicase/nuclease subunit A	NA	G3MA40	Bacillus_virus	25.1	2.6e-07
AVG12874.1|2528250_2531853_-	ATP-dependent helicase/deoxyribonuclease subunit B	NA	NA	NA	NA	NA
AVG12875.1|2532320_2532830_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG12876.1|2532847_2533336_-|transposase	transposase	transposase	A0A0K2CZQ0	Paenibacillus_phage	96.8	6.5e-11
AVG12877.1|2533363_2534587_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12878.1|2534607_2534802_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG12879.1|2535040_2535592_-	DinB superfamily protein	NA	NA	NA	NA	NA
AVG12880.1|2535638_2536367_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12881.1|2536639_2536906_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12882.1|2536959_2537496_-	putative acetyltransferase	NA	NA	NA	NA	NA
AVG12883.1|2537587_2538952_-	ribosomal RNA large subunit methyltransferase I	NA	W6LLI2	Streptococcus_phage	22.2	4.8e-19
AVG12884.1|2539081_2540140_+	Na+/anion cotransporter-like protein	NA	NA	NA	NA	NA
AVG12885.1|2540151_2540577_-	Putative mutator protein MutT4	NA	NA	NA	NA	NA
AVG12886.1|2540724_2542074_-	putative methylthiotransferase YqeV	NA	NA	NA	NA	NA
AVG12887.1|2542076_2542844_-	RNA methyltransferase, RsmE family	NA	NA	NA	NA	NA
AVG12888.1|2543009_2543687_-	peptidase, M50 family	NA	NA	NA	NA	NA
AVG12889.1|2543695_2543986_-	Ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVG12890.1|2544014_2544659_-	Ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVG12891.1|2544874_2545246_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12892.1|2545262_2545403_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12893.1|2545553_2546675_-	chaperone protein DnaJ	NA	A0A1V0SBY2	Catovirus	34.8	2.0e-31
AVG12894.1|2546834_2548688_-	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	1.9e-143
AVG12895.1|2548744_2549344_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AVG12896.1|2549466_2550498_-	heat-inducible transcription repressor HrcA	NA	NA	NA	NA	NA
AVG12897.1|2550541_2550982_-	putative acetyltransferase protein	NA	NA	NA	NA	NA
AVG12898.1|2551077_2551536_-	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVG12899.1|2551636_2552788_-	oxygen-independent coproporphyrinogen-III oxidase 1	NA	NA	NA	NA	NA
AVG12900.1|2552868_2554683_-	elongation factor protein	NA	E4ZFJ7	Streptococcus_phage	23.7	4.4e-20
AVG12901.1|2554759_2555203_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12902.1|2555239_2556220_-	spore autolysin-like protein	NA	NA	NA	NA	NA
AVG12903.1|2556207_2556435_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12904.1|2556636_2557632_-|protease	germination protease Gpr	protease	NA	NA	NA	NA
AVG12905.1|2557817_2558090_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVG12906.1|2558188_2559214_-	DNA polymerase III subunit delta-like protein	NA	NA	NA	NA	NA
AVG12907.1|2559545_2560583_-	putative transmembrane transcriptional regulator (anti-sigma factor)	NA	NA	NA	NA	NA
AVG12908.1|2560572_2561127_-	putative RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
AVG12909.1|2561651_2562326_-	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	38.5	1.6e-31
AVG12910.1|2562401_2563625_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
AVG12911.1|2563713_2566242_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
AVG12912.1|2566369_2566489_-	hypothetical protein	NA	NA	NA	NA	NA
2566595:2566654	attL	AGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTC	NA	NA	NA	NA
AVG12913.1|2566714_2567938_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG12914.1|2568046_2568325_-	beta-lactamase domain-containing protein	NA	M1PSD2	Streptococcus_phage	54.2	2.7e-14
AVG12915.1|2568764_2569004_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	66.2	3.0e-22
AVG12916.1|2569764_2571327_-	bacillolysin	NA	NA	NA	NA	NA
AVG12917.1|2572142_2572628_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	66.2	1.5e-52
AVG12918.1|2572830_2574054_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG12919.1|2574224_2575448_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
AVG12920.1|2575878_2576091_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	97.1	2.3e-34
AVG12921.1|2576221_2576596_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVG12922.1|2576567_2576681_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12923.1|2576719_2577676_-	ribonuclease Z	NA	NA	NA	NA	NA
AVG12924.1|2577850_2581291_-	methionine synthase MetH	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
AVG12925.1|2581567_2582110_+	acireductone dioxygenase MtnD	NA	NA	NA	NA	NA
AVG12926.1|2582215_2583010_-	phosphatase-like protein	NA	NA	NA	NA	NA
AVG12927.1|2583036_2583222_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12928.1|2583403_2583781_-	Cell division suppressor protein YneA	NA	NA	NA	NA	NA
AVG12929.1|2583926_2584544_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	6.5e-16
AVG12930.1|2584689_2584956_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
AVG12931.1|2585452_2585686_-	hypothetical protein	NA	A0A0K2CYV5	Paenibacillus_phage	46.6	2.2e-09
AVG12932.1|2585783_2586875_-	membrane transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG12933.1|2588292_2589042_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG12934.1|2589131_2589644_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG12935.1|2589913_2590324_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12936.1|2590367_2590829_+|transposase	putative transposase for insertion sequence element IS3 family protein	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.7	4.2e-20
AVG12937.1|2590818_2591151_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12938.1|2590990_2591341_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12939.1|2591608_2592832_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	3.4e-226
AVG12940.1|2593205_2593877_+|integrase	integrase catalytic region	integrase	Q6H9S6	Enterobacteria_phage	27.8	3.9e-14
AVG12941.1|2594145_2594961_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.1e-58
AVG12942.1|2595008_2595296_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	2.4e-05
AVG12943.1|2595590_2596922_-	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVG12944.1|2596958_2597366_-	HTH-type transcriptional regulator GlnR	NA	NA	NA	NA	NA
AVG12945.1|2597378_2597474_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12946.1|2597536_2598787_-	aluminum resistance protein	NA	NA	NA	NA	NA
AVG12947.1|2598829_2600119_-	GTP-binding protein HflX	NA	NA	NA	NA	NA
AVG12948.1|2600144_2601134_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.5	3.4e-51
AVG12949.1|2601260_2602307_-	lipoate-protein ligase LplJ	NA	NA	NA	NA	NA
AVG12950.1|2602303_2603005_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AVG12951.1|2603194_2603581_-	carboxylesterase	NA	NA	NA	NA	NA
AVG12952.1|2603631_2604306_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	48.8	1.2e-20
AVG12953.1|2604489_2606922_-	penicillin-binding protein 1F	NA	NA	NA	NA	NA
AVG12954.1|2607070_2607310_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVG12955.1|2607387_2608350_-|tRNA	tRNA dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVG12956.1|2608337_2609168_-	methyltransferase-like protein	NA	NA	NA	NA	NA
AVG12957.1|2609237_2611286_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	2.0e-66
AVG12958.1|2611316_2613998_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.2	1.3e-28
AVG12959.1|2614121_2615477_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12960.1|2615578_2616148_-|coat	spore coat protein E	coat	NA	NA	NA	NA
AVG12961.1|2616407_2616794_+	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	91.4	5.9e-60
AVG12962.1|2616961_2617456_+	Telomeric repeat-binding factor 2	NA	A0A0N7GFE7	Paenibacillus_phage	100.0	2.7e-41
AVG12963.1|2617492_2618125_+	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	68.1	3.7e-51
AVG12964.1|2618291_2618567_+	hypothetical protein	NA	A0A2I7SCF3	Paenibacillus_phage	95.6	3.3e-44
AVG12965.1|2618617_2618968_+	phage protein	NA	A0A2I7SCF2	Paenibacillus_phage	90.5	7.5e-54
AVG12966.1|2618973_2619348_+	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	81.5	9.9e-52
AVG12967.1|2619390_2619624_-	putative transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	37.3	2.5e-05
AVG12968.1|2619763_2620186_+	bacteriophage protein	NA	O48383	Streptococcus_phage	75.0	3.7e-07
AVG12969.1|2620323_2621415_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12970.1|2621561_2622191_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12971.1|2622196_2622406_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12972.1|2622545_2622827_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12973.1|2622967_2623186_+	hypothetical protein	NA	NA	NA	NA	NA
AVG12974.1|2623239_2623518_+	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	80.5	3.2e-31
AVG12975.1|2623702_2624572_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	A0A0N9SGH1	Paenibacillus_phage	94.8	6.1e-161
AVG12976.1|2624564_2624900_-|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	92.8	1.6e-48
AVG12977.1|2624845_2624980_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12978.1|2624967_2625408_-	phage-related protein	NA	A0A0N9S7V6	Paenibacillus_phage	67.1	1.9e-49
AVG12979.1|2625404_2627723_-	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	93.9	0.0e+00
AVG12980.1|2627725_2629183_-|tail	phage tail component	tail	A0A0N9RRA9	Paenibacillus_phage	96.9	4.7e-283
AVG12981.1|2629184_2630021_-	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	52.4	1.8e-32
AVG12982.1|2630177_2632079_-|tail	putative phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	75.4	3.3e-220
AVG12983.1|2632106_2632271_-	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	70.4	5.1e-13
AVG12984.1|2632456_2632840_-	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	67.7	5.0e-43
AVG12985.1|2632842_2633100_-	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	51.9	1.4e-12
AVG12986.1|2633164_2633713_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	98.4	6.2e-95
AVG12987.1|2633725_2634100_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	96.0	1.6e-62
AVG12988.1|2634096_2634522_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	95.0	1.3e-71
AVG12989.1|2634518_2634851_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	94.5	1.1e-54
AVG12990.1|2634851_2635235_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
AVG12991.1|2635249_2636236_-|capsid	major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	89.0	3.5e-157
AVG12992.1|2636292_2636928_-	Phage minor structural protein GP20	NA	A0A0N9SIL0	Paenibacillus_phage	83.4	1.6e-54
AVG12993.1|2637016_2637880_-	putative phage protein	NA	A0A0N9SJR1	Paenibacillus_phage	92.7	4.9e-147
AVG12994.1|2637876_2639256_-|portal	phage portal protein, SPP1 family	portal	A0A0N7GFE4	Paenibacillus_phage	93.7	4.1e-252
AVG12995.1|2639402_2639861_-	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	86.1	8.6e-74
AVG12996.1|2639873_2641640_-	phage protein	NA	A0A0N9RZA7	Paenibacillus_phage	98.0	0.0e+00
AVG12997.1|2642601_2642853_-	hypothetical protein	NA	NA	NA	NA	NA
AVG12998.1|2643694_2644093_-	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
AVG12999.1|2644082_2644520_-	putative phage-associated protein	NA	A0A0N9SJZ8	Paenibacillus_phage	79.3	5.7e-59
AVG13000.1|2644521_2644689_-	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	75.9	4.3e-15
AVG13001.1|2644977_2646201_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG13002.1|2646390_2646783_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13003.1|2647113_2647518_-	hypothetical protein	NA	A0A0N9RRE8	Paenibacillus_phage	88.9	7.4e-61
AVG13004.1|2647582_2647816_-	hypothetical protein	NA	A0A0N9SJZ3	Paenibacillus_phage	94.8	9.8e-34
AVG13005.1|2647904_2648363_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	91.4	7.3e-73
AVG13006.1|2648352_2648760_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	94.1	1.0e-62
AVG13007.1|2648747_2650046_-	modification methylase	NA	A0A1P8CX25	Bacillus_phage	44.8	5.4e-97
AVG13008.1|2650124_2650508_+	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	76.4	8.8e-56
AVG13009.1|2650464_2651025_-	deoxynucleoside monophosphate kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	96.7	3.2e-99
AVG13010.1|2651008_2651869_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	78.0	4.6e-121
AVG13011.1|2651872_2652337_-	putative prophage protein	NA	A0A0N9SGM1	Paenibacillus_phage	99.4	1.8e-87
AVG13012.1|2652330_2652624_-	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	82.6	5.7e-39
AVG13013.1|2652624_2652864_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13014.1|2652865_2653255_-	SprT-like family protein	NA	A0A0N7GFF3	Paenibacillus_phage	76.7	4.6e-52
AVG13015.1|2653268_2653595_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13016.1|2653595_2653790_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13017.1|2653789_2654128_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13018.1|2654078_2654381_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13019.1|2654387_2654591_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13020.1|2654577_2654832_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13021.1|2654824_2655178_-	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	85.7	2.2e-37
AVG13022.1|2655207_2655666_-	deoxyuridine 5'-triphosphate nucleotidohydrolase Dut	NA	D2XR49	Bacillus_phage	53.8	2.9e-37
AVG13023.1|2655677_2656709_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A0E3X9K0	Bacillus_phage	60.3	5.6e-121
AVG13024.1|2656681_2656939_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13025.1|2656953_2659080_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	66.9	2.3e-278
AVG13026.1|2659237_2659420_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13027.1|2659416_2659647_-	crossover junction endodeoxyribonuclease	NA	A0A0N9ST03	Paenibacillus_phage	86.8	2.9e-30
AVG13028.1|2659924_2660869_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	87.1	1.2e-146
AVG13029.1|2660928_2661543_-	DNA polymerase III PolC-like protein	NA	A0A0N9SJX9	Paenibacillus_phage	89.2	4.8e-96
AVG13030.1|2661543_2662671_-	DNA-directed DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	78.6	2.1e-174
AVG13031.1|2662676_2664533_-	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	92.0	3.1e-303
AVG13032.1|2664472_2665282_-	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	75.8	1.0e-106
AVG13033.1|2665293_2665503_-	hypothetical protein	NA	A0A0N9SJW4	Paenibacillus_phage	94.2	1.1e-31
AVG13034.1|2665490_2665904_-	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	97.1	1.7e-73
AVG13035.1|2665933_2666053_-	hypothetical protein	NA	A0A0N7GFF1	Paenibacillus_phage	71.8	1.5e-06
AVG13036.1|2666067_2666274_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13037.1|2666286_2667024_-	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	98.4	8.0e-138
AVG13038.1|2667109_2667634_-	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	66.7	3.9e-54
AVG13039.1|2667699_2668263_-	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	88.8	3.0e-76
AVG13040.1|2668316_2669267_-	DNA primase	NA	A0A0N9S7Y2	Paenibacillus_phage	88.6	4.1e-163
AVG13041.1|2669279_2670656_-	replicative DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	98.0	3.8e-258
AVG13042.1|2670652_2671423_-	putative DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	95.3	7.3e-142
AVG13043.1|2671430_2671697_-	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	85.2	3.4e-38
AVG13044.1|2671707_2672235_-	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	83.4	4.3e-77
AVG13045.1|2672237_2672360_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13046.1|2672372_2673206_-	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	67.9	7.0e-90
AVG13047.1|2673220_2673589_-	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	89.3	6.3e-59
AVG13048.1|2673572_2673950_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	70.9	1.0e-40
AVG13049.1|2674007_2674379_-	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	43.1	2.9e-19
AVG13050.1|2674409_2674658_-	hypothetical protein	NA	A0A0N9RTL0	Paenibacillus_phage	98.8	5.9e-45
AVG13051.1|2674826_2675153_-	hypothetical protein	NA	A0A0N7GFE9	Paenibacillus_phage	98.1	1.2e-53
AVG13052.1|2675173_2675500_-	hypothetical protein	NA	A0A0N9SGJ1	Paenibacillus_phage	99.1	3.4e-56
AVG13053.1|2675526_2675829_-	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	86.0	3.7e-41
AVG13054.1|2675825_2675996_-	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.0e-19
AVG13055.1|2675992_2676169_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13056.1|2676202_2676439_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	73.9	3.4e-26
AVG13057.1|2676553_2676670_-	hypothetical protein	NA	A0A0N7GFE8	Paenibacillus_phage	88.6	3.4e-11
AVG13058.1|2676666_2676834_-	hypothetical protein	NA	A0A0N7GFE8	Paenibacillus_phage	80.9	3.4e-12
AVG13059.1|2676843_2677077_-	hypothetical protein	NA	A0A0N9SHK5	Paenibacillus_phage	91.5	8.6e-22
AVG13060.1|2677250_2677886_+	putative repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	85.9	1.2e-78
AVG13061.1|2677898_2679077_+|integrase	integrase Int	integrase	A0A0N9SGH8	Paenibacillus_phage	97.4	1.1e-216
AVG13062.1|2679198_2680161_-	putative lipoprotein	NA	NA	NA	NA	NA
AVG13063.1|2680374_2680716_-	Putative aliphatic sulfonates transport permease protein SsuC	NA	NA	NA	NA	NA
AVG13064.1|2680880_2681432_-	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	39.6	2.3e-20
AVG13065.1|2681432_2681675_-	ABC transporter, ATP-binding protein	NA	NA	NA	NA	NA
AVG13066.1|2681841_2682342_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG13067.1|2682654_2683377_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVG13068.1|2683465_2684689_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13069.1|2684998_2686519_-	Zn-dependent carboxypeptidase	NA	NA	NA	NA	NA
AVG13070.1|2686625_2686961_+	HesB/YadR/YfhF-family protein	NA	NA	NA	NA	NA
AVG13071.1|2686983_2687574_+	putative carbonic anhydrase YtiB	NA	NA	NA	NA	NA
AVG13072.1|2687570_2688125_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13073.1|2688252_2688684_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13074.1|2688683_2688962_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13075.1|2689138_2691376_-	immune inhibitor A	NA	NA	NA	NA	NA
AVG13076.1|2691650_2692121_-	putative metal-dependent hydrolase of the TIM-barrel fold protein	NA	NA	NA	NA	NA
AVG13077.1|2692153_2695279_-	putative N-acetyltransferase YvbK	NA	NA	NA	NA	NA
AVG13078.1|2695414_2697013_-	malate synthase Mls	NA	NA	NA	NA	NA
AVG13079.1|2697042_2698437_-	isocitrate lyase AceA	NA	A0A0K2CZQ0	Paenibacillus_phage	96.8	1.9e-10
AVG13080.1|2698464_2699688_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13081.1|2699858_2701082_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13082.1|2701163_2701772_+	ABC transporter-like protein	NA	M1I2G3	Paramecium_bursaria_Chlorella_virus	23.9	3.0e-05
2699739:2701127	attR	AGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTCATAGCCCTCAGTTAGAATAATGTTGGGACACAAAATTCTAAATATACGAGGTGTTATGAAATGGCTCAATACCAGATTAACGTAGATTCGCAGCTTTTGCATCAACTATTTTTGGGAAATTCTCAGGATGCGGGTGTAGCCAAGCTGCTCGAGTCTGTACTGAACCAAGTCTTACAAGCACAGGTGAGTGAACAAGTGGAAGCAGATCGTTATGAACGAACAGAGAATCGAAAAGCGTACCGGAATGGATCGTATCCACATGGGCTGCATACGCGGGTGGGAACCATTACACTAAGTGTTCCGCGCATCCGTGGCGGGAAGTTCACGACAGAGCTCTTTAGTCGTTACCAGAGAAGTGAACAAGCGTTAATCTTAGCGATGATGGAAATGGTCGTAAACGGCGTCTCTACGCGTAAAGTCTCGCAAGTAACCGAAGAACTCTGCGGAACCGAGTTTTCTAAATCCACTGTTTCAGACCTTTGTAAGCGGCTGGATCCCATCGTAACTGCTTGGAATAATCGAAGCCTGGCAGACAGCCTCTTTCCGTTTGTTCTCGTAGATGCGATGTATCTCAAGGTCCGTGAAGACGGTCGTGTACGCTCACGAGGCATCATGATTGCCATTGGTGTAAACACCGAGGGCTATCGTGAAGTCCTTGGCCTGATGCTGGGTGACACAGAATCTGAAGCAAGCTGGAGTGAGTTTTTCAGCTCTCTAAAAGGACGTGGATTACGAGGTGTGGATCTCATTACCTCCGACGATCATGGCGGCCTTGTACGCGCGGTACGGCAGCAGCTGCAAGGGGTAACATGGCAGCGATGCCAGACTCACTTCACGCGAAATGTATTAGAAGCCTCACCCAAAGCCTTGAAGGATGAGATCCATGGCCGTCTACGGTCGATTCTAGATGCTCCTGATACTGGAACGGCAAGGTTTTTATTAAAACAGACCTTAGCGGCTTATGAAGATAAGGCGGGTAAGGCGATGGGCGTGCTGGAAAGCGGATTTGACGATGCTACCGCCGTCTTAATGCTGCCAGAGCGTTACCGAAAACGGCTGCGCACGACAAATAGCGTTGAGCGTCTCAACGAAGAGGTTAGACGCCGGGAACGTGTCATTCGCATCTTCCCAAACCGTGAATCCGTGATTCGTCTTATTGGTGCTCTATTGATGGAACAGGATGAAAAATGGGCAGCCGGCAAGAAATATCTCGACATGACCGAGTACATGGAATGGCGGAAGGATCGGCCAAAGTCCGATGCCAAAGTGACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATCT	NA	NA	NA	NA
AVG13083.1|2701768_2702221_+	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.8	8.6e-10
AVG13084.1|2702427_2702811_-	kinase-associated lipoprotein B	NA	NA	NA	NA	NA
AVG13085.1|2702930_2703269_-	putative thioredoxin	NA	NA	NA	NA	NA
AVG13086.1|2703291_2703825_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13087.1|2703907_2705527_-	ABC transporter, ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.4e-54
AVG13088.1|2705557_2707471_-	ABC transporter, ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	6.4e-54
AVG13089.1|2708864_2709161_-	stress responsive A/B barrel domain protein	NA	NA	NA	NA	NA
AVG13090.1|2709180_2710737_-	ABC efflux transporter-like protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	4.9e-52
AVG13091.1|2710866_2712618_-	type VI secretion system FHA domain protein	NA	NA	NA	NA	NA
AVG13092.1|2712630_2713146_-|protease	putative Flp pilus assembly protein, protease CpaA	protease	NA	NA	NA	NA
>prophage 25
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2803332	2855124	4023351	tRNA,transposase,protease	Paenibacillus_phage(23.53%)	48	NA	NA
AVG13179.1|2803332_2805999_-|tRNA	valine--tRNA ligase ValS	tRNA	A0A1V0SK04	Klosneuvirus	41.3	2.1e-167
AVG13180.1|2806791_2807928_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
AVG13181.1|2808032_2808431_-	putative RNA pseudouridine synthase YhcT	NA	NA	NA	NA	NA
AVG13182.1|2808917_2809997_+	exopolysaccharide biosynthesis protein	NA	A0A1P8CWN9	Bacillus_phage	30.9	1.7e-11
AVG13183.1|2810329_2811286_-	pantothenate kinase CoaA	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	5.3e-33
AVG13184.1|2811530_2812832_-	glutamate-1-semialdehyde 2,1-aminomutase 2	NA	NA	NA	NA	NA
AVG13185.1|2812894_2814334_-	protoporphyrinogen oxidase HemY	NA	NA	NA	NA	NA
AVG13186.1|2814374_2815304_-	ferrochelatase HemH	NA	NA	NA	NA	NA
AVG13187.1|2815300_2816374_-	uroporphyrinogen decarboxylase HemE	NA	NA	NA	NA	NA
AVG13188.1|2816566_2817562_-	delta-aminolevulinic acid dehydratase HemB	NA	NA	NA	NA	NA
AVG13189.1|2817582_2819133_-	porphyrin biosynthesis protein HemD	NA	NA	NA	NA	NA
AVG13190.1|2819149_2820094_-	porphobilinogen deaminase HemC	NA	NA	NA	NA	NA
AVG13191.1|2820142_2820880_-	precorrin-2 dehydrogenase SirC	NA	NA	NA	NA	NA
AVG13192.1|2820876_2821719_-	protein HemX	NA	NA	NA	NA	NA
AVG13193.1|2821750_2823151_-|tRNA	glutamyl-tRNA reductase HemA	tRNA	NA	NA	NA	NA
AVG13194.1|2823322_2823856_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13195.1|2823993_2824395_-	S-adenosylmethionine decarboxylase proenzyme SpeH	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.2e-18
AVG13196.1|2824767_2825355_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13197.1|2825745_2826360_-	putative GTP-binding protein EngB	NA	NA	NA	NA	NA
AVG13198.1|2826378_2828712_-|protease	Lon protease Lon	protease	A0A0R6PGP8	Moraxella_phage	41.5	4.3e-169
AVG13199.1|2828861_2830580_-|protease	Lon protease 2	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
AVG13200.1|2830804_2831503_+	N-acetylmuramoyl-L-alanine amidase-like protein	NA	NA	NA	NA	NA
AVG13201.1|2831553_2832675_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase IspG	NA	NA	NA	NA	NA
AVG13202.1|2832779_2834039_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	4.5e-149
AVG13203.1|2834054_2834645_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
AVG13204.1|2834809_2836111_-	trigger factor Tig	NA	NA	NA	NA	NA
AVG13205.1|2836289_2837192_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13206.1|2837322_2838543_-	PGA biosynthesis protein CapA	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	33.9	4.8e-55
AVG13207.1|2838639_2838756_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13208.1|2838769_2838883_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13209.1|2838937_2840452_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVG13210.1|2840444_2840921_-	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVG13211.1|2841086_2841632_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13212.1|2841728_2843573_+	asparagine ligase	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
AVG13213.1|2843640_2844273_-	Non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
AVG13214.1|2844259_2845015_-	ribonuclease PH	NA	NA	NA	NA	NA
AVG13215.1|2845350_2846382_-	spore germination protein GerM	NA	NA	NA	NA	NA
AVG13216.1|2846618_2847134_+	phosphatidylglycerophosphatase A-like protein	NA	G3MBC5	Bacillus_virus	53.6	1.9e-37
AVG13217.1|2847245_2848055_+	putative membrane protein	NA	NA	NA	NA	NA
AVG13218.1|2848177_2849401_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13219.1|2849515_2849869_-	putative lethal factor domain protein	NA	NA	NA	NA	NA
AVG13220.1|2850188_2850995_-	methyltransferase	NA	NA	NA	NA	NA
AVG13221.1|2851061_2851175_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13222.1|2851280_2851511_-	hypothetical protein	NA	R9W000	Paenibacillus_phage	96.7	5.0e-06
AVG13223.1|2851520_2852198_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CYE7	Paenibacillus_phage	94.7	6.9e-128
AVG13224.1|2852674_2853898_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13225.1|2854012_2854141_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	56.1	2.8e-06
AVG13226.1|2854140_2855124_-	phage structural protein	NA	A0A0C5AEQ0	Bacteriophage	75.9	7.1e-49
>prophage 26
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2861083	2901776	4023351	transposase,coat	Paenibacillus_phage(36.36%)	35	NA	NA
AVG13234.1|2861083_2862307_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13235.1|2862994_2863219_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
AVG13236.1|2863359_2864679_-	putative permease	NA	NA	NA	NA	NA
AVG13237.1|2864809_2865742_-	dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit	NA	NA	NA	NA	NA
AVG13238.1|2865722_2866424_-	dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit	NA	NA	NA	NA	NA
AVG13239.1|2866838_2867705_+	3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2	NA	NA	NA	NA	NA
AVG13240.1|2867788_2868625_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVG13241.1|2868611_2869628_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVG13242.1|2869632_2870424_-	glycosyltransferase, group 2 family protein	NA	NA	NA	NA	NA
AVG13243.1|2870577_2871498_+	NAD dependent epimerase/dehydratase family protein WcaG	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.2	7.4e-32
AVG13244.1|2871579_2872299_-	glycosyltransferase-like protein	NA	K7Z8A5	Megavirus	23.6	1.2e-10
AVG13245.1|2872306_2873212_-	UDP-2-acetamido-2,6-dideoxy-hexulose 4-reductase	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
AVG13246.1|2873208_2874039_-	putative reductase	NA	NA	NA	NA	NA
AVG13247.1|2874035_2875022_-	polysaccharide biosynthesis protein CapD	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
AVG13248.1|2875011_2876106_-	UDP-N-acetylglucosamine 2-epimerase WecB	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
AVG13249.1|2876102_2877653_-	extracellular matrix biosynthesis-like protein	NA	NA	NA	NA	NA
AVG13250.1|2877833_2878205_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13251.1|2878204_2879341_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVG13252.1|2879315_2880506_-	putative spore maturation protein	NA	NA	NA	NA	NA
AVG13253.1|2880502_2881225_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	G3MA50	Bacillus_virus	40.9	5.4e-46
AVG13254.1|2881479_2883399_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13255.1|2883410_2889314_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13256.1|2889435_2889774_-	putative L,D-transpeptidase YkuD	NA	NA	NA	NA	NA
AVG13257.1|2891421_2892204_+	phosphatidylserine decarboxylase proenzyme Psd	NA	NA	NA	NA	NA
AVG13258.1|2892215_2892728_+	efflux transporter-like protein	NA	NA	NA	NA	NA
AVG13259.1|2892757_2893357_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG13260.1|2893678_2894431_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	9.3e-134
AVG13261.1|2894568_2894688_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	97.4	7.7e-11
AVG13262.1|2894744_2895251_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.2	1.5e-74
AVG13263.1|2895356_2895836_-	protein YtsP	NA	NA	NA	NA	NA
AVG13264.1|2895901_2896696_-	MSM operon regulatory protein-like protein	NA	NA	NA	NA	NA
AVG13265.1|2896699_2898139_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AVG13266.1|2898457_2899750_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVG13267.1|2899851_2900949_-	endo-1,4-D-glucanase	NA	NA	NA	NA	NA
AVG13268.1|2901266_2901776_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2962380	2979814	4023351	transposase	Paenibacillus_phage(50.0%)	19	NA	NA
AVG13330.1|2962380_2963604_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13331.1|2963631_2964777_+|transposase	transposase	transposase	A0A0K2CZQ0	Paenibacillus_phage	96.8	2.0e-10
AVG13332.1|2964758_2965229_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13333.1|2965369_2966305_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13334.1|2967584_2967797_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13335.1|2967844_2968402_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG13336.1|2968419_2968929_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG13337.1|2968894_2970832_+	cellulose synthase regulator protein	NA	NA	NA	NA	NA
AVG13338.1|2970828_2971695_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVG13339.1|2971919_2972600_-	putative membrane protein	NA	NA	NA	NA	NA
AVG13340.1|2972596_2972968_-	LrgA family protein	NA	NA	NA	NA	NA
AVG13341.1|2973090_2973984_+	putative HTH-type transcriptional regulator YwbI	NA	NA	NA	NA	NA
AVG13342.1|2974359_2974917_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13343.1|2975027_2976176_-	transglutaminase domain protein	NA	NA	NA	NA	NA
AVG13344.1|2976203_2976659_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13345.1|2976737_2977880_+	exporter-like protein	NA	NA	NA	NA	NA
AVG13346.1|2978083_2978452_+	ribonuclease-like protein	NA	NA	NA	NA	NA
AVG13347.1|2978462_2979212_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG13348.1|2979301_2979814_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
>prophage 28
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2984400	3028389	4023351	transposase,tRNA,coat	Paenibacillus_phage(41.67%)	43	NA	NA
AVG13353.1|2984400_2984880_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AVG13354.1|2984918_2985197_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13355.1|2985284_2986268_+	membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
AVG13356.1|2986404_2986629_-	small, acid-soluble spore protein A	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
AVG13357.1|2987133_2988120_-|tRNA	tryptophan--tRNA ligase TrpS	tRNA	NA	NA	NA	NA
AVG13358.1|2988498_2989917_-	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVG13359.1|2990129_2990768_-	ribonuclease H	NA	NA	NA	NA	NA
AVG13360.1|2991362_2991527_-	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG13361.1|2991591_2992815_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	5.8e-226
AVG13362.1|2993065_2994871_-	oligoendopeptidase, pepF/M3 family	NA	NA	NA	NA	NA
AVG13363.1|2995238_2995532_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13364.1|2995659_2996361_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13365.1|2996388_2996772_-	bacterial globin family protein	NA	NA	NA	NA	NA
AVG13366.1|2996827_2996926_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13367.1|2997083_2998334_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVG13368.1|2998477_2999284_+	putative inorganic polyphosphate/ATP-NAD kinase PpnK	NA	NA	NA	NA	NA
AVG13369.1|2999482_3000142_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	54.3	2.2e-62
AVG13370.1|3000334_3001099_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	4.5e-35
AVG13371.1|3000960_3001380_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13372.1|3001417_3002302_-	lipoyl synthase LipA	NA	NA	NA	NA	NA
AVG13373.1|3002490_3003576_+	peptidase, M23 family	NA	A0A7K9	Microcystis_virus	37.0	5.1e-08
AVG13374.1|3003630_3004449_-	spore formation-associated protein	NA	NA	NA	NA	NA
AVG13375.1|3005099_3006005_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG13376.1|3006388_3007612_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13377.1|3007979_3008732_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVG13378.1|3008869_3009553_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	98.2	1.8e-120
AVG13379.1|3009641_3010580_-	O-acetylserine sulfhydrylase CysK	NA	C3U2M1	Lactococcus_phage	55.7	1.7e-84
AVG13380.1|3010603_3011422_-	RNA methyltransferase, TrmH family	NA	NA	NA	NA	NA
AVG13381.1|3011424_3012084_-	Ktr system potassium uptake protein C	NA	NA	NA	NA	NA
AVG13382.1|3012240_3012450_+	small, acid-soluble spore protein I	NA	NA	NA	NA	NA
AVG13383.1|3012710_3013472_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG13384.1|3013468_3014596_-|coat	spore coat protein SA	coat	NA	NA	NA	NA
AVG13385.1|3014787_3016374_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	34.3	1.0e-12
AVG13386.1|3016491_3017337_-	phosphohydrolase	NA	NA	NA	NA	NA
AVG13387.1|3017648_3019601_-	efflux ABC transporter, permease protein	NA	NA	NA	NA	NA
AVG13388.1|3019575_3020358_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	5.3e-31
AVG13389.1|3020539_3022057_-	lipoprotein-like protein	NA	NA	NA	NA	NA
AVG13390.1|3022172_3023135_-	ABC transporter-like protein	NA	NA	NA	NA	NA
AVG13391.1|3023152_3024082_-	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVG13392.1|3024066_3024432_-	TatD-related deoxyribonuclease	NA	NA	NA	NA	NA
AVG13393.1|3024418_3025981_-	Two component transcriptional regulator, AraC family	NA	NA	NA	NA	NA
AVG13394.1|3025973_3027065_-	HAMP domain protein	NA	NA	NA	NA	NA
AVG13395.1|3027165_3028389_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 29
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3047434	3171165	4023351	tRNA,transposase,integrase	Paenibacillus_phage(40.0%)	115	3106211:3106270	3171138:3172576
AVG13413.1|3047434_3048658_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13414.1|3048874_3049258_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13415.1|3049883_3051107_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13416.1|3051346_3052108_+	hydrolase-like protein	NA	A0A2K9KZN8	Tupanvirus	23.3	3.0e-07
AVG13417.1|3059227_3060127_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13418.1|3060245_3060647_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13419.1|3060835_3062536_-	putative glycosyl hydrolase	NA	NA	NA	NA	NA
AVG13420.1|3062689_3063124_-	peroxide operon regulator	NA	NA	NA	NA	NA
AVG13421.1|3063248_3063848_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13422.1|3063889_3064219_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13423.1|3064169_3064778_-	putative RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AVG13424.1|3065102_3065594_-	GCN5-related N-acetyltransferase	NA	NA	NA	NA	NA
AVG13425.1|3065707_3067156_-|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B	tRNA	NA	NA	NA	NA
AVG13426.1|3067174_3068632_-|tRNA	glutamyl-tRNA(Gln) amidotransferase subunit A	tRNA	NA	NA	NA	NA
AVG13427.1|3068665_3068953_-|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C	tRNA	NA	NA	NA	NA
AVG13428.1|3069168_3070233_+	sensor-like protein	NA	NA	NA	NA	NA
AVG13429.1|3070327_3070708_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13430.1|3070875_3071250_-	aminopeptidase-like protein	NA	NA	NA	NA	NA
AVG13431.1|3071358_3071982_-	metallo-beta-lactamase domain protein	NA	A0A1X9I5D3	Streptococcus_phage	40.9	1.5e-28
AVG13432.1|3072005_3072572_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13433.1|3072687_3073293_-	membrane phosphatase-like protein	NA	NA	NA	NA	NA
AVG13434.1|3073423_3073939_+	Cytochrome c oxidase subunit 2	NA	NA	NA	NA	NA
AVG13435.1|3074139_3074328_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13436.1|3074675_3075254_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVG13437.1|3075391_3075748_+	phage infection protein Pip	NA	NA	NA	NA	NA
AVG13438.1|3075768_3076992_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG13439.1|3077019_3078543_+	putative phosphatase	NA	A0A2I7SCM7	Paenibacillus_phage	75.6	1.1e-11
AVG13440.1|3078542_3079094_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13441.1|3079364_3080156_+	polysaccharide deacetylase, PdaB family	NA	NA	NA	NA	NA
AVG13442.1|3080177_3080870_+	putative L,D-transpeptidase YkuD	NA	NA	NA	NA	NA
AVG13443.1|3081222_3081768_-	putative sporulation protein YyaC	NA	G3M9W0	Bacillus_virus	37.4	7.0e-22
AVG13444.1|3081976_3082093_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13445.1|3082201_3082906_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVG13446.1|3083134_3084358_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13447.1|3085245_3088086_+	putative lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
AVG13448.1|3088078_3089434_+	putative lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
AVG13449.1|3089722_3091039_-	DAACS family dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AVG13450.1|3091157_3091301_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13451.1|3091326_3092310_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13452.1|3092334_3092631_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13453.1|3092651_3094679_-	sodium/proton antiporter, CPA1 family	NA	NA	NA	NA	NA
AVG13454.1|3094718_3094991_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13455.1|3095769_3096567_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13456.1|3096784_3098242_+	cardiolipin synthase	NA	NA	NA	NA	NA
AVG13457.1|3098427_3099513_-	micrococcal nuclease	NA	NA	NA	NA	NA
AVG13458.1|3100123_3100897_-	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AVG13459.1|3100972_3102166_-	protein MalY	NA	NA	NA	NA	NA
AVG13460.1|3102191_3103751_-	PTS system maltose- and glucose-specific EIICB component MalX	NA	NA	NA	NA	NA
AVG13461.1|3104087_3104336_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13462.1|3104516_3104765_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13463.1|3104795_3105035_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13464.1|3105218_3106160_-	hypothetical protein	NA	NA	NA	NA	NA
3106211:3106270	attL	TGAAGTGAACCCCAAATGTTAGACAAATAGTTTTAAGCAGCTGGTGAGGATTGAACTCTG	NA	NA	NA	NA
AVG13465.1|3106242_3106992_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG13466.1|3107081_3107594_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG13467.1|3107656_3107800_-	hypothetical protein	NA	A0A0K2CYN9	Paenibacillus_phage	93.9	3.7e-07
AVG13468.1|3108135_3109359_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13469.1|3109436_3109709_+|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	74.0	1.2e-27
AVG13470.1|3110373_3111108_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13471.1|3111111_3112218_-	pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVG13472.1|3112259_3112925_-	putative inner membrane protein	NA	NA	NA	NA	NA
AVG13473.1|3112927_3113713_-	putative inner membrane protein	NA	NA	NA	NA	NA
AVG13474.1|3113733_3114072_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13475.1|3114075_3114432_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13476.1|3114471_3114834_-	dihydroorotase	NA	NA	NA	NA	NA
AVG13477.1|3115947_3116241_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13478.1|3116307_3117531_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG13479.1|3117788_3117929_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13480.1|3117932_3119285_-	putative DNA-binding protein	NA	S5MC02	Brevibacillus_phage	26.3	1.0e-21
AVG13481.1|3119473_3120253_-	ABC transporter, efflux permease protein	NA	NA	NA	NA	NA
AVG13482.1|3120245_3121184_-	daunorubicin/doxorubicin resistance ATP-binding protein DrrA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	1.3e-20
AVG13483.1|3121240_3122029_-	luciferase family protein	NA	NA	NA	NA	NA
AVG13484.1|3122093_3123317_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13485.1|3123789_3124779_+	putative glycosyltransferase YkoT	NA	B9UDL7	Salmonella_phage	40.3	8.4e-50
AVG13486.1|3124808_3126242_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13487.1|3126542_3126974_+	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVG13488.1|3127070_3127616_-	integral membrane protein, YccS/YhfK family	NA	NA	NA	NA	NA
AVG13489.1|3127929_3128925_-	HTH-type transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVG13490.1|3129110_3130034_-	hydrolase, alpha/beta fold family	NA	NA	NA	NA	NA
AVG13491.1|3130257_3131826_-	1-pyrroline-5-carboxylate dehydrogenase RocA	NA	NA	NA	NA	NA
AVG13492.1|3131852_3132767_-	proline dehydrogenase 1	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
AVG13493.1|3133252_3135463_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.8	1.6e-11
AVG13494.1|3135688_3136609_-	purine nucleosidase	NA	NA	NA	NA	NA
AVG13495.1|3136808_3137372_+	signal peptidase I	NA	NA	NA	NA	NA
AVG13496.1|3137412_3138252_-	putative membrane protein	NA	NA	NA	NA	NA
AVG13497.1|3138305_3138644_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13498.1|3139519_3140473_+	site-specific tyrosine recombinase XerD-like protein	NA	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
AVG13499.1|3140746_3141451_+	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVG13500.1|3141634_3141952_+	putative chloramphenical resistance permease RarD	NA	NA	NA	NA	NA
AVG13501.1|3142351_3143338_-	ATPase, AAA family	NA	NA	NA	NA	NA
AVG13502.1|3143434_3144658_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13503.1|3145278_3146265_-	metal-dependent phosphohydrolase-like protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	25.1	3.7e-05
AVG13504.1|3146307_3148551_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVG13505.1|3148913_3149684_-	ribokinase	NA	NA	NA	NA	NA
AVG13506.1|3149690_3150491_-	purine-cytosine permease-like protein	NA	NA	NA	NA	NA
AVG13507.1|3150794_3151190_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13508.1|3151717_3152380_+	peptidoglycan-binding LysM	NA	A0A0E3T7R5	Bacillus_phage	51.9	1.3e-51
AVG13509.1|3152550_3152982_-	heat shock protein	NA	NA	NA	NA	NA
AVG13510.1|3153095_3153281_-	glycosyltransferase, group 2 family protein	NA	NA	NA	NA	NA
AVG13511.1|3153544_3154285_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13512.1|3154346_3154985_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVG13513.1|3155028_3155643_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.5	2.8e-59
AVG13514.1|3155973_3157197_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG13515.1|3157597_3157957_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13516.1|3158595_3158850_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13517.1|3158904_3159789_-	HTH-type transcriptional regulator YofA	NA	NA	NA	NA	NA
AVG13518.1|3159934_3160246_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG13519.1|3160364_3163061_-	ribonucleoside-diphosphate reductase NrdZ	NA	A0A0K2CP92	Brevibacillus_phage	46.3	3.2e-168
AVG13520.1|3163419_3164268_+	D-alanine aminotransferase Dat	NA	NA	NA	NA	NA
AVG13521.1|3164384_3165227_-	octanoyltransferase LipM	NA	NA	NA	NA	NA
AVG13522.1|3165400_3167200_+	RNA polymerase-associated helicase-like protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	29.3	2.1e-59
AVG13523.1|3167196_3168216_+	S-adenosylmethionine ligase	NA	NA	NA	NA	NA
AVG13524.1|3168337_3169351_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13525.1|3169400_3169652_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13526.1|3169813_3170326_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG13527.1|3170415_3171165_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
3171138:3172576	attR	CAGAGTTCAATCCTCACCAGCTGCTTAAAACTATTTGTCTAACATTTGGGGTTCACTTCAAAACGGCGCAATTGAAGGTCTTTTTATGTCTTATTTCATTGTGAAATTTCCCGGTATTAGTCTCTTCCACCGAAGATAGCAGCGACCAGACGAAGCAGATACAGGAACAGGTTAATGAAATCCAGATAGATGTTAAGGGCAGCCATAGGAACATCTTCTACTGCTACTCCCTCACGGTACTGGCTAACATCATACAGAACCCAGCCGCTGAAAATCAGGACACCTGCACCAGCCCAAAGGATGTTGAACCCGCCTGCGGCAATTGGCAGAAACAGATTAATCAGACTGATAATGATTAATCCGATTGTTGCAGCAAACAGAAAGCCTCCCAGGAAGGAGAAAGCTCTTTTCGAGCGGTGTGCATACAAAGCCAGAGAACCGAAAATGACGGCAGTGGTGATAAATGTACCCGCTACAACGTTAGCTCCGATTTTTGCCCCATACATCATAATAACCGGATACAGGGTCACACCTGAGACAGCTGTAAAGGTATACAGGAAGCCATAGCCAAGTCCGGTCTTTTTCCTAAGGAATAAAGCGGCAATCAACATGCCAAGTTCAATAAAAATAAAAATGGGTACCATCTTCGGGGGAATAAAGTATGCCCCGACCAGCATTCCCAAAAACGAAACCAGAAGGGACAAGGAGAAAGTTCTCAAAATATGAGAAAATGATCCTTTGTCCGAGTACGTCATTGTTTATTCCATGAAACGGTACAACTCCTTTTTATATATATTTTCCTTCTAGAATGTACTGCTTTTGGATAGATTATCAACTTATACGGATTCAAGATGGTACAGGTTTCAAATATCTTTTAAATTTTGTTCTTTACATTTTAATATACCCTATTCGGTTTTCAGACAACCTGACACGGCCCGCTTTCCGAATAATCCGTCAAGTACGGTCCTTATTTCGGGGAATGCTGAGACTTTTCCAGTCTTGGCCCTTCAGCAGCTTCGCTATGTATACGATTTGGCCCACATGATAAGAATAATGGGAGAGCTGCCGGTTTATCGCCTGTACTACGGTATGTGGTTCGTTCCGGATACGGATTATTTTCAGAAGATCCTTTCCCTGAAGCACCTGCAGCGCTTTGTATGTGATAGCCCAACCTCTTTCCCATTGTTCTAATACTTGCCCTTTGCTCCAAGCCTTTGGTAAAAATTCAGCGTCCCGGTCACGGCTTTCTTTCTCCCCGTCAGAGGTCAGAAGATCTTTCCATCTCGACTCCATATTCCCGGCCATATGGGAGACAATCGTGGCGATGCTATTGGACTCCTCATGTGCAGACCATTGAAAGTCCTCGTCCTTTTCAAGCTGAATCATCGATTGATCTCCAAGGCGCTTTGTTTTCTGTAAGGCATGTGTCCATTCCTGAA	NA	NA	NA	NA
>prophage 30
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3189417	3211652	4023351	transposase	Paenibacillus_phage(50.0%)	25	NA	NA
AVG13552.1|3189417_3190641_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG13553.1|3190647_3192045_-	radical SAM domain protein	NA	NA	NA	NA	NA
AVG13554.1|3192164_3192362_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13555.1|3192386_3192527_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
AVG13556.1|3192597_3193155_-	Membrane protein putatively involved in post-translational modification of the autoinducing quorum-sensing peptide	NA	NA	NA	NA	NA
AVG13557.1|3193370_3194108_+	Two-component response regulator LytS-like protein	NA	NA	NA	NA	NA
AVG13558.1|3194114_3195410_+	two-component sensor kinase	NA	NA	NA	NA	NA
AVG13559.1|3196053_3196272_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13560.1|3196268_3196388_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13561.1|3196439_3196661_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13562.1|3197911_3199390_+	ATP-binding cassette efflux transporter-like protein	NA	A0A2K9L0W2	Tupanvirus	25.2	6.5e-30
AVG13563.1|3199545_3200601_-|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	30.9	2.2e-16
AVG13564.1|3200605_3201001_-|transposase	transposase IS200-family protein	transposase	Q332K6	Clostridium_botulinum_C_phage	62.8	7.0e-40
AVG13565.1|3201198_3201309_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13566.1|3201418_3201577_+	Ribosomal RNA large subunit methyltransferase Cfr	NA	NA	NA	NA	NA
AVG13567.1|3202509_3203178_-	Adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
AVG13568.1|3203249_3203483_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13569.1|3203875_3204184_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13570.1|3204310_3204637_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13571.1|3204871_3206095_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13572.1|3206465_3207887_-	PTS system EIIBC component	NA	NA	NA	NA	NA
AVG13573.1|3207960_3208848_-	N-acetylmuramic acid 6-phosphate etherase MurQ	NA	NA	NA	NA	NA
AVG13574.1|3209036_3209546_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG13575.1|3209563_3210121_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG13576.1|3210428_3211652_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
>prophage 31
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3251490	3294150	4023351	tRNA,transposase	Paenibacillus_phage(36.36%)	40	NA	NA
AVG13623.1|3251490_3253470_-|tRNA	methionine--tRNA ligase MetG	tRNA	A0A1V0SHR2	Klosneuvirus	36.9	4.8e-97
AVG13624.1|3253829_3254081_-	putative membrane protein insertion efficiency factor 2	NA	A0A2H4PQM5	Staphylococcus_phage	56.1	7.4e-19
AVG13625.1|3254077_3254494_-	transcriptional regulator, Fur family	NA	NA	NA	NA	NA
AVG13626.1|3254732_3256262_+	spore germination protein KA	NA	NA	NA	NA	NA
AVG13627.1|3256258_3257359_+	spore germination protein YndE	NA	NA	NA	NA	NA
AVG13628.1|3257355_3258486_+	spore germination receptor subunit-like protein	NA	NA	NA	NA	NA
AVG13629.1|3258605_3259451_+	Divergent polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG13630.1|3259641_3260631_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVG13631.1|3260805_3262245_-	putative sodium/glutamine symporter GlnT	NA	NA	NA	NA	NA
AVG13632.1|3263403_3264558_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG13633.1|3264673_3265537_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG13634.1|3265649_3266990_-	putative glycolate oxidase iron-sulfur subunit GlcF	NA	NA	NA	NA	NA
AVG13635.1|3266982_3268344_-	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
AVG13636.1|3268634_3269858_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13637.1|3270083_3270521_-	DNA protection protein	NA	NA	NA	NA	NA
AVG13638.1|3270660_3272283_-	DNA topoisomerase 3	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.5	3.4e-16
AVG13639.1|3272383_3272770_-	DNA topoisomerase 3	NA	NA	NA	NA	NA
AVG13640.1|3272929_3273670_+	response regulator	NA	NA	NA	NA	NA
AVG13641.1|3273980_3275363_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.5	1.9e-47
AVG13642.1|3275470_3275701_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13643.1|3275858_3276737_-	putative fructokinase GmuE	NA	NA	NA	NA	NA
AVG13644.1|3276776_3277766_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
AVG13645.1|3278050_3280174_+	putative cyclic beta-1,2-glucan modification protein	NA	NA	NA	NA	NA
AVG13646.1|3280282_3280624_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13647.1|3280767_3281658_-	Vegetative catalase	NA	A0A2K9L572	Tupanvirus	38.3	7.8e-55
AVG13648.1|3281617_3281911_-	Vegetative catalase	NA	NA	NA	NA	NA
AVG13649.1|3282059_3283283_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13650.1|3283683_3283803_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13651.1|3284000_3284750_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG13652.1|3284839_3285352_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG13653.1|3285540_3286155_+	Anti-sigma-V factor RsiV	NA	NA	NA	NA	NA
AVG13654.1|3286377_3287598_-	anion ABC transporter-like protein	NA	NA	NA	NA	NA
AVG13655.1|3287603_3288293_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG13656.1|3288492_3288783_-	putative dienelactone hydrolase	NA	NA	NA	NA	NA
AVG13657.1|3289248_3289677_+	pyruvate formate-lyase-activating enzyme	NA	NA	NA	NA	NA
AVG13658.1|3289671_3290436_-	putative phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AVG13659.1|3290687_3291911_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13660.1|3292029_3292329_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13661.1|3292343_3292862_-	putative phage DNA-binding protein	NA	NA	NA	NA	NA
AVG13662.1|3292926_3294150_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 32
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3337760	3449054	4023351	tRNA,transposase,protease,coat	Paenibacillus_phage(32.26%)	100	NA	NA
AVG13707.1|3337760_3338984_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
AVG13708.1|3338976_3339180_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	NA	NA	NA	NA
AVG13709.1|3339176_3339413_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13710.1|3339653_3340229_-	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	31.0	3.9e-15
AVG13711.1|3340232_3341090_-	phosphate ABC transporter membrane protein 2, PhoT family	NA	NA	NA	NA	NA
AVG13712.1|3341086_3342031_-	phosphate ABC transporter membrane protein, PhoT family	NA	NA	NA	NA	NA
AVG13713.1|3342259_3343150_-	phosphate ABC transporter, phosphate-binding protein	NA	NA	NA	NA	NA
AVG13714.1|3343865_3344948_-	oxidoreductase, NAD-binding domain protein	NA	NA	NA	NA	NA
AVG13715.1|3345087_3346014_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG13716.1|3346079_3346793_-	alkaline phosphatase synthesis transcriptional regulatory protein PhoP	NA	W8CYM9	Bacillus_phage	37.8	1.1e-38
AVG13717.1|3346900_3348700_-	alkaline phosphatase synthesis sensor protein PhoR	NA	W8CYF6	Bacillus_phage	36.6	1.1e-39
AVG13718.1|3348911_3350333_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13719.1|3350601_3352143_-	fumarate hydratase class I, aerobic	NA	NA	NA	NA	NA
AVG13720.1|3352323_3353475_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVG13721.1|3353779_3354721_-	malate dehydrogenase Mdh	NA	NA	NA	NA	NA
AVG13722.1|3354746_3356045_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	75.9	4.0e-15
AVG13723.1|3356151_3357264_-	citrate synthase 2	NA	NA	NA	NA	NA
AVG13724.1|3357684_3358131_-	acyl-CoA thioesterase-like protein	NA	NA	NA	NA	NA
AVG13725.1|3358307_3360062_-	pyruvate kinase Pyk	NA	NA	NA	NA	NA
AVG13726.1|3360054_3361029_-	acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVG13727.1|3361018_3361885_-	acetyl-coenzyme A carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AVG13728.1|3361979_3362171_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13729.1|3362523_3366180_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.9	7.6e-213
AVG13730.1|3366904_3368128_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13731.1|3368653_3368986_+	Sporulation membrane protein YtrH	NA	NA	NA	NA	NA
AVG13732.1|3368982_3369561_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13733.1|3370009_3371152_-	gamma-D-glutamate-meso-diaminopimelate muropeptidase-like protein	NA	A0A1W6DXV0	Rhodococcus_phage	40.2	6.2e-12
AVG13734.1|3372034_3373258_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13735.1|3373946_3374294_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVG13736.1|3374647_3375190_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13737.1|3375155_3375362_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13738.1|3375433_3376657_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	5.2e-227
AVG13739.1|3376900_3377875_-	isoprenyl transferase-like protein	NA	NA	NA	NA	NA
AVG13740.1|3377896_3378526_-	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVG13741.1|3378522_3380844_-	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVG13742.1|3380942_3381125_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13743.1|3381344_3381497_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13744.1|3381673_3381979_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13745.1|3381962_3383300_-	inosine-5'-monophosphate dehydrogenase GuaB	NA	NA	NA	NA	NA
AVG13746.1|3383454_3383742_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13747.1|3383860_3384103_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13748.1|3386259_3387483_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG13749.1|3387547_3387712_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVG13750.1|3387689_3388049_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13751.1|3388097_3389264_-	putative membrane protein	NA	NA	NA	NA	NA
AVG13752.1|3389393_3390767_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG13753.1|3390775_3391975_+|coat	endospore coat-associated protein YheC	coat	NA	NA	NA	NA
AVG13754.1|3391987_3393358_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG13755.1|3393357_3394476_+|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
AVG13756.1|3394481_3395918_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVG13757.1|3395940_3397167_-	putative membrane protein	NA	NA	NA	NA	NA
AVG13758.1|3397207_3397579_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
AVG13759.1|3397582_3397972_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13760.1|3397987_3398683_-	glycosyltransferase, group 2 family protein	NA	A8CG95	Salmonella_phage	28.0	1.4e-06
AVG13761.1|3399007_3400231_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13762.1|3400607_3401120_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	42.8	9.7e-26
AVG13763.1|3401209_3401959_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	62.2	1.0e-87
AVG13764.1|3402356_3402863_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13765.1|3403862_3405962_+	thermophilic serine proteinase	NA	A0A218KC60	Bacillus_phage	35.9	3.4e-32
AVG13766.1|3406217_3406397_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13767.1|3406545_3408099_-	sporulation kinase E	NA	NA	NA	NA	NA
AVG13768.1|3408320_3408575_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13769.1|3408867_3409407_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13770.1|3409707_3409923_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13771.1|3410507_3411941_-	stage V sporulation protein R	NA	NA	NA	NA	NA
AVG13772.1|3411937_3413089_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.7	5.6e-21
AVG13773.1|3413690_3414350_-	ATP-binding transport protein NatA	NA	A0A2K9L0W2	Tupanvirus	24.0	8.5e-06
AVG13774.1|3414346_3414523_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13775.1|3414725_3415949_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
AVG13776.1|3416275_3416794_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13777.1|3416813_3417149_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13778.1|3417237_3418461_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13779.1|3418590_3418791_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	3.7e-05
AVG13780.1|3419051_3419258_-	putative conjugation protein	NA	NA	NA	NA	NA
AVG13781.1|3419386_3421318_-	zinc-transporting ATPase ZosA	NA	E4ZFI9	Streptococcus_phage	40.6	1.3e-126
AVG13782.1|3421638_3421836_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13783.1|3422258_3423275_+	Phosphatidylglycerol lysyltransferase	NA	NA	NA	NA	NA
AVG13784.1|3423307_3424828_+	Phosphatidylglycerol lysyltransferase	NA	NA	NA	NA	NA
AVG13785.1|3424945_3426841_-	putative serine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	1.3e-102
AVG13786.1|3427092_3427833_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13787.1|3427887_3428871_-	thioredoxin reductase	NA	NA	NA	NA	NA
AVG13788.1|3428910_3429570_-	molybdenum transport permease-like protein	NA	NA	NA	NA	NA
AVG13789.1|3429572_3430508_-	molybdate-binding lipoprotein-like protein	NA	NA	NA	NA	NA
AVG13790.1|3430572_3431796_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13791.1|3432043_3432988_+	molybdate binding regulator-like protein	NA	NA	NA	NA	NA
AVG13792.1|3433361_3433619_-	transcriptional regulator-like protein	NA	A0A2I7SC16	Paenibacillus_phage	43.0	6.2e-13
AVG13793.1|3433824_3434289_-|tRNA	putative tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AVG13794.1|3434460_3435549_-	phosphoserine aminotransferase SerC	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-89
AVG13795.1|3435722_3436331_+	2'-5' RNA-ligase-like protein	NA	NA	NA	NA	NA
AVG13796.1|3436525_3436885_+	putative transporter protein	NA	G3MA03	Bacillus_virus	52.6	1.5e-20
AVG13797.1|3437026_3437197_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13798.1|3437296_3438721_-	glutamine ligase GlnA	NA	NA	NA	NA	NA
AVG13799.1|3439133_3439811_-	deoxyribose-phosphate aldolase DeoC	NA	NA	NA	NA	NA
AVG13800.1|3439893_3441198_-	pyrimidine-nucleoside phosphorylase Pdp	NA	A0A0H3UZD4	Geobacillus_virus	57.4	3.1e-137
AVG13801.1|3441241_3442426_-	pyrimidine nucleoside transport protein NupC	NA	NA	NA	NA	NA
AVG13802.1|3442887_3443856_-	deoxyribonucleoside regulator	NA	NA	NA	NA	NA
AVG13803.1|3444166_3445120_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase IspH	NA	NA	NA	NA	NA
AVG13804.1|3445189_3446695_-	sensory transduction histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	1.4e-24
AVG13805.1|3446695_3447385_-	response regulator MprA	NA	W8CYM9	Bacillus_phage	40.5	2.3e-38
AVG13806.1|3447545_3449054_-|protease	putative serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.1	1.1e-21
>prophage 33
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3477407	3524033	4023351	tRNA,transposase	Paenibacillus_phage(22.22%)	44	NA	NA
AVG13834.1|3477407_3478631_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13835.1|3478841_3482009_-	putative membrane protein	NA	NA	NA	NA	NA
AVG13836.1|3482001_3482913_-	aldo/keto reductase	NA	NA	NA	NA	NA
AVG13837.1|3483087_3484260_-	DGQHR domain protein	NA	NA	NA	NA	NA
AVG13838.1|3484259_3485399_-	DGQHR domain protein	NA	NA	NA	NA	NA
AVG13839.1|3485551_3486598_-	peptidase M50	NA	NA	NA	NA	NA
AVG13840.1|3486613_3486982_-	Modulator of the general stress response	NA	M1PLC0	Streptococcus_phage	43.5	1.7e-19
AVG13841.1|3487043_3487976_-	putative RNA pseudouridine synthase YlyB	NA	NA	NA	NA	NA
AVG13842.1|3487972_3488542_-	Cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AVG13843.1|3488557_3490174_-	cobyric acid synthase CobQ	NA	NA	NA	NA	NA
AVG13844.1|3491301_3492105_-	cobalamin synthase CobS	NA	NA	NA	NA	NA
AVG13845.1|3492086_3492821_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AVG13846.1|3492905_3493082_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AVG13847.1|3493084_3493660_-	bifunctional adenosylcobalamin biosynthesis protein CobP	NA	NA	NA	NA	NA
AVG13848.1|3493792_3494839_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase CobT	NA	NA	NA	NA	NA
AVG13849.1|3494896_3495685_-	putative ABC transporter ATP-binding protein YvrA	NA	G3M9Y6	Bacillus_virus	26.3	9.8e-17
AVG13850.1|3495686_3496727_-	putative ABC transporter permease protein YvrB	NA	NA	NA	NA	NA
AVG13851.1|3496749_3497745_-	putative ABC transporter substrate-binding lipoprotein YvrC	NA	NA	NA	NA	NA
AVG13852.1|3498236_3498542_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13853.1|3498936_3499200_-	Spo0E like sporulation regulatory protein	NA	NA	NA	NA	NA
AVG13854.1|3499284_3500490_-	putative aminotransferase YugH	NA	A0A1X6WGT4	Pacmanvirus	24.4	1.8e-06
AVG13855.1|3500505_3500997_-	transcriptional regulator, AsnC family	NA	NA	NA	NA	NA
AVG13856.1|3501260_3501542_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13857.1|3501769_3503101_-	transporter, major facilitator family protein	NA	NA	NA	NA	NA
AVG13858.1|3503127_3504315_-	putative lipoprotein YufN	NA	NA	NA	NA	NA
AVG13859.1|3504346_3504841_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13860.1|3504973_3505393_-	membrane protein YshE	NA	NA	NA	NA	NA
AVG13861.1|3505492_3506164_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AVG13862.1|3506276_3508640_-	MutS2 protein MutS2	NA	Q94M10	Lactobacillus_phage	37.9	1.8e-13
AVG13863.1|3508963_3509332_+	Membrane protein of unknown function	NA	NA	NA	NA	NA
AVG13864.1|3509573_3509936_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AVG13865.1|3510016_3510550_-	cvpA family protein	NA	NA	NA	NA	NA
AVG13866.1|3510561_3513462_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AVG13867.1|3513568_3516019_-|tRNA	phenylalanine--tRNA ligase beta chain PheT	tRNA	NA	NA	NA	NA
AVG13868.1|3516042_3517071_-|tRNA	phenylalanine--tRNA ligase alpha chain PheS	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
AVG13869.1|3518171_3518687_-	type I signal peptidase-like protein	NA	NA	NA	NA	NA
AVG13870.1|3518854_3519778_+	putative oxidoreductase YajO	NA	NA	NA	NA	NA
AVG13871.1|3519884_3520181_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVG13872.1|3520416_3520995_+|transposase	transposase-like protein	transposase	A0A1B1P773	Bacillus_phage	40.6	1.5e-35
AVG13873.1|3521125_3521626_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.2	5.2e-24
AVG13874.1|3521903_3522221_-|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
AVG13875.1|3522379_3522520_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13876.1|3522523_3522745_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVG13877.1|3522809_3524033_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 34
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3532477	3585272	4023351	transposase,bacteriocin,integrase	Paenibacillus_phage(35.71%)	52	3532434:3532493	3549697:3551087
3532434:3532493	attL	GATCAAGTCCAAATTTGTGTGTAAATTCCCTCAGCTAGACTGTGCTACATAATGCGAGTC	NA	NA	NA	NA
AVG13886.1|3532477_3533701_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13887.1|3534570_3534672_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13888.1|3534831_3535593_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13889.1|3535871_3537095_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13890.1|3537605_3537986_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13891.1|3538129_3539035_+|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.0	6.2e-92
AVG13892.1|3539048_3540788_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.9	8.0e-96
AVG13893.1|3540829_3541339_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG13894.1|3541356_3541914_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG13895.1|3542313_3542814_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.2	5.2e-24
AVG13896.1|3543360_3543522_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13897.1|3543707_3544889_+	putative membrane protein	NA	NA	NA	NA	NA
AVG13898.1|3545004_3545658_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13899.1|3545932_3546640_-	cAMP-binding protein	NA	NA	NA	NA	NA
AVG13900.1|3546711_3546876_-	Rubredoxin-2	NA	NA	NA	NA	NA
AVG13901.1|3547199_3548096_-	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
AVG13902.1|3548488_3549712_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13903.1|3550180_3550882_+	nitric oxide-dependent regulator	NA	NA	NA	NA	NA
AVG13904.1|3551485_3552709_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
3549697:3551087	attR	GACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATCGAAGGGAACCTCGCGGCAATCAATCTTTCCTACCCAGTAAATATCTTTGGACAACTTAATTTCAGTTTGCACTGGAATAACCTCCTGCTGATCATTTTAACGGCACCCTAATTCTACGCCTACTTGCTGGAAAAAAAGAGGATTCAAATCAAATTTTACGAAATAACAAAATGGTTCCTTAGCGGAGTGAGATCTGATCCGAAAAATAACCTTCTCAAGTTCAAGAATATCAGAAGAACAAATTCACTAAACGTATTATCAGGAAGAACAGGAGCAATAAATCCGAGATTTACCAAGGTTTGGCGAAACAAACGAAGTCACAAGCGAAAAACTGTAATAGTTTGATTTGCATTGATCCTAATCATTACCAAGAATACCGTATTATAATAGCCTTGTACTTGAATTAAATAAAGGAGGACCTATAATGACCTTTACTGCTCAAAGCAAAATCCGAGACATTGTCATACAGTTTCCCAAAGCAAGTGATTATTTTAAAACCCATAAAATTGACTTTTGCTGTGGAGGAAACAAGCCTTTGGAGGAAGTAGCAAAACAGCATGGATTGGATGTTAATGACCTTCTACGTGATATCCAGCACCTTCAGATGAAGAACGTTGAAAATCGGTCCGGTACGCCTGATCCTGCACATCTGTCTTCTACTGACCTTATTGATTTAATTGTGGACAAACACCACGCTTACTTGCGCGAGGAGCTTCCCCAGTTAGATACTTATGTAACCAAGGTGTTTCATGTTCACGGAGAAAATCATGTTCATCTGCAGGAAGTTTTCCGTTTATTTCGTGCTTTACGAACCGAACTGGAGCAGCATACCCTTAAGGAGGAGACTATTTCTTTTCCACAGATTCAAGCCTACGAAAATAAACCGTCGGAAGAAAGTAGAAACCTGCTTGCTGACACGATCAGGGAACTGGAGAAAGAGCATGATGAAGCGGGCCACTTGCTTAAAGAAATCCGCCGCGTAACTTCCGACTTTACATTACCTGAAGGCGCCTGCACCACTTACCAGATCACTTACCACCGTCTAGAGGAATTGGAATCTATGACTTTTGAGCATGTGCATTTAGAGAATAATATTCTTTTTCCACGGTATACTGAGTATCGGTGAATTCGATGAGACAAATACAAAGGAAAGCCCACCGGAGAACGGTGACTGTGACCTGCAAGAATGTCACTTTAAAAAGTGGCTGTCCTAAAAGTTATTGAAGTACCCCCGTCAAGTAGACAGAAATAAAATAACATCTATTATAAAGCCTTAGTTCGAACTTTCACCCGGATTAAGGCTGGTTTAACTTGTTTGCAGTATGGATATT	NA	NA	NA	NA
AVG13905.1|3553184_3553664_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13906.1|3554053_3554410_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13907.1|3554803_3556492_-	copper resistance protein CopC	NA	NA	NA	NA	NA
AVG13908.1|3556664_3556949_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13909.1|3557672_3557915_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13910.1|3558204_3559011_+	histidine kinase	NA	NA	NA	NA	NA
AVG13911.1|3559007_3559685_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVG13912.1|3559774_3560398_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13913.1|3560454_3562881_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.0	8.2e-115
AVG13914.1|3562975_3563176_-	copper insertion chaperone and transporter component-like protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
AVG13915.1|3563196_3563505_-	Copper-sensitive operon repressor	NA	NA	NA	NA	NA
AVG13916.1|3563573_3564059_-	dihydrofolate reductase DfrA	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
AVG13917.1|3564113_3565070_-	thymidylate synthase ThyA	NA	A0A0N9SH48	Staphylococcus_phage	63.7	6.7e-121
AVG13918.1|3565099_3565369_-	ribokinase-like protein	NA	NA	NA	NA	NA
AVG13919.1|3565683_3566118_-	UspA domain-containing protein	NA	NA	NA	NA	NA
AVG13920.1|3566339_3566729_-	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVG13921.1|3567343_3568450_+	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVG13922.1|3568490_3569846_+	putative glycine dehydrogenase [decarboxylating] subunit 1	NA	E3SN07	Prochlorococcus_phage	38.4	1.4e-55
AVG13923.1|3569842_3571309_+	putative glycine dehydrogenase [decarboxylating] subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	6.8e-80
AVG13924.1|3571669_3572209_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13925.1|3572350_3573745_-	sporulation kinase A	NA	NA	NA	NA	NA
AVG13926.1|3573957_3575070_-	sigmaI modulating factor-like protein	NA	NA	NA	NA	NA
AVG13927.1|3575062_3575881_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
AVG13928.1|3576100_3577060_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13929.1|3577314_3577740_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13930.1|3577849_3579073_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
AVG13931.1|3579323_3579524_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13932.1|3579570_3581541_+	glycosyl hydrolase, family 15	NA	NA	NA	NA	NA
AVG13933.1|3581578_3581974_-	glycine cleavage system H protein GcvH	NA	NA	NA	NA	NA
AVG13934.1|3582118_3582664_-	thioredoxin-like protein YkuU	NA	NA	NA	NA	NA
AVG13935.1|3582888_3583977_-	3-isopropylmalate dehydrogenase LeuB	NA	NA	NA	NA	NA
AVG13936.1|3584328_3584658_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13937.1|3584936_3585272_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 35
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3622988	3672107	4023351	transposase	Paenibacillus_phage(35.71%)	54	NA	NA
AVG13979.1|3622988_3624212_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG13980.1|3624585_3626529_-	ABC-type antimicrobial peptide transport system, permease component	NA	NA	NA	NA	NA
AVG13981.1|3626515_3627286_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	9.5e-33
AVG13982.1|3627537_3628128_-	putative lipoprotein	NA	NA	NA	NA	NA
AVG13983.1|3628676_3628997_+	small acid soluble protein	NA	NA	NA	NA	NA
AVG13984.1|3629060_3629507_+	heat shock protein	NA	NA	NA	NA	NA
AVG13985.1|3629508_3630048_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13986.1|3630127_3630352_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13987.1|3630348_3630870_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13988.1|3630894_3631194_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13989.1|3631817_3632573_+	hypothetical protein	NA	NA	NA	NA	NA
AVG13990.1|3632588_3633296_+	ABC transporter-like protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	2.0e-08
AVG13991.1|3633406_3633697_-	hypothetical protein	NA	NA	NA	NA	NA
AVG13992.1|3633797_3634028_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVG13993.1|3634099_3634738_-	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	44.0	1.7e-35
AVG13994.1|3634930_3636283_-	glucose-6-phosphate isomerase Pgi	NA	NA	NA	NA	NA
AVG13995.1|3636432_3637521_+	putative 2-hydroxy-3-oxopropionate reductase GarR	NA	NA	NA	NA	NA
AVG13996.1|3637584_3639609_-	transketolase Tkt	NA	A0A2K9L6P9	Tupanvirus	23.6	1.2e-15
AVG13997.1|3639732_3640629_-	formyltetrahydrofolate deformylase PurU	NA	NA	NA	NA	NA
AVG13998.1|3640667_3641813_-	putative endonuclease 4	NA	A0A2H4UU70	Bodo_saltans_virus	31.1	2.0e-26
AVG13999.1|3642020_3642446_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14000.1|3642718_3642931_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14001.1|3642942_3643833_-	beta-lactamase domain-containing protein	NA	Q332B9	Clostridium_botulinum_C_phage	46.4	5.8e-58
AVG14002.1|3644101_3644452_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14003.1|3644553_3646071_+	PTS system glucose-specific EIICBA component PtsG	NA	NA	NA	NA	NA
AVG14004.1|3646149_3646323_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14005.1|3646797_3648021_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
AVG14006.1|3648048_3648855_+	putative transcriptional regulatory protein YclJ	NA	W8CYM9	Bacillus_phage	41.4	4.2e-39
AVG14007.1|3648851_3650627_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	33.3	3.3e-28
AVG14008.1|3650747_3651578_+	putative polysaccharide deacetylase YheN	NA	NA	NA	NA	NA
AVG14009.1|3653107_3653374_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14010.1|3653557_3653803_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14011.1|3653812_3654343_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14012.1|3654847_3656071_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14013.1|3656063_3656333_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14014.1|3656652_3656895_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14015.1|3657000_3658149_-	mannitol-1-phosphate 5-dehydrogenase MtlD	NA	NA	NA	NA	NA
AVG14016.1|3658150_3658591_-	mannitol-specific phosphotransferase enzyme IIA component MtlF	NA	NA	NA	NA	NA
AVG14017.1|3658634_3660755_-	transcriptional regulator MtlR	NA	NA	NA	NA	NA
AVG14018.1|3660840_3662289_-	PTS system mannitol-specific EIICB component MtlA	NA	NA	NA	NA	NA
AVG14019.1|3662832_3663108_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14020.1|3663635_3664118_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14021.1|3664216_3664645_-	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	54.8	8.4e-23
AVG14022.1|3664817_3665189_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14023.1|3665221_3666445_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14024.1|3666559_3666742_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14025.1|3666716_3667100_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14026.1|3667116_3668073_-	multidrug resistance protein	NA	NA	NA	NA	NA
AVG14027.1|3668284_3668410_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14028.1|3668498_3668951_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVG14029.1|3669096_3669321_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14030.1|3669812_3670148_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG14031.1|3670254_3670779_+	glycosyl transferase	NA	NA	NA	NA	NA
AVG14032.1|3670883_3672107_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
>prophage 36
CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3866313	3926281	4023351	tRNA,transposase,protease,bacteriocin	Paenibacillus_phage(28.57%)	57	NA	NA
AVG14200.1|3866313_3866874_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVG14201.1|3867014_3867215_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14202.1|3867317_3868001_-	ankyrin-repeat containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	70.2	6.9e-11
AVG14203.1|3868028_3869252_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14204.1|3869306_3869480_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14205.1|3869728_3870328_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVG14206.1|3870406_3871804_-	bifunctional protein GlmU	NA	M1PC96	Moumouvirus	33.0	2.3e-29
AVG14207.1|3871932_3872217_-	putative septation protein SpoVG	NA	NA	NA	NA	NA
AVG14208.1|3872332_3872722_-	RutC family protein YabJ	NA	NA	NA	NA	NA
AVG14209.1|3872741_3873563_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
AVG14210.1|3873724_3874582_-	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase IspE	NA	NA	NA	NA	NA
AVG14211.1|3874692_3874875_-	Small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
AVG14212.1|3875094_3875370_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14213.1|3875614_3876493_-|protease	sporulation-specific protease YabG	protease	NA	NA	NA	NA
AVG14214.1|3876543_3877449_-	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AVG14215.1|3877445_3878000_-	ribonuclease M5-like protein	NA	NA	NA	NA	NA
AVG14216.1|3878117_3879269_-	3D domain protein	NA	S6BUU4	Bacillus_phage	45.2	8.1e-12
AVG14217.1|3880021_3880765_+	ABC-type transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	4.6e-24
AVG14218.1|3880764_3881979_+	protein EcsB	NA	NA	NA	NA	NA
AVG14219.1|3881971_3882739_-	hydrolase, TatD family protein	NA	NA	NA	NA	NA
AVG14220.1|3882776_3884042_-	metal-dependent phosphohydrolase	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.9	6.6e-23
AVG14221.1|3884388_3884643_+	transition state regulatory protein AbrB	NA	A0A0K2CZ86	Paenibacillus_phage	66.7	1.5e-22
AVG14222.1|3884767_3885637_-	ribosomal RNA small subunit methyltransferase I	NA	M1PLC5	Streptococcus_phage	46.7	6.4e-62
AVG14223.1|3885647_3886403_-	putative methyltransferase	NA	NA	NA	NA	NA
AVG14224.1|3886493_3886829_-	initiation-control protein YabA	NA	NA	NA	NA	NA
AVG14225.1|3886847_3887657_-	stage 0 sporulation protein YaaT	NA	NA	NA	NA	NA
AVG14226.1|3887659_3888637_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	38.0	1.1e-25
AVG14227.1|3888688_3889135_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14228.1|3889181_3889511_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14229.1|3889543_3890209_-	thymidylate kinase Tmk	NA	M1PSC7	Streptococcus_phage	44.6	5.1e-43
AVG14230.1|3890279_3891749_-	lysine decarboxylase-like protein	NA	NA	NA	NA	NA
AVG14231.1|3891943_3892129_-	Inhibitor of sigma-G Gin	NA	NA	NA	NA	NA
AVG14232.1|3892295_3892811_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14233.1|3899014_3899872_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVG14234.1|3900864_3902454_-	galactose-1-phosphate uridylyltransferase GalT	NA	NA	NA	NA	NA
AVG14235.1|3902473_3903463_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	38.9	9.6e-54
AVG14236.1|3903464_3904607_-	galactokinase GalK	NA	NA	NA	NA	NA
AVG14237.1|3904853_3905720_+	Msm operon regulatory protein MsmR	NA	NA	NA	NA	NA
AVG14238.1|3905952_3906915_-	putative ABC transporter permease protein YufQ	NA	NA	NA	NA	NA
AVG14239.1|3906915_3907995_-	putative ABC transporter permease protein YufP	NA	NA	NA	NA	NA
AVG14240.1|3907984_3909532_-	putative ABC transporter ATP-binding protein YufO	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.0	2.2e-12
AVG14241.1|3909674_3910700_-	putative lipoprotein YufN	NA	A0A0A7DN02	Lactobacillus_phage	31.2	9.4e-36
AVG14242.1|3910977_3912234_-	threonine dehydratase biosynthetic	NA	NA	NA	NA	NA
AVG14243.1|3912535_3912880_+	hypothetical protein	NA	NA	NA	NA	NA
AVG14244.1|3912788_3913097_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14245.1|3913142_3914366_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
AVG14246.1|3914646_3916716_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheH	NA	W8CYL7	Bacillus_phage	29.5	5.3e-46
AVG14247.1|3916712_3918473_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheI	NA	W8CYL7	Bacillus_phage	28.2	9.1e-47
AVG14248.1|3918642_3918786_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14249.1|3919065_3919608_-	Glyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	52.0	2.1e-50
AVG14250.1|3919680_3919896_-	Glyoxal reductase	NA	A0A1V0SKP9	Klosneuvirus	49.1	6.5e-08
AVG14251.1|3920046_3920325_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14252.1|3920336_3920990_-	ABC-type transporter ATP-binding protein EcsA	NA	A0A076FI99	Aureococcus_anophage	27.6	1.1e-10
AVG14253.1|3921205_3922429_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14254.1|3922754_3923039_-	hypothetical protein	NA	NA	NA	NA	NA
AVG14255.1|3923541_3924765_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14256.1|3926041_3926281_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
CP019653	Paenibacillus larvae subsp. larvae DSM 25430 plasmid unnamed1, complete sequence	21567	10304	19765	21567	transposase	Paenibacillus_phage(66.67%)	8	NA	NA
AVG14359.1|10304_11528_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14360.1|11694_12465_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
AVG14361.1|12636_13860_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14362.1|14477_15701_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVG14363.1|15743_16079_-	MurPQ operon repressor	NA	NA	NA	NA	NA
AVG14364.1|16114_16795_-	putative N-acetylmannosamine-6-phosphate 2-epimerase NanE	NA	NA	NA	NA	NA
AVG14365.1|16799_18332_-	PTS system glucose-specific EIICBA component PtsG	NA	A0A2I7SAJ6	Vibrio_phage	52.1	6.5e-09
AVG14366.1|18541_19765_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
