The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	0	61101	5368065	holin,terminase,tail,integrase	Salmonella_phage(34.33%)	76	14911:14970	56248:56454
AUX54625.1|1638_1944_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
AUX54626.1|2028_2967_-	hypothetical protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
AUX54627.1|4119_4764_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AUX54628.1|4760_4952_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59766.1|4935_5346_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
AUX54629.1|5538_5883_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
AUX54630.1|6002_6788_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AUX54631.1|6784_7552_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AUX54632.1|7551_7761_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AUX54633.1|7907_8141_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
AUX54634.1|8295_8877_+	transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
AUX54635.1|9251_9551_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	51.5	1.3e-17
AUX54636.1|9547_10369_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	2.0e-134
AUX54637.1|10365_11247_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	7.1e-133
AUX54638.1|11295_11544_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
AUX54639.1|11653_11947_+	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
AUX54640.1|11939_12098_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
AUX54641.1|12094_12688_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
AUX54642.1|12684_13455_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
AUX54643.1|13451_13643_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54644.1|13659_14910_-|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
14911:14970	attL	ATTTCACCCGTGATGCATCATTTTTTCTGACGGTACGAGAGTATACCGTAATGGTAATAC	NA	NA	NA	NA
AUX54645.1|15227_15710_-	endopeptidase	NA	Q858E9	Salmonella_phage	77.5	4.8e-59
AUX54646.1|15706_16336_-	endolysin	NA	Q858F0	Salmonella_phage	77.9	1.6e-91
AUX54647.1|16325_16631_-|holin	holin	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AUX54648.1|16617_17022_-	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	6.0e-55
AUX54649.1|17131_17470_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59767.1|20118_20415_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AUX54650.1|20513_20666_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AUX54651.1|20700_20997_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	4.4e-47
AUX54652.1|21195_23670_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
AUX54653.1|23673_25476_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	76.6	1.4e-249
AUX54654.1|25472_28286_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.6	0.0e+00
AUX54655.1|28296_28836_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AUX54656.1|28835_29300_-	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	5.8e-70
AUX54657.1|29299_31777_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
AUX54658.1|31776_32382_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	1.1e-87
AUX54659.1|32381_32705_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	3.1e-46
AUX54660.1|32755_33097_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
AUX54661.1|33107_33545_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AUX54662.1|33598_34585_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	3.3e-179
AUX54663.1|34599_35280_-	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AUX54664.1|35282_35579_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AUX54665.1|35575_37258_-|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AUX54666.1|37272_37479_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AUX54667.1|37498_37687_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54668.1|37940_38183_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54669.1|38214_39690_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.5	1.3e-280
AUX54670.1|39686_40271_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
AUX54671.1|40328_40658_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	5.1e-28
AUX54672.1|40812_41064_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54673.1|41063_42548_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX54674.1|42644_42983_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
AUX54675.1|42975_43281_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
AUX54676.1|43365_44304_-	hypothetical protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
AUX54677.1|45456_46101_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AUX54678.1|46097_46289_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59768.1|46272_46683_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
AUX54679.1|46875_47220_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
AUX54680.1|47339_48125_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AUX54681.1|48121_48889_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AUX54682.1|48888_49098_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AUX54683.1|49244_49478_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
AUX54684.1|49632_50214_+	transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
AUX54685.1|50588_50888_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	51.5	1.3e-17
AUX54686.1|50884_51706_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	2.0e-134
AUX54687.1|51702_52584_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	7.1e-133
AUX54688.1|52632_52881_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
AUX54689.1|52990_53284_+	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
AUX54690.1|53276_53435_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
AUX54691.1|53431_54025_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
AUX54692.1|54021_54792_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
AUX54693.1|54788_54980_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54694.1|54996_56247_-|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
AUX54695.1|56439_58017_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
56248:56454	attR	ATTTCACCCGTGATGCATCATTTTTTCTGACGGTACGAGAGTATACCGTAATGGTAATACCGTCAGGTATACCGTCAAAAAATGTGAGATAGAGTGAATAGTGTTGAAGTGATATAAAGAAAAACCCCCTGTAAAAACAGAGGGTTAAATTTCAATTTGAGTAGATATGATTAGCTATAGGGTAGCCGTTAATCATTCCCACTCAAT	NA	NA	NA	NA
AUX54696.1|58084_59551_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AUX54697.1|59709_61101_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
>prophage 2
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	71421	71853	5368065		Powai_lake_megavirus(100.0%)	1	NA	NA
AUX54707.1|71421_71853_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 3
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	82365	88686	5368065		Mycoplasma_phage(20.0%)	8	NA	NA
AUX54713.1|82365_83652_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
AUX54714.1|83722_83923_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUX54715.1|83924_84260_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AUX54716.1|84261_86112_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
AUX54717.1|86127_86643_-	co-chaperone HscB	NA	NA	NA	NA	NA
AUX54718.1|86717_87041_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AUX54719.1|87058_87445_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AUX54720.1|87471_88686_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 4
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	103933	126001	5368065	tRNA	Bacillus_phage(25.0%)	21	NA	NA
AUX54733.1|103933_105187_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
AUX54734.1|105205_105403_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54735.1|105512_106703_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUX54736.1|106776_107115_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX54737.1|107180_108518_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AUX54738.1|108504_109191_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54739.1|109220_110642_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AUX54740.1|111232_115120_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AUX54741.1|115295_116912_+	lytic transglycosylase F	NA	NA	NA	NA	NA
AUX54742.1|116908_117451_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AUX54743.1|117480_118116_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AUX54744.1|118329_119178_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUX54745.1|119234_119495_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
AUX54746.1|119507_119888_-	holo-ACP synthase	NA	NA	NA	NA	NA
AUX54747.1|119887_120619_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUX54748.1|120630_121368_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AUX54749.1|121379_122285_-	GTPase Era	NA	NA	NA	NA	NA
AUX54750.1|122281_122962_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AUX54751.1|122905_123034_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54752.1|123211_124186_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AUX54753.1|124201_126001_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 5
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	130901	210500	5368065	tail,capsid,coat,head,tRNA,portal,integrase,plate	Salmonella_phage(72.0%)	90	175596:175642	212161:212207
AUX54759.1|130901_131639_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AUX54760.1|131770_133102_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AUX54761.1|133147_133531_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AUX54762.1|133844_134534_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AUX54763.1|134591_135677_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUX54764.1|135880_136306_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AUX54765.1|136375_137074_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUX54766.1|137108_139760_+	protein acetyltransferase	NA	NA	NA	NA	NA
AUX54767.1|139880_141236_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AUX54768.1|141277_141601_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54769.1|141604_142903_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AUX54770.1|143117_143231_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54771.1|148868_151442_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AUX54772.1|151571_152303_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54773.1|152299_153280_-	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AUX54774.1|153411_154149_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUX54775.1|154419_154755_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AUX54776.1|155009_156170_+	chorismate mutase	NA	NA	NA	NA	NA
AUX54777.1|156166_157039_-	gluconolactonase	NA	NA	NA	NA	NA
AUX54778.1|157101_158223_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUX54779.1|158232_159303_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AUX54780.1|159645_160155_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54781.1|160147_161371_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUX54782.1|161384_161867_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54783.1|161875_163246_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54784.1|163302_163761_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54785.1|163750_163888_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54786.1|163880_164228_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUX54787.1|164267_165035_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUX54788.1|165066_165615_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUX54789.1|165633_165882_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUX54790.1|166141_167506_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUX54791.1|167669_168461_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54792.1|168480_169767_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUX54793.1|169886_170477_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUX54794.1|170601_171480_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUX54795.1|171566_173228_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUX54796.1|173253_173394_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54797.1|173375_173717_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUX54798.1|173783_174074_-	RnfH family protein	NA	NA	NA	NA	NA
AUX54799.1|174063_174540_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUX54800.1|174650_175133_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
175596:175642	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AUX54801.1|175736_176114_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54802.1|176141_176360_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AUX54803.1|176426_177521_-	late control protein D	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AUX54804.1|177517_178003_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AUX59770.1|177999_180396_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
AUX54805.1|180622_180742_-|tail	phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AUX54806.1|180756_181056_-	hypothetical protein	NA	E5G6P9	Salmonella_phage	78.0	8.2e-33
AUX54807.1|181108_181624_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AUX54808.1|181633_182806_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AUX54809.1|182954_184028_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AUX54810.1|184079_185198_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	2.0e-55
AUX54811.1|185207_187157_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AUX54812.1|187158_187830_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AUX54813.1|187822_188731_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AUX54814.1|188717_189080_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AUX54815.1|189076_189649_-|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AUX54816.1|189743_190610_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54817.1|190632_191079_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AUX54818.1|191071_191494_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AUX59772.1|191456_191615_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
AUX54819.1|191589_192018_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AUX54820.1|192014_192398_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AUX54821.1|192402_192912_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AUX59771.1|192892_193108_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AUX54822.1|193111_193315_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AUX54823.1|193314_193779_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AUX54824.1|193874_194528_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AUX54825.1|194531_195584_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AUX54826.1|195600_196434_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AUX54827.1|196574_198338_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AUX54828.1|198337_199381_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AUX59773.1|199437_199707_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AUX54829.1|200227_201229_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54830.1|201228_202308_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54831.1|202337_202544_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54832.1|202755_202977_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54833.1|203072_203306_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AUX54834.1|203317_203506_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AUX54835.1|203668_206053_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AUX54836.1|206049_206901_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AUX54837.1|206897_207125_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AUX54838.1|207124_207358_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AUX54839.1|207425_207764_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AUX54840.1|207727_207928_-	protein fil	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AUX54841.1|207935_208445_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AUX54842.1|208477_208720_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AUX54843.1|208842_209472_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AUX54844.1|209474_210500_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
212161:212207	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 6
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	225865	227386	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX54858.1|225865_227386_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 7
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	249543	250446	5368065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUX54876.1|249543_250446_-	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 8
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	255627	260926	5368065		Lactobacillus_phage(25.0%)	5	NA	NA
AUX54884.1|255627_255873_+	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
AUX54885.1|255869_256280_+	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AUX54886.1|256252_258394_+	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
AUX54887.1|258404_259367_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
AUX54888.1|259723_260926_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 9
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	275644	283882	5368065	tRNA	Vibrio_phage(20.0%)	8	NA	NA
AUX54904.1|275644_275830_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUX54905.1|276193_278821_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
AUX54906.1|279071_279572_-	recombination regulator RecX	NA	NA	NA	NA	NA
AUX54907.1|279639_280698_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
AUX54908.1|280788_281286_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
AUX54909.1|281425_282304_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX54910.1|282311_283175_-	iron ABC transporter	NA	NA	NA	NA	NA
AUX54911.1|283171_283882_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.4e-06
>prophage 10
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	289634	290600	5368065		Tetraselmis_virus(100.0%)	1	NA	NA
AUX54919.1|289634_290600_+	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 11
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	317541	318942	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX54947.1|317541_318942_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 12
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	329307	330129	5368065		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUX54958.1|329307_330129_+	manganese/iron transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 13
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	341873	347037	5368065		Cedratvirus(50.0%)	5	NA	NA
AUX54970.1|341873_342653_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
AUX54971.1|342931_343414_+	Hcp family T6SS protein CtsH1	NA	NA	NA	NA	NA
AUX54972.1|343425_343875_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54973.1|343859_344207_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUX54974.1|344475_347037_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 14
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	350506	356925	5368065		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AUX54978.1|350506_351394_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
AUX54979.1|351502_352705_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54980.1|352701_353079_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUX54981.1|353131_354124_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AUX54982.1|354281_355418_-	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AUX54983.1|355543_356170_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
AUX54984.1|356163_356925_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 15
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	359995	362028	5368065		Tupanvirus(50.0%)	2	NA	NA
AUX54990.1|359995_360601_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
AUX54991.1|360600_362028_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 16
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	370794	376131	5368065		Vibrio_phage(33.33%)	5	NA	NA
AUX55000.1|370794_371466_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
AUX55001.1|371628_371757_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55002.1|371940_373050_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AUX55003.1|373113_374412_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AUX55004.1|374493_376131_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 17
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	379673	385139	5368065		Erysipelothrix_phage(33.33%)	3	NA	NA
AUX55007.1|379673_380978_-	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
AUX55008.1|381091_383842_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
AUX55009.1|383999_385139_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 18
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	392553	393399	5368065		Vibrio_phage(100.0%)	1	NA	NA
AUX55017.1|392553_393399_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 19
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	403653	404676	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX55027.1|403653_404676_-	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 20
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	411080	411836	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX55033.1|411080_411836_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 21
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	423380	425881	5368065	tRNA	environmental_halophage(50.0%)	3	NA	NA
AUX55046.1|423380_424586_+	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
AUX55047.1|424585_425017_+	cysteine desulfurase, sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AUX55048.1|425059_425881_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 22
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	430826	431651	5368065		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AUX55053.1|430826_431651_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 23
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	464302	469567	5368065		Deep-sea_thermophilic_phage(50.0%)	4	NA	NA
AUX55093.1|464302_465556_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
AUX55094.1|465783_467115_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AUX55095.1|467344_467665_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55096.1|467722_469567_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
>prophage 24
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	473096	475982	5368065		Hokovirus(100.0%)	1	NA	NA
AUX55097.1|473096_475982_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 25
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	483417	493413	5368065		Hokovirus(33.33%)	9	NA	NA
AUX55103.1|483417_485664_-	phosphoenolpyruvate--protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
AUX55104.1|485676_486207_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUX59779.1|486660_486804_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55105.1|486889_487585_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AUX55106.1|487648_488362_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
AUX55107.1|488485_488704_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55108.1|488924_489965_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUX55109.1|490067_491261_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AUX55110.1|491253_493413_-	bifunctional 2-acylglycerophosphoethanolamine acyltransferase/acyl-ACP synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 26
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	499400	500402	5368065		Enterobacteria_phage(100.0%)	1	NA	NA
AUX59780.1|499400_500402_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	5.9e-27
>prophage 27
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	506116	507244	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX55123.1|506116_507244_+	sugar ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 28
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	513007	516478	5368065		Enterobacteria_phage(33.33%)	3	NA	NA
AUX55128.1|513007_514003_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
AUX55129.1|513999_515421_-	arabinose:proton symporter	NA	O13311	Aichi_virus	27.3	1.1e-23
AUX55130.1|515716_516478_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 29
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	537050	538754	5368065	integrase	Escherichia_phage(100.0%)	2	534940:534954	544728:544742
534940:534954	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
AUX55152.1|537050_537680_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.3e-51
AUX55153.1|538145_538754_+	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
544728:544742	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 30
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	553227	557359	5368065		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AUX55169.1|553227_554781_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
AUX55170.1|555253_555676_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
AUX55171.1|555685_556978_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
AUX55172.1|557029_557359_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 31
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	560437	561457	5368065		Klosneuvirus(100.0%)	1	NA	NA
AUX55178.1|560437_561457_+	oxidoreductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 32
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	565425	573327	5368065	tRNA	Clostridium_phage(20.0%)	8	NA	NA
AUX55182.1|565425_566139_-	hypothetical protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
AUX59784.1|566189_566315_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55183.1|566455_567010_+	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AUX55184.1|567244_568762_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
AUX55185.1|568771_569800_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	2.9e-05
AUX55186.1|569955_571689_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
AUX55187.1|571694_572408_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AUX55188.1|572430_573327_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 33
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	578023	579457	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX55196.1|578023_579457_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 34
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	584032	586906	5368065		Prochlorococcus_phage(100.0%)	1	NA	NA
AUX55202.1|584032_586906_-	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 35
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	594849	596082	5368065		Catovirus(100.0%)	1	NA	NA
AUX55211.1|594849_596082_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 36
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	613335	614130	5368065		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUX55228.1|613335_614130_-	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 37
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	627885	629040	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX55243.1|627885_629040_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 38
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	643911	644997	5368065		Geobacillus_virus(100.0%)	1	NA	NA
AUX55264.1|643911_644997_+	murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	1.0e-11
>prophage 39
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	652543	653524	5368065		Caulobacter_phage(100.0%)	1	NA	NA
AUX55271.1|652543_653524_-	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 40
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	660222	661758	5368065		Vibrio_phage(100.0%)	4	NA	NA
AUX55278.1|660222_660483_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
AUX55279.1|660623_661079_+	cold-shock protein	NA	NA	NA	NA	NA
AUX55280.1|661157_661403_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX55281.1|661506_661758_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
>prophage 41
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	672152	673520	5368065		Morganella_phage(100.0%)	1	NA	NA
AUX55290.1|672152_673520_+	glycosaminoglycan attachment protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 42
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	702111	703479	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX55320.1|702111_703479_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 43
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	708362	709739	5368065		Lactococcus_phage(100.0%)	1	NA	NA
AUX55325.1|708362_709739_+	cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	36.7	8.7e-45
>prophage 44
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	729447	730275	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX55347.1|729447_730275_+	2,5-didehydrogluconate reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 45
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	735627	739350	5368065		Bacillus_virus(50.0%)	3	NA	NA
AUX55351.1|735627_737886_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
AUX55352.1|738007_738877_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUX55353.1|738954_739350_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 46
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	742661	744557	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX55358.1|742661_744557_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 47
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	748899	755780	5368065		Erwinia_phage(25.0%)	9	NA	NA
AUX55364.1|748899_749571_+	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
AUX55365.1|749576_750737_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
AUX55366.1|750781_751573_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AUX55367.1|751759_752530_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AUX55368.1|752591_753245_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
AUX55369.1|753622_753895_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55370.1|753930_754128_-	glycogen synthase	NA	NA	NA	NA	NA
AUX55371.1|754119_754269_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55372.1|754346_755780_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 48
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	760891	762133	5368065	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AUX55376.1|760891_762133_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 49
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	771426	785785	5368065	tRNA	Moraxella_phage(20.0%)	14	NA	NA
AUX55390.1|771426_772440_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AUX55391.1|772448_772679_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55392.1|772677_772893_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUX55393.1|773004_774750_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AUX55394.1|774968_776810_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AUX55395.1|776909_777416_-	double-stranded uracil-DNA glycosylase	NA	NA	NA	NA	NA
AUX55396.1|778150_778423_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55397.1|778491_778857_-	hdeB family protein	NA	NA	NA	NA	NA
AUX55398.1|779158_779773_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUX55399.1|779777_783020_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
AUX55400.1|783110_783782_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55401.1|784022_784598_+	acid-resistance protein	NA	NA	NA	NA	NA
AUX55402.1|784624_784930_+	acid-resistance protein	NA	NA	NA	NA	NA
AUX55403.1|784981_785785_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 50
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	803863	805243	5368065		Klosneuvirus(100.0%)	1	NA	NA
AUX55423.1|803863_805243_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 51
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	809514	811002	5368065		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUX55429.1|809514_811002_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 52
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	820565	821537	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX55438.1|820565_821537_+	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 53
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	838560	839706	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX55458.1|838560_839706_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 54
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	855812	865509	5368065	protease	Escherichia_phage(20.0%)	11	NA	NA
AUX55474.1|855812_856586_+	transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
AUX55475.1|856620_857511_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUX55476.1|857625_858489_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	1.6e-49
AUX55477.1|858552_860670_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUX55478.1|860627_861014_+	YraN family protein	NA	NA	NA	NA	NA
AUX55479.1|861039_861630_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AUX55480.1|861639_862215_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AUX55481.1|863451_864099_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55482.1|864227_864764_+|protease	protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
AUX55483.1|864725_865169_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55484.1|865218_865509_+	hypothetical protein	NA	S6DF82	Invertebrate_iridovirus	52.6	3.1e-13
>prophage 55
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	871202	873134	5368065		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUX55491.1|871202_873134_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 56
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	878548	885167	5368065		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
AUX55498.1|878548_881239_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
AUX55499.1|881263_882751_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUX55500.1|882778_883243_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AUX59800.1|883688_883844_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55501.1|883823_885167_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 57
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	889431	892308	5368065	protease	Pandoravirus(50.0%)	2	NA	NA
AUX55507.1|889431_890280_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
AUX55508.1|890373_892308_-|protease	ATP-dependent metalloprotease	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 58
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	898906	900348	5368065		Indivirus(50.0%)	2	NA	NA
AUX55517.1|898906_899878_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
AUX55518.1|900075_900348_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 59
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	904397	917328	5368065		Bacillus_virus(16.67%)	15	NA	NA
AUX55525.1|904397_905246_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
AUX55526.1|905419_906397_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUX55527.1|906393_907398_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
AUX55528.1|907412_907979_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
AUX55529.1|907975_908551_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUX55530.1|908519_909065_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUX55531.1|909071_909797_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AUX55532.1|909844_911278_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AUX55533.1|911300_911588_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AUX55534.1|911658_912147_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUX55535.1|912192_913047_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AUX55536.1|913043_913316_+	phosphohistidinoprotein-hexose phosphotransferase	NA	NA	NA	NA	NA
AUX55537.1|913379_914105_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUX55538.1|914101_914755_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AUX55539.1|914988_917328_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 60
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	921272	922205	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX55543.1|921272_922205_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 61
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	929650	981228	5368065	terminase,tail,capsid,protease,head,tRNA,portal,integrase	uncultured_Caudovirales_phage(70.59%)	61	965407:965424	981402:981419
AUX55547.1|929650_930145_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
AUX55548.1|930148_930787_-	stringent starvation protein A	NA	NA	NA	NA	NA
AUX55549.1|930785_930989_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55550.1|931098_931491_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUX55551.1|931506_931935_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUX55552.1|932200_933328_-	cell division protein ZapE	NA	NA	NA	NA	NA
AUX55553.1|933518_933917_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55554.1|934090_935458_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AUX55555.1|935545_936604_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
AUX55556.1|936740_937679_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUX55557.1|938093_938564_+	arginine repressor	NA	NA	NA	NA	NA
AUX55558.1|938939_939203_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55559.1|939301_939568_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55560.1|939972_941940_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AUX55561.1|941945_942878_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUX55562.1|942885_943089_-	transporter	NA	NA	NA	NA	NA
AUX55563.1|943220_944150_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX55564.1|944185_945631_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUX55565.1|949553_951023_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUX55566.1|951025_951607_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUX55567.1|951614_952103_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUX55568.1|952102_953095_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUX55569.1|953165_954209_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AUX59802.1|954186_954393_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55570.1|954514_956455_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AUX55571.1|956534_956726_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55572.1|956954_957956_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUX55573.1|957955_958564_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUX59803.1|958787_959240_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUX55574.1|959262_959730_+	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUX55575.1|959740_961090_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUX55576.1|961200_961443_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55577.1|961432_962884_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUX55578.1|962895_963777_+	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUX55579.1|963782_963977_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55580.1|964134_965100_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUX55581.1|965124_965421_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
965407:965424	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
AUX55582.1|965574_965766_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55583.1|965768_967430_-|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AUX55584.1|967413_967770_-|terminase	terminase	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AUX55585.1|967727_967919_-|terminase	terminase	terminase	NA	NA	NA	NA
AUX55586.1|967900_968053_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
AUX59804.1|968045_968318_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	88.9	1.0e-42
AUX55587.1|968488_968788_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AUX55588.1|968784_969120_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AUX55589.1|969116_970358_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AUX55590.1|970359_970920_-	peptidase	NA	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AUX55591.1|970971_972138_-|capsid	capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AUX55592.1|972401_972914_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55593.1|972962_973298_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55594.1|973640_975776_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AUX55595.1|975775_976141_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55596.1|976137_976506_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AUX55597.1|976604_976733_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55598.1|976809_976998_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59805.1|976990_977170_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AUX55599.1|977393_977588_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55600.1|977711_978491_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AUX55601.1|978501_978786_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX55602.1|978967_979909_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55603.1|980001_981228_-|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
981402:981419	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
>prophage 62
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	997554	999026	5368065	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AUX55615.1|997554_998064_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AUX55616.1|998078_999026_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 63
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1018929	1022298	5368065		Tupanvirus(50.0%)	2	NA	NA
AUX55653.1|1018929_1020114_-	translation elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AUX55654.1|1020183_1022298_-	translation elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 64
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1030143	1039787	5368065		Tupanvirus(25.0%)	11	NA	NA
AUX55667.1|1030143_1032048_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
AUX55668.1|1032110_1032311_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55669.1|1032275_1033274_+	hydrolase	NA	NA	NA	NA	NA
AUX55670.1|1033270_1033489_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AUX55671.1|1033525_1034395_+	phosphoribulokinase	NA	NA	NA	NA	NA
AUX55672.1|1034449_1034854_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59807.1|1034813_1035002_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55673.1|1035160_1035793_+	transcriptional regulator Crp	NA	NA	NA	NA	NA
AUX55674.1|1035844_1037923_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
AUX55675.1|1037912_1039133_-	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	NA	NA	NA	NA
AUX55676.1|1039223_1039787_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 65
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1051188	1052016	5368065		Vibrio_phage(100.0%)	1	NA	NA
AUX55689.1|1051188_1052016_-	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 66
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1066839	1070611	5368065		Bacillus_phage(66.67%)	3	NA	NA
AUX55706.1|1066839_1068462_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
AUX55707.1|1068539_1069895_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
AUX55708.1|1069891_1070611_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 67
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1083437	1085828	5368065		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AUX55720.1|1083437_1085828_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 68
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1089173	1089932	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX55723.1|1089173_1089932_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 69
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1093789	1096237	5368065		Dickeya_phage(100.0%)	1	NA	NA
AUX55729.1|1093789_1096237_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 70
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1113982	1115790	5368065		Enterococcus_phage(50.0%)	2	NA	NA
AUX55744.1|1113982_1114723_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
AUX55745.1|1114719_1115790_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 71
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1119216	1121449	5368065		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
AUX55749.1|1119216_1119585_-	toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
AUX55750.1|1119581_1119803_-	prevent-host-death family protein	NA	NA	NA	NA	NA
AUX59809.1|1119966_1120668_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	6.4e-12
AUX55751.1|1120681_1121449_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 72
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1128770	1134571	5368065		Klosneuvirus(25.0%)	5	NA	NA
AUX55760.1|1128770_1130036_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
AUX55761.1|1130154_1131678_+	decarboxylase	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
AUX55762.1|1131730_1132585_-	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AUX55763.1|1132854_1133910_-	cell division protein FtsX	NA	NA	NA	NA	NA
AUX55764.1|1133902_1134571_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 73
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1137655	1141792	5368065		Dickeya_phage(50.0%)	4	NA	NA
AUX55768.1|1137655_1138282_+	hypothetical protein	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
AUX55769.1|1138360_1140571_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
AUX55770.1|1140674_1140920_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
AUX55771.1|1141126_1141792_+	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 74
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1148092	1152199	5368065		Tupanvirus(66.67%)	3	NA	NA
AUX55779.1|1148092_1150078_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
AUX55780.1|1150074_1151058_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
AUX55781.1|1151059_1152199_-	UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 75
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1158301	1159093	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX55788.1|1158301_1159093_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 76
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1167634	1169677	5368065		Indivirus(100.0%)	1	NA	NA
AUX55797.1|1167634_1169677_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 77
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1213405	1219378	5368065		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AUX55827.1|1213405_1215517_-	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
AUX55828.1|1215536_1216328_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AUX55829.1|1216329_1216869_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AUX55830.1|1217186_1217366_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55831.1|1217384_1218398_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AUX55832.1|1218394_1219378_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 78
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1223701	1225065	5368065	transposase	Macacine_betaherpesvirus(50.0%)	2	NA	NA
AUX55837.1|1223701_1224487_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AUX55838.1|1224543_1225065_-	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
>prophage 79
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1231884	1234624	5368065		Streptococcus_phage(50.0%)	2	NA	NA
AUX55843.1|1231884_1232325_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
AUX55844.1|1232293_1234624_-	trimethylamine N-oxide reductase I catalytic subunit	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 80
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1239783	1240755	5368065		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUX55851.1|1239783_1240755_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 81
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1244158	1246089	5368065		Morganella_phage(50.0%)	2	NA	NA
AUX55855.1|1244158_1244371_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AUX55856.1|1244469_1246089_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
>prophage 82
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1250465	1251461	5368065		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AUX55861.1|1250465_1251461_+	acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 83
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1256929	1258471	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX55867.1|1256929_1258471_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 84
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1266444	1268286	5368065	tRNA	Tupanvirus(100.0%)	1	NA	NA
AUX55876.1|1266444_1268286_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 85
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1284123	1293273	5368065		Rhizobium_phage(20.0%)	9	NA	NA
AUX55893.1|1284123_1284375_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
AUX55894.1|1284479_1284911_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55895.1|1285156_1286701_+	phosphoglycerate mutase (2,3-diphosphoglycerate-independent)	NA	NA	NA	NA	NA
AUX55896.1|1286710_1287982_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
AUX55897.1|1287985_1288933_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55898.1|1288938_1289727_-	family 2 glycosyl transferase	NA	NA	NA	NA	NA
AUX55899.1|1289895_1290921_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
AUX55900.1|1290933_1292127_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
AUX55901.1|1292340_1293273_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 86
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1306041	1310783	5368065		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AUX55914.1|1306041_1306521_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
AUX55915.1|1306708_1307518_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
AUX55916.1|1307653_1307821_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUX55917.1|1307841_1308078_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUX55918.1|1308294_1308960_-	hypothetical protein	NA	NA	NA	NA	NA
AUX55919.1|1309129_1310347_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
AUX55920.1|1310324_1310783_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 87
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1314242	1315160	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX55923.1|1314242_1315160_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 88
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1320202	1328492	5368065		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
AUX55931.1|1320202_1321261_+	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
AUX55932.1|1321316_1322567_-	chloride channel protein	NA	NA	NA	NA	NA
AUX55933.1|1322841_1323459_+	hypothetical protein	NA	NA	NA	NA	NA
AUX55934.1|1323464_1325141_-	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
AUX55935.1|1325399_1326023_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AUX55936.1|1326077_1326353_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUX55937.1|1326371_1328492_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 89
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1339473	1340325	5368065		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUX55948.1|1339473_1340325_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 90
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1343459	1344851	5368065		environmental_Halophage(100.0%)	1	NA	NA
AUX55951.1|1343459_1344851_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 91
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1358110	1359160	5368065		Tupanvirus(100.0%)	1	NA	NA
AUX55962.1|1358110_1359160_+	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 92
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1376420	1377584	5368065		Salmonella_phage(100.0%)	1	NA	NA
AUX55981.1|1376420_1377584_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 93
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1396018	1397131	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX55996.1|1396018_1397131_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 94
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1409308	1414747	5368065		Micromonas_sp._RCC1109_virus(50.0%)	7	NA	NA
AUX56009.1|1409308_1410997_-	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
AUX56010.1|1411101_1411197_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56011.1|1411209_1411377_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56012.1|1411829_1411949_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AUX56013.1|1412039_1412486_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX56014.1|1412553_1413387_+	EamA family transporter	NA	NA	NA	NA	NA
AUX56015.1|1413562_1414747_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
>prophage 95
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1425756	1427676	5368065		Morganella_phage(33.33%)	3	NA	NA
AUX56027.1|1425756_1426581_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
AUX56028.1|1426717_1427146_-	heat-shock protein	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
AUX56029.1|1427262_1427676_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 96
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1431111	1432260	5368065		Oenococcus_phage(100.0%)	1	NA	NA
AUX56033.1|1431111_1432260_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 97
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1438027	1445557	5368065		Bacillus_virus(33.33%)	7	NA	NA
AUX56040.1|1438027_1440442_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
AUX56041.1|1440470_1441544_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AUX56042.1|1441690_1442791_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AUX56043.1|1442795_1444199_-	chromosomal replication initiation protein DnaA	NA	NA	NA	NA	NA
AUX56044.1|1444820_1444961_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUX56045.1|1444976_1445336_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AUX56046.1|1445299_1445557_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 98
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1453049	1454387	5368065		Moraxella_phage(100.0%)	1	NA	NA
AUX56054.1|1453049_1454387_-	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 99
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1460163	1467723	5368065		Bacillus_phage(25.0%)	6	NA	NA
AUX56062.1|1460163_1460937_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
AUX56063.1|1460984_1461875_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUX56064.1|1461874_1462834_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AUX56065.1|1462962_1464003_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AUX56066.1|1464339_1466169_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
AUX56067.1|1466352_1467723_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 100
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1480073	1481066	5368065		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AUX56084.1|1480073_1481066_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 101
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1484231	1490110	5368065		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AUX56087.1|1484231_1486100_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
AUX56088.1|1486285_1486705_+	D-ribose pyranase	NA	NA	NA	NA	NA
AUX56089.1|1486715_1488221_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
AUX56090.1|1488226_1489192_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AUX56091.1|1489219_1490110_+	D-ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 102
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1504404	1507197	5368065		uncultured_virus(100.0%)	1	NA	NA
AUX56103.1|1504404_1507197_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 103
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1511085	1513553	5368065		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AUX56108.1|1511085_1512495_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
AUX56109.1|1512503_1513553_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 104
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1520375	1521293	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX56116.1|1520375_1521293_-	lipase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 105
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1544264	1545776	5368065		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AUX56143.1|1544264_1545776_-	sugar ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 106
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1554114	1557617	5368065		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
AUX56152.1|1554114_1554735_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
AUX56153.1|1554807_1555482_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUX56154.1|1555548_1556922_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AUX56155.1|1556918_1557617_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 107
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1562119	1563454	5368065		Erwinia_phage(100.0%)	1	NA	NA
AUX56161.1|1562119_1563454_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 108
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1574518	1576075	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX56171.1|1574518_1576075_+	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 109
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1580846	1581509	5368065		Cyanophage(100.0%)	1	NA	NA
AUX56177.1|1580846_1581509_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 110
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1596139	1597978	5368065		Acinetobacter_phage(100.0%)	1	NA	NA
AUX56190.1|1596139_1597978_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 111
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1608040	1609687	5368065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUX56197.1|1608040_1609687_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 112
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1617790	1619812	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX56206.1|1617790_1619812_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 113
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1624303	1626240	5368065		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AUX56212.1|1624303_1625569_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
AUX56213.1|1625910_1626240_+	thioredoxin	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 114
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1630290	1636432	5368065		Catovirus(20.0%)	6	NA	NA
AUX56218.1|1630290_1631421_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
AUX56219.1|1631417_1632680_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
AUX56220.1|1632676_1633744_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
AUX56221.1|1633762_1634644_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
AUX56222.1|1634621_1635296_+	TDP-D-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AUX56223.1|1635301_1636432_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 115
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1652799	1656644	5368065		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AUX56240.1|1652799_1653702_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
AUX56241.1|1653701_1654418_+	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AUX56242.1|1654481_1656644_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 116
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1660479	1663941	5368065		Catovirus(50.0%)	3	NA	NA
AUX56248.1|1660479_1662306_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
AUX56249.1|1662367_1662988_+	threonine export protein RhtC	NA	NA	NA	NA	NA
AUX56250.1|1663032_1663941_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 117
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1675942	1679286	5368065		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AUX56262.1|1675942_1677583_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
AUX56263.1|1677712_1677964_+	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUX56264.1|1677967_1678504_+	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUX56265.1|1678506_1679286_+	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 118
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1688004	1688619	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX56274.1|1688004_1688619_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 119
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1698552	1701673	5368065		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUX56279.1|1698552_1699509_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
AUX56280.1|1700488_1701673_+	translation elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 120
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1705900	1718344	5368065		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
AUX56289.1|1705900_1709929_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
AUX56290.1|1710005_1714229_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
AUX56291.1|1714629_1715970_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUX56292.1|1716012_1716330_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AUX56293.1|1716333_1716639_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AUX56294.1|1716811_1718344_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 121
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1726769	1728533	5368065		Klosneuvirus(50.0%)	3	NA	NA
AUX56304.1|1726769_1727441_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
AUX56305.1|1727483_1728074_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56306.1|1728260_1728533_+	DNA-binding protein	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 122
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1733954	1735544	5368065		Prochlorococcus_phage(100.0%)	1	NA	NA
AUX56312.1|1733954_1735544_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 123
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1749087	1752771	5368065		Dickeya_phage(100.0%)	1	NA	NA
AUX56319.1|1749087_1752771_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 124
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1759339	1760143	5368065		Moumouvirus(100.0%)	1	NA	NA
AUX56327.1|1759339_1760143_-	sorbitol-6-phosphate 2-dehydrogenase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 125
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1776652	1777762	5368065		Mycoplasma_phage(100.0%)	1	NA	NA
AUX56346.1|1776652_1777762_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 126
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1784828	1785437	5368065		Lactococcus_phage(100.0%)	1	NA	NA
AUX56353.1|1784828_1785437_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 127
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1791432	1793959	5368065		Escherichia_phage(50.0%)	2	NA	NA
AUX56363.1|1791432_1792848_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
AUX56364.1|1792879_1793959_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 128
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1797140	1802447	5368065		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AUX56369.1|1797140_1799966_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
AUX56370.1|1800217_1800742_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AUX56371.1|1800866_1802447_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 129
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1814375	1815458	5368065		Mycoplasma_phage(100.0%)	1	NA	NA
AUX56383.1|1814375_1815458_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.7e-19
>prophage 130
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1822987	1824337	5368065		Moraxella_phage(100.0%)	1	NA	NA
AUX56393.1|1822987_1824337_+	permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 131
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1836620	1842963	5368065		Staphylococcus_phage(50.0%)	5	NA	NA
AUX56407.1|1836620_1838579_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
AUX56408.1|1838678_1838879_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56409.1|1838990_1840304_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AUX56410.1|1840340_1841027_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56411.1|1841256_1842963_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	5.7e-22
>prophage 132
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1849345	1850866	5368065		Pithovirus(100.0%)	1	NA	NA
AUX56420.1|1849345_1850866_-	D-xylose ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 133
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1856246	1857793	5368065		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AUX56426.1|1856246_1856927_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
AUX56427.1|1857034_1857793_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 134
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1863153	1864656	5368065		Burkholderia_virus(100.0%)	1	NA	NA
AUX56434.1|1863153_1864656_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 135
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1869020	1874107	5368065	transposase	Escherichia_phage(33.33%)	8	NA	NA
AUX56440.1|1869020_1869977_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
AUX56441.1|1869986_1870358_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AUX56442.1|1870523_1871309_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AUX56443.1|1871365_1871887_-	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AUX56444.1|1872055_1872361_-	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
AUX56445.1|1872360_1873278_-	DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AUX56446.1|1873353_1873467_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56447.1|1873423_1874107_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 136
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1894177	1899823	5368065		Cronobacter_phage(33.33%)	5	NA	NA
AUX56465.1|1894177_1894471_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
AUX56466.1|1894508_1896155_+	chaperonin GroL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AUX56467.1|1896415_1896769_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56468.1|1896823_1897687_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56469.1|1897699_1899823_-	colicin V synthesis protein	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
>prophage 137
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1911002	1916196	5368065		Morganella_phage(33.33%)	6	NA	NA
AUX56482.1|1911002_1911536_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
AUX56483.1|1911649_1912009_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
AUX56484.1|1912019_1912415_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
AUX56485.1|1912425_1913160_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUX56486.1|1913152_1914943_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
AUX56487.1|1915218_1916196_+	elongation factor P lysine(34) lysyltransferase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 138
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1923550	1924096	5368065		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AUX56492.1|1923550_1924096_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 139
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1928938	1932164	5368065		Vibrio_phage(50.0%)	2	NA	NA
AUX56496.1|1928938_1930294_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
AUX56497.1|1930304_1932164_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 140
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1938094	1942438	5368065		Pithovirus(50.0%)	3	NA	NA
AUX56506.1|1938094_1939393_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
AUX56507.1|1939543_1939969_+	transcriptional repressor NsrR	NA	NA	NA	NA	NA
AUX56508.1|1940005_1942438_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
>prophage 141
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1962035	1962860	5368065		Bordetella_phage(100.0%)	1	NA	NA
AUX56533.1|1962035_1962860_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 142
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1979358	1985937	5368065		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AUX56547.1|1979358_1979889_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
AUX56548.1|1980292_1981249_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX59841.1|1981261_1981390_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56549.1|1981372_1982875_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AUX56550.1|1982885_1983911_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUX56551.1|1983897_1984896_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AUX56552.1|1984938_1985937_-	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 143
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2002070	2005202	5368065		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AUX56572.1|2002070_2002355_+	addiction module toxin RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
AUX56573.1|2002358_2002823_-	anaerobic ribonucleotide reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
AUX56574.1|2003063_2005202_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 144
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2012959	2019017	5368065		Enterobacteria_phage(33.33%)	6	NA	NA
AUX56582.1|2012959_2013907_-	trehalose operon repressor	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
AUX59844.1|2013943_2014141_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56583.1|2014286_2016995_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
AUX56584.1|2017067_2017454_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUX56585.1|2017606_2018068_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUX56586.1|2018081_2019017_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 145
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2027460	2077726	5368065	tRNA,transposase,integrase	Enterobacteria_phage(35.29%)	55	2039028:2039043	2066272:2066287
AUX56596.1|2027460_2028225_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
AUX56597.1|2028486_2028990_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX56598.1|2029110_2031966_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
AUX56599.1|2031965_2032409_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUX56600.1|2032528_2034040_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AUX56601.1|2034320_2034440_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUX56602.1|2034429_2035527_+	lipopolysaccharide ABC transporter permease LptF	NA	NA	NA	NA	NA
AUX56603.1|2035526_2036609_+	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AUX56604.1|2036657_2038160_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
AUX56605.1|2038258_2039080_-	inosose isomerase	NA	NA	NA	NA	NA
2039028:2039043	attL	AGCGCTGGCGCGATTT	NA	NA	NA	NA
AUX56606.1|2039430_2040936_+	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUX56607.1|2040954_2041764_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
AUX56608.1|2042177_2042315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX56609.1|2043154_2043376_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56610.1|2043297_2043576_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56611.1|2043667_2043775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX56612.1|2044327_2045185_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUX56613.1|2045336_2047250_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
AUX56614.1|2047509_2047671_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56615.1|2047755_2049696_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
AUX56616.1|2049742_2050756_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AUX56617.1|2050797_2051682_+	protein iolH	NA	NA	NA	NA	NA
AUX56618.1|2051705_2052605_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
AUX56619.1|2052748_2054059_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX56620.1|2054051_2055125_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
AUX56621.1|2055130_2055955_-	phosphodiesterase	NA	NA	NA	NA	NA
AUX56622.1|2055965_2056853_-	ABC transporter permease	NA	NA	NA	NA	NA
AUX56623.1|2056842_2057727_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUX56624.1|2057857_2058877_-	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
AUX56625.1|2058988_2060458_-	sulfate permease	NA	NA	NA	NA	NA
AUX56626.1|2060454_2061135_-	carbonic anhydrase	NA	NA	NA	NA	NA
AUX56627.1|2061959_2063222_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
AUX56628.1|2063279_2064290_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59846.1|2064240_2064462_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56629.1|2064700_2064814_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56630.1|2064777_2065857_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56631.1|2065921_2066197_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUX56632.1|2066115_2066619_+|transposase	transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
2066272:2066287	attR	AAATCGCGCCAGCGCT	NA	NA	NA	NA
AUX59847.1|2067153_2067303_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56633.1|2067374_2067941_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AUX56634.1|2067958_2068204_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AUX56635.1|2068200_2068938_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AUX56636.1|2069498_2069765_+	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AUX59848.1|2069767_2070310_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AUX56637.1|2070306_2070534_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56638.1|2070530_2070851_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56639.1|2070865_2073199_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
AUX56640.1|2073943_2074210_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX56641.1|2074347_2075055_+|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	2.4e-06
AUX56642.1|2075169_2075397_+	phospholipase	NA	NA	NA	NA	NA
AUX56643.1|2075588_2076068_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AUX56644.1|2076070_2076418_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56645.1|2076419_2076923_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56646.1|2077028_2077304_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUX56647.1|2077222_2077726_+|transposase	transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
>prophage 146
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2094785	2099743	5368065		Enterobacteria_phage(33.33%)	4	NA	NA
AUX56666.1|2094785_2095514_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
AUX56667.1|2095630_2096164_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AUX56668.1|2096173_2096521_-	DNA-binding protein	NA	NA	NA	NA	NA
AUX56669.1|2096593_2099743_-	cation transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
>prophage 147
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2102981	2105088	5368065		Bacillus_phage(50.0%)	2	NA	NA
AUX56674.1|2102981_2103665_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
AUX56675.1|2103654_2105088_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
>prophage 148
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2114844	2117589	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX56682.1|2114844_2117589_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 149
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2121505	2122990	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX56686.1|2121505_2122990_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 150
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2138577	2139504	5368065		Sodalis_phage(100.0%)	1	NA	NA
AUX56706.1|2138577_2139504_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 151
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2171605	2172628	5368065		Tupanvirus(100.0%)	1	NA	NA
AUX56740.1|2171605_2172628_+	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 152
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2179632	2182800	5368065		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AUX56747.1|2179632_2180694_+	glucosamine--fructose-6-phosphate aminotransferase	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
AUX56748.1|2180711_2181722_+	glucosamine--fructose-6-phosphate aminotransferase	NA	NA	NA	NA	NA
AUX56749.1|2181855_2182800_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 153
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2185960	2187240	5368065		Shigella_phage(50.0%)	2	NA	NA
AUX56752.1|2185960_2186698_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
AUX56753.1|2186700_2187240_-	primosomal protein DnaI	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 154
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2200463	2203184	5368065		Streptococcus_phage(50.0%)	3	NA	NA
AUX56770.1|2200463_2202053_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
AUX56771.1|2202272_2202893_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUX56772.1|2203022_2203184_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 155
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2207919	2209242	5368065		Geobacillus_virus(100.0%)	1	NA	NA
AUX56777.1|2207919_2209242_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 156
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2215573	2220733	5368065		Enterococcus_phage(33.33%)	3	NA	NA
AUX56784.1|2215573_2216806_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
AUX56785.1|2216899_2218567_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
AUX59853.1|2218795_2220733_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 157
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2237890	2238844	5368065		Cyanophage(100.0%)	1	NA	NA
AUX56804.1|2237890_2238844_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 158
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2243215	2253168	5368065	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
AUX56810.1|2243215_2245132_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
AUX56811.1|2245219_2246353_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AUX56812.1|2246482_2247706_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	5.1e-89
AUX56813.1|2247760_2248657_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AUX56814.1|2248666_2248780_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56815.1|2248776_2249040_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUX56816.1|2249369_2250308_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUX59855.1|2250351_2253168_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
>prophage 159
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2271965	2273114	5368065		Halovirus(100.0%)	1	NA	NA
AUX56838.1|2271965_2273114_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 160
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2279455	2281039	5368065		Bacillus_phage(50.0%)	3	NA	NA
AUX56844.1|2279455_2279935_+	dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
AUX56845.1|2280034_2280238_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56846.1|2280190_2281039_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 161
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2293497	2298949	5368065		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUX56859.1|2293497_2296404_-	RNA polymerase-binding ATPase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
AUX56860.1|2296591_2298949_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
>prophage 162
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2305245	2305947	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX56867.1|2305245_2305947_-	thiamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 163
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2314645	2315401	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX56875.1|2314645_2315401_-	3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 164
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2326800	2328525	5368065		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AUX56887.1|2326800_2328525_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 165
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2354717	2355761	5368065		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUX56914.1|2354717_2355761_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 166
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2360028	2360592	5368065		Sphingobium_phage(100.0%)	1	NA	NA
AUX56919.1|2360028_2360592_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 167
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2371932	2373357	5368065		Erysipelothrix_phage(100.0%)	1	NA	NA
AUX56928.1|2371932_2373357_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 168
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2383006	2392884	5368065	transposase	Shigella_phage(20.0%)	11	NA	NA
AUX56937.1|2383006_2383885_-|transposase	transposase	transposase	U5P429	Shigella_phage	43.5	2.6e-50
AUX56938.1|2383881_2384199_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	36.6	4.8e-07
AUX56939.1|2384247_2385090_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUX56940.1|2385086_2385497_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56941.1|2385744_2386104_-	hypothetical protein	NA	NA	NA	NA	NA
AUX56942.1|2386237_2387836_+	multicopper oxidase	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
AUX56943.1|2387919_2390310_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AUX56944.1|2390390_2390510_+	hypothetical protein	NA	NA	NA	NA	NA
AUX56945.1|2390514_2391051_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
AUX56946.1|2391110_2391773_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUX56947.1|2391957_2392884_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 169
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2398288	2405059	5368065	tRNA	unidentified_phage(50.0%)	6	NA	NA
AUX56955.1|2398288_2399683_-	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
AUX56956.1|2399745_2400627_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AUX56957.1|2400686_2401142_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AUX56958.1|2401304_2402021_-	sugar fermentation stimulation protein SfsA	NA	NA	NA	NA	NA
AUX56959.1|2402020_2402557_-	2'-5' RNA ligase	NA	NA	NA	NA	NA
AUX56960.1|2402629_2405059_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 170
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2427194	2427992	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX56980.1|2427194_2427992_+	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 171
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2433958	2434303	5368065		Lake_Baikal_phage(100.0%)	1	NA	NA
AUX56985.1|2433958_2434303_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 172
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2438258	2439692	5368065	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUX56990.1|2438258_2439692_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 173
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2451252	2452029	5368065		Flavobacterium_phage(100.0%)	1	NA	NA
AUX57001.1|2451252_2452029_+	(2E,6E)-farnesyl- diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.2e-24
>prophage 174
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2460860	2464960	5368065		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AUX57010.1|2460860_2461460_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
AUX57011.1|2461477_2464960_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
>prophage 175
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2477944	2478976	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX57027.1|2477944_2478976_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 176
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2485488	2486292	5368065		Indivirus(100.0%)	1	NA	NA
AUX57029.1|2485488_2486292_+	2,5-didehydrogluconate reductase B	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 177
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2490357	2494567	5368065		Lactobacillus_phage(33.33%)	5	NA	NA
AUX57033.1|2490357_2491725_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
AUX57034.1|2491796_2492552_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUX57035.1|2492638_2493307_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUX57036.1|2493303_2493771_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
AUX57037.1|2493835_2494567_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 178
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2500075	2500657	5368065		Caulobacter_phage(100.0%)	1	NA	NA
AUX57042.1|2500075_2500657_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 179
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2517906	2519190	5368065		Klosneuvirus(100.0%)	1	NA	NA
AUX57062.1|2517906_2519190_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 180
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2526723	2527719	5368065		Catovirus(100.0%)	1	NA	NA
AUX57070.1|2526723_2527719_-	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 181
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2532366	2533764	5368065		Erysipelothrix_phage(100.0%)	1	NA	NA
AUX57076.1|2532366_2533764_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 182
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2542220	2555216	5368065	integrase	Enterobacteria_phage(72.73%)	17	2530354:2530368	2553411:2553425
2530354:2530368	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
AUX57082.1|2542220_2544554_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AUX57083.1|2544565_2544886_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57084.1|2544882_2545110_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59862.1|2545106_2545658_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AUX57085.1|2545660_2545927_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AUX57086.1|2546031_2546169_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57087.1|2546468_2547206_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	61.1	1.4e-73
AUX57088.1|2547202_2547448_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AUX57089.1|2547465_2548032_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AUX59863.1|2548104_2548254_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57090.1|2548600_2549026_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57091.1|2549025_2549976_-	chromosome partitioning protein	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AUX57092.1|2549963_2551154_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AUX57093.1|2551506_2552760_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AUX57094.1|2552770_2553874_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2553411:2553425	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
AUX57095.1|2554028_2554151_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57096.1|2554163_2555216_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 183
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2562060	2562903	5368065		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUX57105.1|2562060_2562903_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 184
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2571976	2575697	5368065		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
AUX59865.1|2571976_2572726_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	42.4	2.9e-34
AUX57113.1|2572796_2573606_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX59866.1|2573978_2574110_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57114.1|2574226_2574922_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
AUX57115.1|2574914_2575697_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 185
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2586700	2587468	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX57127.1|2586700_2587468_+	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 186
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2607951	2616471	5368065		Bacillus_phage(60.0%)	6	NA	NA
AUX57149.1|2607951_2608863_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
AUX57150.1|2608954_2609869_+	fructokinase	NA	NA	NA	NA	NA
AUX57151.1|2609942_2613080_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
AUX57152.1|2613076_2614282_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
AUX57153.1|2614464_2615154_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
AUX57154.1|2615175_2616471_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 187
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2633276	2637615	5368065	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AUX57171.1|2633276_2634404_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
AUX57172.1|2634426_2634759_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AUX57173.1|2634785_2636633_+	protein-export membrane protein SecD	NA	NA	NA	NA	NA
AUX57174.1|2636643_2637615_+	protein-export membrane protein SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 188
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2641213	2645873	5368065		Indivirus(33.33%)	6	NA	NA
AUX57180.1|2641213_2642317_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
AUX57181.1|2642404_2642875_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AUX57182.1|2642894_2643314_+	N utilization substance protein B	NA	NA	NA	NA	NA
AUX57183.1|2643385_2644357_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AUX57184.1|2644349_2644853_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AUX57185.1|2644898_2645873_-	oxidoreductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
>prophage 189
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2658658	2660356	5368065		Lactobacillus_phage(100.0%)	1	NA	NA
AUX57198.1|2658658_2660356_-	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 190
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2674662	2679831	5368065	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AUX57214.1|2674662_2675286_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
AUX57215.1|2675536_2676811_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AUX57216.1|2676994_2679349_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
AUX57217.1|2679558_2679831_+	DNA-binding protein HU	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 191
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2683061	2683763	5368065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUX57221.1|2683061_2683763_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 192
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2688190	2691734	5368065		Bacillus_phage(100.0%)	2	NA	NA
AUX57226.1|2688190_2689963_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
AUX57227.1|2689955_2691734_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 193
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2702657	2703767	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX57239.1|2702657_2703767_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 194
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2712941	2722332	5368065		Enterobacteria_phage(33.33%)	11	NA	NA
AUX57248.1|2712941_2714012_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
AUX57249.1|2714127_2714391_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUX57250.1|2714390_2714531_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUX57251.1|2714527_2715226_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX57252.1|2715326_2716778_+	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AUX57253.1|2716752_2717223_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57254.1|2717243_2717384_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57255.1|2717355_2717922_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AUX57256.1|2718080_2718299_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX57257.1|2718325_2718700_-	Hha toxicity attenuator	NA	NA	NA	NA	NA
AUX57258.1|2719185_2722332_-	multidrug efflux RND transporter permease	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 195
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2727853	2735664	5368065	transposase	Sodalis_phage(25.0%)	9	NA	NA
AUX57262.1|2727853_2728753_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
AUX57263.1|2728820_2728994_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AUX57264.1|2729006_2729534_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AUX57265.1|2729603_2729981_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57266.1|2730131_2730683_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AUX57267.1|2730775_2732683_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
AUX57268.1|2732740_2733073_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUX57269.1|2733072_2733678_+	recombination protein RecR	NA	NA	NA	NA	NA
AUX57270.1|2733789_2735664_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
>prophage 196
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2745809	2751015	5368065		uncultured_virus(50.0%)	5	NA	NA
AUX57281.1|2745809_2748365_-	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
AUX57282.1|2748417_2748828_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUX57283.1|2748824_2749283_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57284.1|2749279_2750197_-	paraslipin	NA	NA	NA	NA	NA
AUX57285.1|2750337_2751015_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
>prophage 197
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2754197	2754884	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX57290.1|2754197_2754884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 198
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2763429	2773536	5368065	tRNA,integrase	Moumouvirus(16.67%)	10	2766294:2766307	2768207:2768220
AUX57301.1|2763429_2764815_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AUX57302.1|2764860_2765073_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUX57303.1|2765074_2765941_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2766294:2766307	attL	GCTGGATAGAGCAA	NA	NA	NA	NA
AUX57304.1|2766522_2767737_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	53.4	1.4e-126
AUX57305.1|2767880_2768843_+	hypothetical protein	NA	NA	NA	NA	NA
2768207:2768220	attR	TTGCTCTATCCAGC	NA	NA	NA	NA
AUX57306.1|2768999_2769197_+	dipicolinate synthase	NA	E5E3Y1	Burkholderia_phage	49.0	4.3e-06
AUX57307.1|2769257_2769974_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59872.1|2770059_2770569_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	43.5	1.8e-19
AUX57308.1|2770561_2770783_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57309.1|2770779_2773536_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	56.4	5.6e-293
>prophage 199
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2777079	2786396	5368065		Pseudomonas_phage(40.0%)	9	NA	NA
AUX57314.1|2777079_2779776_+	Lytic transglycosylase, catalytic	NA	K4NWI2	Pseudomonas_phage	28.4	1.4e-35
AUX57315.1|2779775_2781503_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57316.1|2781495_2784063_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.7	2.7e-180
AUX57317.1|2784065_2784449_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57318.1|2784488_2784641_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
AUX57319.1|2784723_2785236_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57320.1|2785222_2785585_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57321.1|2785759_2786134_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	45.7	4.8e-22
AUX57322.1|2786147_2786396_-	transcriptional regulator	NA	T1SA17	Salmonella_phage	72.8	1.2e-26
>prophage 200
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2798623	2799544	5368065		Morganella_phage(100.0%)	1	NA	NA
AUX57335.1|2798623_2799544_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 201
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2805767	2809092	5368065	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AUX57340.1|2805767_2807243_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AUX57341.1|2807574_2809092_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 202
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2817333	2823134	5368065		Amsacta_moorei_entomopoxvirus(50.0%)	6	NA	NA
AUX57349.1|2817333_2818818_+	D-xylose ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
AUX57350.1|2818828_2819860_+	ABC transporter	NA	NA	NA	NA	NA
AUX57351.1|2819865_2820003_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57352.1|2820043_2820652_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57353.1|2820699_2821710_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX57354.1|2821733_2823134_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
>prophage 203
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2829756	2830554	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX57361.1|2829756_2830554_-	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 204
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2845336	2846452	5368065		Tupanvirus(100.0%)	1	NA	NA
AUX57378.1|2845336_2846452_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 205
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2889345	2892069	5368065		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUX57420.1|2889345_2892069_+	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 206
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2896602	2897966	5368065	transposase	Bacillus_phage(50.0%)	2	NA	NA
AUX57423.1|2896602_2897124_+	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AUX57424.1|2897180_2897966_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
>prophage 207
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2902472	2907152	5368065		Streptococcus_phage(50.0%)	5	NA	NA
AUX57429.1|2902472_2903936_-	GntR family transcriptional regulator	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
AUX57430.1|2904177_2905029_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX57431.1|2905076_2905718_+	ABC transporter permease	NA	NA	NA	NA	NA
AUX57432.1|2905732_2906398_+	ABC transporter permease	NA	NA	NA	NA	NA
AUX57433.1|2906390_2907152_+	glutamate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
>prophage 208
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2910222	2911750	5368065		Planktothrix_phage(100.0%)	2	NA	NA
AUX57437.1|2910222_2910927_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
AUX57438.1|2910913_2911750_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
>prophage 209
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2916307	2922221	5368065	holin	Catovirus(50.0%)	5	NA	NA
AUX57443.1|2916307_2917972_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
AUX57444.1|2917985_2919458_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUX57445.1|2919471_2920059_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AUX59875.1|2919975_2920191_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57446.1|2920187_2922221_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 210
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2928924	2930469	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX57455.1|2928924_2930469_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 211
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2941861	2946602	5368065		Tupanvirus(50.0%)	2	NA	NA
AUX57467.1|2941861_2945743_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
AUX57468.1|2945807_2946602_-	iron-enterobactin transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.3	1.5e-09
>prophage 212
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2958944	2963365	5368065		Burkholderia_phage(50.0%)	5	NA	NA
AUX57480.1|2958944_2959349_-	transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
AUX57481.1|2959323_2959626_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AUX57482.1|2959809_2960553_-	oxidoreductase	NA	NA	NA	NA	NA
AUX57483.1|2960610_2961699_-	oxidoreductase	NA	NA	NA	NA	NA
AUX57484.1|2961862_2963365_+	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 213
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2980476	2994191	5368065		Cedratvirus(20.0%)	12	NA	NA
AUX57498.1|2980476_2981505_+	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
AUX57499.1|2981547_2982489_-	kinase	NA	NA	NA	NA	NA
AUX57500.1|2982500_2983505_-	ABC transporter permease	NA	NA	NA	NA	NA
AUX59878.1|2983501_2984350_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57501.1|2984487_2985990_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	9.2e-16
AUX57502.1|2986034_2987015_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX57503.1|2987423_2989733_+	biotin transporter BioY	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
AUX57504.1|2989840_2990383_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AUX57505.1|2990379_2991069_-	2,3-diketo-5-methylthio-1-phosphopentane phosphatase	NA	NA	NA	NA	NA
AUX59879.1|2991210_2992356_+	methionine aminotransferase	NA	NA	NA	NA	NA
AUX57506.1|2992356_2992983_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
AUX57507.1|2992967_2994191_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
>prophage 214
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2997325	2999396	5368065		Bacillus_virus(50.0%)	2	NA	NA
AUX57510.1|2997325_2998891_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
AUX57511.1|2998967_2999396_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 215
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3003486	3004147	5368065		Morganella_phage(50.0%)	2	NA	NA
AUX57516.1|3003486_3003696_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
AUX57517.1|3003763_3004147_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 216
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3009025	3011512	5368065		Stx2-converting_phage(50.0%)	2	NA	NA
AUX57524.1|3009025_3010297_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	6.9e-105
AUX57525.1|3010363_3011512_-	rare lipoprotein A	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 217
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3018556	3026522	5368065	tRNA	Staphylococcus_phage(33.33%)	6	NA	NA
AUX57535.1|3018556_3021139_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
AUX57536.1|3021362_3021848_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57537.1|3021893_3023687_-	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
AUX57538.1|3023752_3025423_-	hemin-binding protein	NA	NA	NA	NA	NA
AUX57539.1|3025437_3025554_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57540.1|3025796_3026522_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 218
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3032526	3033573	5368065		Pseudomonas_phage(100.0%)	1	NA	NA
AUX57546.1|3032526_3033573_-	nucleoside triphosphate hydrolase	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 219
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3037613	3039278	5368065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUX57550.1|3037613_3039278_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 220
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3044031	3047833	5368065	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AUX57556.1|3044031_3045987_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
AUX57557.1|3046165_3047833_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 221
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3052521	3053295	5368065		Mycobacterium_phage(100.0%)	1	NA	NA
AUX57564.1|3052521_3053295_-	alpha/beta hydrolase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 222
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3060121	3067551	5368065		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AUX57571.1|3060121_3062170_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
AUX57572.1|3062190_3063870_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUX57573.1|3063869_3064076_-	ATPase	NA	NA	NA	NA	NA
AUX57574.1|3064265_3064475_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57575.1|3064658_3066101_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
AUX57576.1|3066072_3067551_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	6.5e-46
>prophage 223
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3073360	3074152	5368065		Kaumoebavirus(100.0%)	1	NA	NA
AUX57584.1|3073360_3074152_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 224
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3098475	3101986	5368065		Vibriophage(33.33%)	4	NA	NA
AUX57609.1|3098475_3099195_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
AUX57610.1|3099191_3100136_-	cation transporter	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
AUX57611.1|3100253_3100619_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57612.1|3100933_3101986_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 225
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3106347	3108200	5368065		Tupanvirus(50.0%)	3	NA	NA
AUX57617.1|3106347_3107364_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
AUX57618.1|3107469_3107595_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57619.1|3107573_3108200_-	hypothetical protein	NA	M1GX76	Paramecium_bursaria_Chlorella_virus	26.3	1.1e-07
>prophage 226
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3111811	3112870	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX59883.1|3111811_3112870_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 227
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3117716	3118451	5368065		Enterobacteria_phage(100.0%)	1	NA	NA
AUX57629.1|3117716_3118451_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 228
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3128543	3134166	5368065		Catovirus(50.0%)	4	NA	NA
AUX57641.1|3128543_3130070_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
AUX57642.1|3130168_3131551_+	proline-specific permease ProY	NA	NA	NA	NA	NA
AUX57643.1|3132329_3132806_-	kinase inhibitor	NA	NA	NA	NA	NA
AUX59885.1|3132876_3134166_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 229
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3137969	3138692	5368065		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUX57648.1|3137969_3138692_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 230
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3145189	3146095	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX57654.1|3145189_3146095_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 231
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3156262	3158002	5368065		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUX57668.1|3156262_3158002_-	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 232
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3163207	3171172	5368065		Micromonas_pusilla_virus(20.0%)	8	NA	NA
AUX57674.1|3163207_3164053_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
AUX59888.1|3164088_3165045_+	transketolase	NA	NA	NA	NA	NA
AUX57675.1|3165259_3166615_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
AUX57676.1|3166802_3168971_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
AUX57677.1|3169000_3169969_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AUX57678.1|3170078_3170339_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57679.1|3170624_3170891_-	hypothetical protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
AUX59889.1|3170911_3171172_-	hypothetical protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 233
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3175246	3180398	5368065		Planktothrix_phage(33.33%)	7	NA	NA
AUX57683.1|3175246_3175969_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
AUX57684.1|3175965_3176625_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUX57685.1|3176750_3177497_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUX57686.1|3177905_3178409_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
AUX57687.1|3178646_3179534_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AUX57688.1|3179552_3179678_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57689.1|3179885_3180398_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 234
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3184399	3185776	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX57694.1|3184399_3185776_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 235
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3188785	3190378	5368065		Tupanvirus(100.0%)	1	NA	NA
AUX57697.1|3188785_3190378_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 236
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3198357	3200790	5368065		Bacteriophage(100.0%)	1	NA	NA
AUX57702.1|3198357_3200790_-	glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 237
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3205033	3206893	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX57707.1|3205033_3206893_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 238
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3218598	3220598	5368065		Stx2-converting_phage(50.0%)	2	NA	NA
AUX57718.1|3218598_3219801_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
AUX57719.1|3219839_3220598_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 239
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3225673	3277159	5368065	tail,capsid,head,portal,integrase,plate	Salmonella_phage(73.91%)	64	3225581:3225599	3263081:3263099
3225581:3225599	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AUX57726.1|3225673_3226654_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
AUX57727.1|3226893_3227145_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57728.1|3227144_3228629_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX57729.1|3228727_3229672_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57730.1|3229683_3230562_-	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AUX57731.1|3230707_3230929_+	regulator	NA	NA	NA	NA	NA
AUX57732.1|3230961_3231471_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AUX59891.1|3231478_3231679_+	hypothetical protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AUX57733.1|3231642_3231984_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AUX57734.1|3232051_3232285_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AUX57735.1|3232284_3232512_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AUX57736.1|3232508_3233366_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AUX57737.1|3233362_3235777_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AUX57738.1|3235930_3236119_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AUX57739.1|3236129_3236363_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUX59892.1|3236924_3237155_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57740.1|3237430_3239173_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57741.1|3239234_3240260_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AUX57742.1|3240259_3242026_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AUX57743.1|3242168_3243002_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AUX57744.1|3243018_3244077_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AUX57745.1|3244080_3244731_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AUX57746.1|3244826_3245291_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AUX57747.1|3245290_3245494_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AUX57748.1|3245497_3245713_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AUX57749.1|3245693_3246203_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AUX57750.1|3246207_3246591_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AUX57751.1|3246587_3247016_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AUX57752.1|3247002_3247149_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
AUX57753.1|3247111_3247543_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AUX57754.1|3247535_3247982_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AUX57755.1|3247978_3248488_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57756.1|3248486_3248651_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57757.1|3248765_3249338_+|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AUX57758.1|3249334_3249697_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AUX57759.1|3249683_3250592_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AUX57760.1|3250584_3251184_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AUX57761.1|3251185_3254137_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AUX57762.1|3254140_3254872_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59893.1|3254910_3255072_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57763.1|3255101_3256178_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AUX57764.1|3256316_3257489_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AUX57765.1|3257498_3258014_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AUX57766.1|3258066_3258366_+	hypothetical protein	NA	E5G6P9	Salmonella_phage	79.0	3.7e-33
AUX59895.1|3258380_3258500_+|tail	phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AUX59894.1|3258726_3261120_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
AUX57767.1|3261116_3261602_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AUX57768.1|3261598_3262699_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AUX59896.1|3262793_3263009_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	68.6	2.2e-19
AUX57769.1|3263114_3263237_+	hypothetical protein	NA	NA	NA	NA	NA
3263081:3263099	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AUX59897.1|3263228_3264914_-	transporter	NA	NA	NA	NA	NA
AUX57770.1|3265180_3265564_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57771.1|3265570_3265834_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AUX57772.1|3266036_3266324_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57773.1|3267145_3268048_+	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AUX57774.1|3268136_3268616_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57775.1|3268964_3270077_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AUX59898.1|3270207_3271374_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
AUX57776.1|3271384_3272338_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUX57777.1|3272334_3273180_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUX57778.1|3273237_3273726_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57779.1|3273767_3274895_+	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AUX57780.1|3274973_3275690_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AUX57781.1|3275686_3277159_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 240
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3280259	3284609	5368065		Planktothrix_phage(50.0%)	5	NA	NA
AUX57785.1|3280259_3280988_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AUX57786.1|3281214_3281730_-	lipoprotein	NA	NA	NA	NA	NA
AUX57787.1|3282375_3282555_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57788.1|3282607_3283747_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUX57789.1|3283778_3284609_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 241
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3297425	3327556	5368065	tRNA,protease	uncultured_Mediterranean_phage(13.33%)	24	NA	NA
AUX57798.1|3297425_3298541_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AUX57799.1|3298537_3300478_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AUX57800.1|3300417_3300600_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57801.1|3300554_3300776_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AUX57802.1|3301101_3301419_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AUX57803.1|3301449_3303729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AUX57804.1|3303849_3304068_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUX57805.1|3304421_3305141_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUX57806.1|3305167_3306889_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AUX57807.1|3306889_3308656_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AUX57808.1|3308770_3309739_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AUX59902.1|3309856_3309988_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57809.1|3310271_3310766_+	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUX57810.1|3310901_3315155_+	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AUX57811.1|3315277_3315889_+	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUX57812.1|3315897_3317241_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AUX57813.1|3317331_3318624_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AUX57814.1|3318824_3321263_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
AUX57815.1|3321273_3321891_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AUX57816.1|3321892_3322756_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AUX57817.1|3322767_3322914_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AUX57818.1|3323030_3324179_+	MFS transporter	NA	NA	NA	NA	NA
AUX57819.1|3324341_3325082_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
AUX57820.1|3325273_3327556_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 242
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3331606	3332695	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX57823.1|3331606_3332695_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 243
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3336868	3341411	5368065		Bacillus_phage(100.0%)	3	NA	NA
AUX57826.1|3336868_3337156_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
AUX57827.1|3337361_3339626_+	ComEC family protein	NA	NA	NA	NA	NA
AUX57828.1|3339662_3341411_+	lipid ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 244
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3358774	3365504	5368065	tRNA,transposase	Enterobacteria_phage(25.0%)	6	NA	NA
AUX59906.1|3358774_3359851_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
AUX59907.1|3360445_3360943_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	45.8	2.5e-34
AUX57843.1|3361201_3361843_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUX57844.1|3361979_3362102_-	hypothetical protein	NA	NA	NA	NA	NA
AUX57845.1|3362082_3363345_-|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUX57846.1|3364103_3365504_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 245
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3371566	3376689	5368065		Agrobacterium_phage(33.33%)	4	NA	NA
AUX57851.1|3371566_3372769_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
AUX57852.1|3372767_3372881_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57853.1|3373095_3375711_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
AUX57854.1|3375915_3376689_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 246
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3385455	3387363	5368065		Tupanvirus(100.0%)	1	NA	NA
AUX57862.1|3385455_3387363_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 247
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3400055	3402110	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX57877.1|3400055_3402110_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 248
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3407052	3407712	5368065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUX57886.1|3407052_3407712_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 249
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3431850	3435369	5368065		Enterobacteria_phage(100.0%)	4	NA	NA
AUX57911.1|3431850_3432024_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
AUX57912.1|3432233_3433124_+	EamA family transporter	NA	NA	NA	NA	NA
AUX57913.1|3433530_3434853_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
AUX57914.1|3434874_3435369_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 250
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3451933	3452992	5368065		Cronobacter_phage(100.0%)	1	NA	NA
AUX57930.1|3451933_3452992_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 251
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3461092	3461620	5368065		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AUX57939.1|3461092_3461620_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 252
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3469970	3470891	5368065		Morganella_phage(100.0%)	1	NA	NA
AUX57945.1|3469970_3470891_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 253
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3474132	3474384	5368065		Salmonella_phage(100.0%)	1	NA	NA
AUX57952.1|3474132_3474384_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 254
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3493539	3494721	5368065		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AUX57970.1|3493539_3494274_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
AUX57971.1|3494484_3494721_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 255
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3498000	3498642	5368065		Pseudomonas_phage(100.0%)	1	NA	NA
AUX57975.1|3498000_3498642_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 256
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3518366	3524432	5368065		Planktothrix_phage(33.33%)	6	NA	NA
AUX57992.1|3518366_3519068_+	lipoprotein ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
AUX57993.1|3519067_3520312_+	lipoprotein transporter subunit LolE	NA	NA	NA	NA	NA
AUX57994.1|3520360_3521272_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUX57995.1|3521286_3522117_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
AUX57996.1|3522207_3522552_+	hypothetical protein	NA	NA	NA	NA	NA
AUX57997.1|3522803_3524432_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
>prophage 257
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3528864	3530001	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX58002.1|3528864_3530001_-	putrescine/spermidine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 258
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3536566	3537937	5368065		Bodo_saltans_virus(100.0%)	1	NA	NA
AUX58009.1|3536566_3537937_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 259
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3541165	3542416	5368065		Phage_21(100.0%)	1	NA	NA
AUX58013.1|3541165_3542416_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 260
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3557026	3558811	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58034.1|3557026_3558811_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 261
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3562100	3565686	5368065		Morganella_phage(50.0%)	7	NA	NA
AUX58040.1|3562100_3563015_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AUX58041.1|3563104_3563743_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AUX58042.1|3563873_3564137_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58043.1|3564196_3564322_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59918.1|3564439_3564556_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58044.1|3564513_3564651_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58045.1|3564672_3565686_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
>prophage 262
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3572615	3584049	5368065		Klebsiella_phage(14.29%)	14	NA	NA
AUX58052.1|3572615_3572858_-	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
AUX58053.1|3573224_3573476_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58054.1|3573475_3574960_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX58055.1|3575038_3575458_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AUX58056.1|3575460_3576726_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
AUX58057.1|3576732_3577638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58058.1|3577804_3578554_+	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
AUX58059.1|3578550_3579768_-	MFS transporter	NA	NA	NA	NA	NA
AUX58060.1|3579943_3580825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58061.1|3580895_3581015_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58062.1|3581082_3581394_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58063.1|3581515_3581998_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AUX58064.1|3582156_3582720_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58065.1|3582765_3584049_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 263
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3587362	3588178	5368065		Indivirus(100.0%)	1	NA	NA
AUX59922.1|3587362_3588178_+	hypothetical protein	NA	A0A1V0SDE7	Indivirus	26.5	2.9e-16
>prophage 264
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3591862	3593116	5368065		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
AUX58073.1|3591862_3593116_-	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 265
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3598808	3602867	5368065		Staphylococcus_phage(50.0%)	4	NA	NA
AUX58079.1|3598808_3599792_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
AUX58080.1|3599929_3600688_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58081.1|3600829_3602188_+	MFS transporter	NA	NA	NA	NA	NA
AUX58082.1|3602225_3602867_-	nicotinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
>prophage 266
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3606741	3608105	5368065	transposase	Bacillus_phage(50.0%)	2	NA	NA
AUX58086.1|3606741_3607263_+	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	7.9e-15
AUX58087.1|3607319_3608105_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
>prophage 267
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3611849	3612755	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX58090.1|3611849_3612755_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.6	1.8e-30
>prophage 268
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3618057	3618690	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58095.1|3618057_3618690_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 269
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3624747	3625968	5368065		Klosneuvirus(100.0%)	1	NA	NA
AUX58102.1|3624747_3625968_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 270
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3632651	3633479	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX58110.1|3632651_3633479_-	NAD(+) synthase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 271
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3639743	3645477	5368065		Tupanvirus(50.0%)	5	NA	NA
AUX58119.1|3639743_3642002_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
AUX58120.1|3642114_3642447_+	cell division protein	NA	NA	NA	NA	NA
AUX58121.1|3642506_3643898_-	L-cystine transporter	NA	NA	NA	NA	NA
AUX58122.1|3644033_3644624_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUX58123.1|3644715_3645477_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 272
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3652771	3653449	5368065		Cyanophage(100.0%)	1	NA	NA
AUX58132.1|3652771_3653449_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 273
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3665693	3668651	5368065		Acinetobacter_phage(100.0%)	2	NA	NA
AUX58144.1|3665693_3667052_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
AUX58145.1|3667055_3668651_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 274
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3675770	3681136	5368065	protease	Chrysochromulina_ericina_virus(50.0%)	7	NA	NA
AUX58153.1|3675770_3676532_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
AUX59925.1|3676541_3676742_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58154.1|3676750_3677833_+|protease	protease SohB	protease	NA	NA	NA	NA
AUX58155.1|3677880_3678132_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58156.1|3678060_3678282_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58157.1|3678223_3678439_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58158.1|3678538_3681136_+	DNA topoisomerase I subunit omega	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 275
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3685976	3686579	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX58164.1|3685976_3686579_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 276
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3692169	3694104	5368065		Bodo_saltans_virus(100.0%)	1	NA	NA
AUX58173.1|3692169_3694104_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 277
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3698734	3840009	5368065	terminase,tail,lysis,protease,head,holin,integrase,transposase	Klebsiella_phage(27.78%)	177	3760951:3760968	3818125:3818142
AUX58179.1|3698734_3699544_-	peptide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AUX58180.1|3699545_3700538_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AUX58181.1|3700537_3701428_-	antimicrobial peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AUX58182.1|3701574_3702792_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
AUX58183.1|3702688_3703003_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AUX58184.1|3702999_3703662_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AUX58185.1|3703658_3704087_-	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AUX58186.1|3704083_3704764_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AUX58187.1|3705049_3705895_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AUX58188.1|3705910_3706195_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AUX58189.1|3706283_3706478_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58190.1|3706470_3706596_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58191.1|3706906_3707110_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AUX58192.1|3707191_3708268_-	nucleotide-binding protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AUX58193.1|3708555_3709254_-	hypothetical protein	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AUX58194.1|3709365_3709593_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AUX58195.1|3709633_3709855_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AUX58196.1|3709940_3710801_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AUX58197.1|3710797_3711646_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AUX58198.1|3711642_3711945_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58199.1|3712147_3713116_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
AUX58200.1|3713519_3714548_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58201.1|3715068_3715536_+	protein ninB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AUX58202.1|3715516_3715684_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AUX58203.1|3715680_3716349_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AUX58204.1|3716341_3716980_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AUX59926.1|3717116_3717806_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AUX58205.1|3718443_3718755_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AUX58206.1|3718751_3719291_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AUX58207.1|3719287_3719632_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AUX58208.1|3719628_3719904_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AUX58209.1|3719854_3720049_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AUX58210.1|3720862_3721108_+	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AUX58211.1|3721236_3721422_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58212.1|3721970_3722975_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AUX58213.1|3722952_3724260_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AUX58214.1|3724259_3725660_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AUX58215.1|3725643_3726756_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AUX58216.1|3727286_3728072_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AUX58217.1|3728082_3729036_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AUX58218.1|3729357_3729753_+	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AUX58219.1|3729754_3730009_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AUX58220.1|3730018_3730252_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AUX58221.1|3730238_3730622_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AUX58222.1|3730623_3731175_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AUX58223.1|3731171_3731564_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUX58224.1|3731587_3732760_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AUX58225.1|3732813_3733296_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58226.1|3733433_3733640_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58227.1|3733716_3734073_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AUX58228.1|3734750_3737648_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AUX58229.1|3737731_3738067_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58230.1|3738381_3738846_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AUX58231.1|3739026_3739509_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AUX58232.1|3739518_3739899_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AUX58233.1|3739895_3742964_+	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AUX58234.1|3743040_3745995_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AUX58235.1|3745998_3746730_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58236.1|3746726_3746921_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58237.1|3746954_3747554_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58238.1|3747795_3749739_-	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AUX58239.1|3749987_3750692_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX58240.1|3750582_3751542_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUX59927.1|3751687_3752479_+	ANT(3'') family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AUX58241.1|3752642_3752990_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUX58242.1|3752983_3753823_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AUX58243.1|3753752_3753932_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58244.1|3753950_3754451_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX58245.1|3754756_3754870_-	NTP-binding protein	NA	NA	NA	NA	NA
AUX58246.1|3754957_3755722_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUX58247.1|3755898_3756603_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX58248.1|3756608_3757118_+	DNA invertase	NA	A0A286S1P7	Klebsiella_phage	98.0	2.1e-76
AUX58249.1|3757195_3757618_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUX58250.1|3758264_3758516_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58251.1|3758515_3760000_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX59928.1|3760079_3760499_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AUX58252.1|3760500_3761766_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
3760951:3760968	attL	GCGGCGAAACAGTGGCAG	NA	NA	NA	NA
AUX59929.1|3761841_3762669_-	hypothetical protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AUX58253.1|3762855_3763527_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AUX58254.1|3763731_3764697_-	antimicrobial peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AUX58255.1|3766670_3767579_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUX58256.1|3767686_3768517_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX58257.1|3768495_3770805_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUX58258.1|3770976_3772146_+	amidohydrolase	NA	NA	NA	NA	NA
AUX58259.1|3772171_3773563_+	MFS transporter	NA	NA	NA	NA	NA
AUX58260.1|3773553_3774543_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AUX58261.1|3774695_3775364_+	phage shock protein PspA	NA	NA	NA	NA	NA
AUX58262.1|3775419_3775644_+	phage shock protein B	NA	NA	NA	NA	NA
AUX58263.1|3775643_3776003_+	DNA-binding transcriptional activator PspC	NA	NA	NA	NA	NA
AUX58264.1|3776031_3776250_+	phage shock protein D	NA	NA	NA	NA	NA
AUX58265.1|3776352_3777750_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58266.1|3777746_3778808_+	TIGR01620 family protein	NA	NA	NA	NA	NA
AUX58267.1|3778897_3779779_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58268.1|3779910_3781224_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AUX58269.1|3781396_3782938_+	DNA-binding transcriptional regulator TyrR	NA	NA	NA	NA	NA
AUX58270.1|3783039_3784092_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUX58271.1|3784162_3784669_-	lipid hydroperoxide peroxidase	NA	NA	NA	NA	NA
AUX58272.1|3784771_3785737_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AUX58273.1|3785733_3786441_-	murein peptide amidase A	NA	NA	NA	NA	NA
AUX58274.1|3786513_3786630_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58275.1|3786626_3788243_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AUX58276.1|3788410_3788797_-	glyoxalase	NA	NA	NA	NA	NA
AUX58277.1|3789027_3789861_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58278.1|3789985_3790870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58279.1|3791042_3792179_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58280.1|3792251_3793454_+	MFS transporter	NA	NA	NA	NA	NA
AUX58281.1|3793532_3794402_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AUX58282.1|3794426_3794564_-	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
AUX59930.1|3794587_3794878_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUX58283.1|3794948_3795137_-	cold-shock protein	NA	NA	NA	NA	NA
AUX58284.1|3795437_3796352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58285.1|3796460_3797222_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AUX58286.1|3797438_3798971_+	phosphohydrolase	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AUX58287.1|3799169_3799718_-|protease	protease	protease	NA	NA	NA	NA
AUX58288.1|3799914_3801096_+|integrase	integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AUX58289.1|3801076_3801268_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
AUX58290.1|3801278_3801425_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
AUX58291.1|3801497_3801977_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59931.1|3801973_3802087_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
AUX58292.1|3802182_3802407_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AUX58293.1|3802396_3803107_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AUX58294.1|3803112_3803631_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AUX58295.1|3803735_3804563_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AUX58296.1|3804559_3804754_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58297.1|3804750_3805176_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AUX58298.1|3805172_3805295_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
AUX58299.1|3805362_3805617_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AUX59932.1|3805609_3805771_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
AUX58300.1|3806144_3806333_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AUX58301.1|3806325_3806640_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AUX58302.1|3806810_3807479_-	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AUX58303.1|3807576_3807798_+	hypothetical protein	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AUX58304.1|3807772_3808066_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AUX58305.1|3808374_3810033_+	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AUX58306.1|3810019_3810997_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AUX58307.1|3810993_3811470_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AUX58308.1|3811466_3812249_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AUX58309.1|3812315_3812471_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58310.1|3812508_3812637_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58311.1|3812654_3812903_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUX58312.1|3812905_3813436_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AUX58313.1|3813432_3813822_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AUX58314.1|3814056_3814377_+	negative regulator GrlR	NA	NA	NA	NA	NA
AUX59933.1|3814742_3815231_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58315.1|3815181_3816582_+|terminase	terminase	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AUX58316.1|3816819_3818271_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
3818125:3818142	attR	GCGGCGAAACAGTGGCAG	NA	NA	NA	NA
AUX58317.1|3818326_3818875_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AUX58318.1|3818926_3820129_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AUX58319.1|3820132_3820627_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AUX58320.1|3820638_3821580_+	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AUX58321.1|3821619_3821901_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58322.1|3821869_3822289_+	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AUX58323.1|3822285_3822792_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58324.1|3822791_3823178_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AUX58325.1|3823272_3823713_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AUX58326.1|3823716_3824862_+	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AUX58327.1|3824872_3825313_+	hypothetical protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AUX58328.1|3825316_3825742_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AUX58329.1|3825777_3825930_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AUX58330.1|3825919_3827923_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AUX59934.1|3828108_3828522_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
AUX59935.1|3828597_3828825_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
AUX58331.1|3829848_3830190_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AUX58332.1|3830242_3830428_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59936.1|3830680_3831031_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58333.1|3831084_3831738_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AUX58334.1|3831739_3832093_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AUX58335.1|3832092_3833289_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AUX58336.1|3833285_3834059_+	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AUX58337.1|3834533_3834698_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59937.1|3834818_3834950_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58338.1|3834924_3835122_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58339.1|3835177_3838201_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
AUX58340.1|3838211_3838943_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58341.1|3838939_3839149_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58342.1|3839253_3839538_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58343.1|3839760_3840009_-	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
>prophage 278
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3847435	3852461	5368065		Cronobacter_phage(50.0%)	2	NA	NA
AUX58351.1|3847435_3850090_+	ClpV1 family T6SS ATPase	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AUX59938.1|3850091_3852461_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
>prophage 279
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3881386	3882400	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX58380.1|3881386_3882400_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 280
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3890007	3897154	5368065	tRNA	Escherichia_phage(40.0%)	9	NA	NA
AUX59940.1|3890007_3890751_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
AUX58389.1|3890769_3890952_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58390.1|3891030_3892014_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AUX58391.1|3892330_3892525_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58392.1|3892539_3893913_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AUX58393.1|3893958_3894894_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AUX58394.1|3895127_3895562_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
AUX58395.1|3895643_3895856_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUX58396.1|3895999_3897154_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 281
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3902271	3903261	5368065		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUX58401.1|3902271_3903261_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 282
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3929441	3934079	5368065		Catovirus(50.0%)	2	NA	NA
AUX58426.1|3929441_3933344_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
AUX58427.1|3933404_3934079_-	methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 283
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3942765	3943971	5368065		Klosneuvirus(100.0%)	1	NA	NA
AUX58436.1|3942765_3943971_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 284
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3956145	3959673	5368065		Enterobacteria_phage(50.0%)	6	NA	NA
AUX58448.1|3956145_3956538_-	cytoplasmic protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
AUX58449.1|3956788_3957022_-	SirA-like protein	NA	NA	NA	NA	NA
AUX58450.1|3957018_3958227_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58451.1|3958330_3958684_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58452.1|3958920_3959400_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58453.1|3959469_3959673_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 285
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3972493	3973795	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58463.1|3972493_3973795_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 286
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3985038	3985554	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX58477.1|3985038_3985554_-	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 287
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4006648	4007677	5368065		Lactobacillus_phage(100.0%)	1	NA	NA
AUX58495.1|4006648_4007677_+	hypothetical protein	NA	A0A2P0ZL82	Lactobacillus_phage	34.6	2.9e-45
>prophage 288
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4017120	4018080	5368065		Salmonella_phage(100.0%)	1	NA	NA
AUX58505.1|4017120_4018080_-	transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 289
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4035204	4037331	5368065		Escherichia_phage(100.0%)	3	NA	NA
AUX58526.1|4035204_4035813_-	DMSO reductase maturation protein DsmD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
AUX58527.1|4035854_4036712_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
AUX58528.1|4036713_4037331_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 290
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4043830	4048003	5368065		uncultured_virus(33.33%)	4	NA	NA
AUX58533.1|4043830_4044193_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.9	1.6e-22
AUX58534.1|4044306_4045590_+	MFS transporter	NA	NA	NA	NA	NA
AUX58535.1|4045843_4047307_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
AUX58536.1|4047571_4048003_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
>prophage 291
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4053141	4053816	5368065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUX58541.1|4053141_4053816_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 292
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4062959	4078854	5368065		Escherichia_phage(66.67%)	15	NA	NA
AUX58554.1|4062959_4063580_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AUX58555.1|4063572_4064838_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AUX58556.1|4064849_4065752_-	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AUX58557.1|4066012_4066774_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUX58558.1|4066794_4067655_-	class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUX58559.1|4068299_4069388_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUX58560.1|4069418_4070684_-	MFS transporter	NA	NA	NA	NA	NA
AUX58561.1|4070738_4072319_-	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	54.5	5.3e-171
AUX58562.1|4074042_4075107_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
AUX58563.1|4075103_4075223_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58564.1|4075361_4075802_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX59948.1|4075854_4076070_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AUX58565.1|4076038_4077136_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AUX58566.1|4077203_4077602_+	rhodanese	NA	NA	NA	NA	NA
AUX58567.1|4077750_4078854_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 293
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4083005	4084511	5368065		Brazilian_cedratvirus(50.0%)	2	NA	NA
AUX58571.1|4083005_4083803_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
AUX58572.1|4083812_4084511_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
>prophage 294
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4087757	4088132	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX59949.1|4087757_4088132_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 295
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4100080	4100842	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX58590.1|4100080_4100842_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 296
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4106238	4107663	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58597.1|4106238_4107663_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	3.0e-16
>prophage 297
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4120697	4121489	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX58614.1|4120697_4121489_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 298
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4131982	4133362	5368065		Enterobacteria_phage(100.0%)	1	NA	NA
AUX58626.1|4131982_4133362_+	xanthine permease XanP	NA	Q9KX94	Enterobacteria_phage	26.6	9.1e-18
>prophage 299
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4159141	4160317	5368065		Streptococcus_phage(100.0%)	1	NA	NA
AUX58656.1|4159141_4160317_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 300
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4167679	4169236	5368065		Catovirus(100.0%)	1	NA	NA
AUX58663.1|4167679_4169236_-	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 301
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4176516	4177290	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX58671.1|4176516_4177290_+	alkaline phosphatase	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 302
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4183492	4185025	5368065	transposase	Bacillus_phage(100.0%)	1	NA	NA
AUX58679.1|4183492_4185025_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
>prophage 303
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4191181	4191700	5368065		Erysipelothrix_phage(100.0%)	1	NA	NA
AUX58686.1|4191181_4191700_-	hypothetical protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.7e-25
>prophage 304
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4204782	4205835	5368065		Enterobacteria_phage(100.0%)	1	NA	NA
AUX58701.1|4204782_4205835_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	3.6e-14
>prophage 305
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4221442	4222180	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX58715.1|4221442_4222180_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 306
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4247562	4248819	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58745.1|4247562_4248819_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	4.0e-20
>prophage 307
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4254812	4258930	5368065		Pithovirus(50.0%)	4	NA	NA
AUX58751.1|4254812_4255541_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.2	2.4e-17
AUX58752.1|4255537_4256278_+	ABC transporter permease	NA	NA	NA	NA	NA
AUX58753.1|4256302_4257238_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AUX58754.1|4257544_4258930_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 308
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4263220	4265301	5368065		Bacillus_phage(100.0%)	2	NA	NA
AUX58758.1|4263220_4264564_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	8.0e-11
AUX58759.1|4264560_4265301_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
>prophage 309
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4281823	4282504	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX58773.1|4281823_4282504_-	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 310
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4288666	4291279	5368065		Rathayibacter_phage(100.0%)	1	NA	NA
AUX58780.1|4288666_4291279_-	alpha-L-rhamnosidase	NA	A0A1P8VV88	Rathayibacter_phage	21.3	7.0e-11
>prophage 311
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4301297	4301756	5368065		Stx_converting_phage(100.0%)	1	NA	NA
AUX58790.1|4301297_4301756_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.3e-10
>prophage 312
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4306509	4308846	5368065		Mycobacterium_phage(50.0%)	5	NA	NA
AUX58797.1|4306509_4306725_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
AUX58798.1|4306750_4306981_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58799.1|4306883_4307084_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58800.1|4307090_4307276_-	stress-induced bacterial acidophilic repeat motif	NA	NA	NA	NA	NA
AUX58801.1|4307931_4308846_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.4e-83
>prophage 313
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4314699	4319442	5368065		Tupanvirus(66.67%)	5	NA	NA
AUX58809.1|4314699_4316415_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	24.0	4.7e-32
AUX58810.1|4316451_4317405_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58811.1|4317579_4318179_-	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
AUX58812.1|4318210_4318342_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58813.1|4318431_4319442_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 314
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4323030	4324638	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX58817.1|4323030_4324638_+	glutathione ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	5.6e-19
>prophage 315
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4335909	4336683	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58829.1|4335909_4336683_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 316
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4343161	4344661	5368065		Mycobacterium_phage(100.0%)	1	NA	NA
AUX58836.1|4343161_4344661_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 317
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4350768	4352313	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX58840.1|4350768_4352313_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 318
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4357949	4362233	5368065		Bacillus_virus(100.0%)	6	NA	NA
AUX58845.1|4357949_4358654_-	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.8e-31
AUX58846.1|4358865_4359447_+	hypothetical protein	NA	NA	NA	NA	NA
AUX58847.1|4359570_4359798_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUX58848.1|4359868_4360486_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUX59960.1|4360563_4361415_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX58849.1|4361453_4362233_-	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 319
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4368171	4368723	5368065		Leuconostoc_phage(100.0%)	1	NA	NA
AUX58856.1|4368171_4368723_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 320
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4373286	4375392	5368065		Salmonella_phage(100.0%)	1	NA	NA
AUX58861.1|4373286_4375392_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.4	4.6e-138
>prophage 321
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4391082	4392096	5368065		Mycoplasma_phage(100.0%)	1	NA	NA
AUX58880.1|4391082_4392096_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 322
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4398965	4400927	5368065	protease	Phage_TP(100.0%)	1	NA	NA
AUX58887.1|4398965_4400927_-|protease	protease	protease	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 323
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4411358	4413999	5368065		Moumouvirus(100.0%)	2	NA	NA
AUX58898.1|4411358_4412447_+	alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
AUX58899.1|4412493_4413999_-	carboxylesterase	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
>prophage 324
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4420824	4422875	5368065		Prochlorococcus_phage(50.0%)	3	NA	NA
AUX58905.1|4420824_4421943_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	8.1e-33
AUX58906.1|4421967_4422243_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58907.1|4422347_4422875_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 325
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4428426	4429797	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX58915.1|4428426_4429797_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.9	2.3e-66
>prophage 326
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4441052	4442339	5368065	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AUX58928.1|4441052_4442339_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 327
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4445663	4447025	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58932.1|4445663_4447025_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	2.6e-17
>prophage 328
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4450831	4452319	5368065		Salmonella_phage(50.0%)	2	NA	NA
AUX58937.1|4450831_4451353_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	58.0	1.1e-51
AUX58938.1|4451422_4452319_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
>prophage 329
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4456506	4457379	5368065		Bacillus_phage(100.0%)	1	NA	NA
AUX58945.1|4456506_4457379_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 330
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4460651	4471659	5368065		Enterobacteria_phage(20.0%)	12	NA	NA
AUX58949.1|4460651_4461677_+	transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
AUX58950.1|4461603_4462608_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX58951.1|4462720_4463902_+	Bcr/CflA family multidrug efflux transporter	NA	NA	NA	NA	NA
AUX58952.1|4464194_4465343_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
AUX58953.1|4465379_4466015_-	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AUX58954.1|4466244_4467618_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUX58955.1|4467793_4468144_+	acid-shock protein	NA	NA	NA	NA	NA
AUX58956.1|4468285_4468864_-	Rossman fold protein, TIGR00730 family	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
AUX59968.1|4469543_4469714_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58957.1|4469767_4470028_-	hypothetical protein	NA	NA	NA	NA	NA
AUX58958.1|4469937_4470156_-	ATPase	NA	NA	NA	NA	NA
AUX58959.1|4470774_4471659_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
>prophage 331
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4477134	4477905	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX58969.1|4477134_4477905_-	decarboxylase	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 332
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4483089	4485038	5368065		Bacillus_virus(50.0%)	2	NA	NA
AUX58975.1|4483089_4484070_+	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
AUX58976.1|4484066_4485038_+	peptide ABC transporter substrate-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
>prophage 333
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4499061	4499892	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX58991.1|4499061_4499892_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.9e-26
>prophage 334
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4524230	4524854	5368065		Staphylococcus_phage(100.0%)	1	NA	NA
AUX59017.1|4524230_4524854_-	heme ABC transporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 335
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4529711	4530782	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX59022.1|4529711_4530782_-	lipase	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 336
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4550305	4551127	5368065		Planktothrix_phage(100.0%)	1	NA	NA
AUX59037.1|4550305_4551127_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 337
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4554525	4555299	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX59039.1|4554525_4555299_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 338
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4565949	4567913	5368065		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AUX59049.1|4565949_4566966_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
AUX59050.1|4566962_4567913_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.8e-34
>prophage 339
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4575350	4576100	5368065		Erysipelothrix_phage(100.0%)	1	NA	NA
AUX59058.1|4575350_4576100_+	ABC transporter	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 340
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4586020	4589233	5368065		environmental_halophage(50.0%)	3	NA	NA
AUX59070.1|4586020_4587241_-	bifunctional cysteine desulfurase/selenocysteine lyase	NA	Q2XUY6	environmental_halophage	42.3	7.6e-93
AUX59071.1|4587237_4588512_-	FeS cluster assembly protein SufD	NA	NA	NA	NA	NA
AUX59072.1|4588486_4589233_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 341
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4603689	4604451	5368065		Indivirus(100.0%)	1	NA	NA
AUX59087.1|4603689_4604451_+	sugar ABC transporter substrate-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.4e-15
>prophage 342
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4614429	4622398	5368065		Hokovirus(25.0%)	8	NA	NA
AUX59096.1|4614429_4616808_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	4.2e-172
AUX59097.1|4616883_4617003_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59976.1|4617147_4617981_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AUX59977.1|4618135_4619182_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
AUX59098.1|4619289_4619517_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AUX59099.1|4619546_4620989_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	37.2	1.1e-55
AUX59100.1|4621102_4621567_-	endopeptidase	NA	NA	NA	NA	NA
AUX59101.1|4621648_4622398_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.9e-10
>prophage 343
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4629465	4636634	5368065	tRNA	Geobacillus_virus(25.0%)	7	NA	NA
AUX59108.1|4629465_4629765_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AUX59109.1|4629769_4632157_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUX59110.1|4632172_4633156_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AUX59111.1|4633462_4633819_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUX59112.1|4633869_4634067_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUX59113.1|4634159_4634702_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AUX59114.1|4634705_4636634_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 344
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4646287	4649183	5368065		Lactobacillus_phage(33.33%)	3	NA	NA
AUX59127.1|4646287_4647115_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
AUX59128.1|4647168_4648173_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AUX59129.1|4648169_4649183_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 345
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4657442	4663712	5368065		Citrobacter_phage(25.0%)	8	NA	NA
AUX59978.1|4657442_4658060_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
AUX59137.1|4658067_4658199_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59138.1|4658621_4659029_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX59139.1|4659150_4660053_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
AUX59140.1|4660250_4661264_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AUX59141.1|4661353_4662256_-	patatin family protein	NA	NA	NA	NA	NA
AUX59142.1|4662356_4662827_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59143.1|4662869_4663712_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 346
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4667722	4669258	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX59148.1|4667722_4669258_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 347
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4685750	4686539	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX59156.1|4685750_4686539_-	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 348
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4692050	4697764	5368065		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
AUX59163.1|4692050_4692302_-	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	7.6e-08
AUX59164.1|4692544_4693645_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AUX59165.1|4693731_4694586_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AUX59166.1|4694625_4695438_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59167.1|4695441_4695834_-	siroheme synthase	NA	NA	NA	NA	NA
AUX59168.1|4695833_4696682_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AUX59169.1|4696681_4697764_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 349
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4700976	4703728	5368065		Tupanvirus(50.0%)	2	NA	NA
AUX59172.1|4700976_4701924_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
AUX59173.1|4702048_4703728_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
>prophage 350
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4721571	4723539	5368065		Microcystis_phage(50.0%)	3	NA	NA
AUX59191.1|4721571_4722465_-	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	26.8	6.3e-12
AUX59985.1|4722486_4722603_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59192.1|4722648_4723539_-	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	30.9	2.0e-10
>prophage 351
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4733189	4746141	5368065	transposase	Staphylococcus_phage(33.33%)	14	NA	NA
AUX59198.1|4733189_4734398_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AUX59199.1|4734440_4734716_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59987.1|4734830_4735370_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUX59200.1|4735395_4736187_-	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
AUX59201.1|4736284_4736767_+	cold-shock protein	NA	NA	NA	NA	NA
AUX59202.1|4736876_4737776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX59203.1|4737750_4738560_-	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX59204.1|4738571_4739867_-	citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AUX59205.1|4740170_4741097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX59206.1|4741197_4741674_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX59207.1|4741723_4743367_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
AUX59208.1|4743650_4744544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX59209.1|4744549_4745269_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
AUX59210.1|4745265_4746141_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
>prophage 352
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4750003	4752298	5368065		Tetraselmis_virus(100.0%)	1	NA	NA
AUX59988.1|4750003_4752298_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.1e-158
>prophage 353
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4769439	4770051	5368065		Geobacillus_virus(100.0%)	1	NA	NA
AUX59231.1|4769439_4770051_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 354
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4785676	4793045	5368065	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AUX59247.1|4785676_4787416_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.8e-34
AUX59248.1|4787567_4788149_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59249.1|4788187_4788883_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUX59250.1|4789028_4790939_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
AUX59251.1|4791070_4791415_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59252.1|4791415_4791601_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59253.1|4791689_4793045_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	40.4	2.3e-42
>prophage 355
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4796977	4798525	5368065		Moraxella_phage(100.0%)	1	NA	NA
AUX59257.1|4796977_4798525_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	8.6e-41
>prophage 356
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4805977	4806187	5368065		Morganella_phage(100.0%)	1	NA	NA
AUX59266.1|4805977_4806187_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 357
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4811424	4813473	5368065		Moraxella_phage(100.0%)	1	NA	NA
AUX59274.1|4811424_4813473_-	C-terminal processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 358
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4820980	4821634	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX59281.1|4820980_4821634_-	serine/threonine-protein phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.0e-55
>prophage 359
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4825358	4826327	5368065		Pectobacterium_phage(50.0%)	2	NA	NA
AUX59286.1|4825358_4825589_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
AUX59287.1|4825667_4826327_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 360
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4833752	4835228	5368065		Cyanophage(100.0%)	1	NA	NA
AUX59294.1|4833752_4835228_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 361
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4839153	4855700	5368065	tRNA	Tupanvirus(25.0%)	18	NA	NA
AUX59299.1|4839153_4840473_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
AUX59300.1|4840488_4841433_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX59301.1|4841511_4842264_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
AUX59302.1|4842263_4843049_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUX59303.1|4843112_4844123_-	Holliday junction DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AUX59304.1|4844131_4844743_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AUX59305.1|4844822_4845344_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AUX59306.1|4845378_4846119_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59307.1|4846146_4846590_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUX59308.1|4846591_4848379_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AUX59309.1|4848646_4849213_+	hydrolase	NA	NA	NA	NA	NA
AUX59310.1|4849209_4850028_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AUX59311.1|4850080_4850476_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59312.1|4850515_4851259_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AUX59313.1|4851255_4852260_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUX59314.1|4852341_4853085_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUX59315.1|4853161_4853731_-	metalloprotein	NA	NA	NA	NA	NA
AUX59316.1|4853966_4855700_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 362
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4862638	4864153	5368065		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUX59323.1|4862638_4864153_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 363
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4880762	4881515	5368065		Bacillus_virus(100.0%)	1	NA	NA
AUX59342.1|4880762_4881515_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 364
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4888116	4896560	5368065		Burkholderia_phage(40.0%)	7	NA	NA
AUX59351.1|4888116_4889796_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
AUX59352.1|4889911_4890823_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59353.1|4891006_4891918_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AUX59998.1|4891892_4892387_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
AUX59354.1|4892367_4893768_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
AUX59355.1|4893844_4894552_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AUX59356.1|4895414_4896560_+	porin	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 365
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4916192	4917029	5368065		Mycobacterium_phage(100.0%)	1	NA	NA
AUX59372.1|4916192_4917029_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 366
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4932008	4939102	5368065		Pseudomonas_phage(33.33%)	5	NA	NA
AUX59390.1|4932008_4933493_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX59391.1|4933492_4933744_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59392.1|4934013_4935183_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
AUX59393.1|4935357_4936782_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AUX59394.1|4936999_4939102_-	translation elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.2e-63
>prophage 367
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4943609	4944509	5368065		Cellulophaga_phage(100.0%)	1	NA	NA
AUX59399.1|4943609_4944509_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 368
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4950053	4954706	5368065	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
AUX59406.1|4950053_4950650_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A1V0SIZ6	Klosneuvirus	34.2	4.8e-16
AUX59407.1|4951107_4951548_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AUX59408.1|4951544_4951895_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AUX60002.1|4951958_4953518_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	5.9e-175
AUX59409.1|4953510_4953843_+|transposase	transposase	transposase	Q76S41	Shigella_phage	97.9	7.2e-46
AUX59410.1|4953800_4954706_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.7e-169
>prophage 369
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4964787	4970599	5368065		Cafeteria_roenbergensis_virus(25.0%)	6	NA	NA
AUX59417.1|4964787_4965792_+	protein CapI	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.3	1.4e-31
AUX59418.1|4965862_4966057_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59419.1|4966193_4966316_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59420.1|4966739_4967906_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AUX59421.1|4968148_4969555_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AUX59422.1|4969744_4970599_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	44.2	2.0e-47
>prophage 370
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4978821	4981336	5368065		Enterobacteria_phage(100.0%)	3	NA	NA
AUX59428.1|4978821_4979379_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.0	5.0e-60
AUX59429.1|4979381_4980251_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	3.6e-113
AUX59430.1|4980271_4981336_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	2.8e-99
>prophage 371
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4992863	4998177	5368065		Moraxella_phage(33.33%)	4	NA	NA
AUX59439.1|4992863_4994447_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AUX59440.1|4994985_4996833_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AUX59441.1|4996863_4997445_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AUX59442.1|4997535_4998177_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 372
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5015296	5022201	5368065		Bacillus_phage(33.33%)	6	NA	NA
AUX59454.1|5015296_5016775_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AUX59455.1|5016771_5017494_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AUX59456.1|5017812_5019174_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AUX59457.1|5019416_5020313_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AUX59458.1|5020553_5021327_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AUX60003.1|5021337_5022201_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 373
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5049220	5056274	5368065	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
AUX60004.1|5049220_5051254_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
AUX59484.1|5051368_5051839_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
AUX59485.1|5051886_5052606_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUX59486.1|5052599_5054288_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
AUX59487.1|5054517_5054631_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59488.1|5054605_5055343_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUX59489.1|5055326_5056274_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 374
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5062808	5063363	5368065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUX59494.1|5062808_5063363_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 375
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5079387	5080908	5368065		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUX59510.1|5079387_5080908_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 376
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5084672	5090385	5368065	transposase	Cellulophaga_phage(25.0%)	5	NA	NA
AUX59514.1|5084672_5085341_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
AUX59515.1|5085701_5086535_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUX59516.1|5086605_5088579_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
AUX59517.1|5089021_5089807_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AUX59518.1|5089863_5090385_-	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	7.9e-15
>prophage 377
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5094426	5095281	5368065		Catovirus(100.0%)	1	NA	NA
AUX59523.1|5094426_5095281_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 378
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5103113	5107425	5368065		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AUX59532.1|5103113_5104580_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
AUX59533.1|5104700_5105678_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59534.1|5105715_5106429_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59535.1|5106855_5107425_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 379
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5113180	5119267	5368065		Planktothrix_phage(33.33%)	5	NA	NA
AUX59540.1|5113180_5114770_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	7.7e-21
AUX59541.1|5114773_5115118_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59542.1|5115449_5116646_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
AUX59543.1|5116642_5117362_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AUX59544.1|5117509_5119267_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 380
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5123502	5124510	5368065		Vibrio_phage(100.0%)	1	NA	NA
AUX59550.1|5123502_5124510_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 381
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5130875	5132036	5368065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUX59556.1|5130875_5132036_+	transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 382
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5135956	5139354	5368065		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
AUX59560.1|5135956_5137021_-	bifunctional transcriptional regulator/O6-methylguanine-DNA methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
AUX59561.1|5137094_5138147_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUX59562.1|5138250_5139354_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
>prophage 383
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5143493	5155624	5368065		Pseudomonas_phage(33.33%)	8	NA	NA
AUX59566.1|5143493_5146334_-	two-component system sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
AUX59567.1|5146465_5149099_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
AUX59568.1|5149245_5149974_+	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
AUX59569.1|5150318_5152604_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
AUX59570.1|5152705_5153836_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AUX59571.1|5153835_5154090_+	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
AUX59572.1|5154251_5154557_+	oxidoreductase	NA	NA	NA	NA	NA
AUX59573.1|5154553_5155624_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 384
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5163469	5164675	5368065		Oenococcus_phage(100.0%)	1	NA	NA
AUX59580.1|5163469_5164675_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 385
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5167791	5168745	5368065		Sodalis_phage(100.0%)	1	NA	NA
AUX59585.1|5167791_5168745_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 386
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5196770	5197370	5368065		Salmonella_phage(100.0%)	1	NA	NA
AUX59610.1|5196770_5197370_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 387
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5209772	5210546	5368065		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUX59625.1|5209772_5210546_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 388
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5214837	5216355	5368065		Mollivirus(100.0%)	1	NA	NA
AUX59632.1|5214837_5216355_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 389
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5222797	5223934	5368065		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUX59640.1|5222797_5223934_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 390
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5232416	5233502	5368065		Pandoravirus(100.0%)	1	NA	NA
AUX59647.1|5232416_5233502_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 391
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5242737	5247200	5368065	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
AUX59656.1|5242737_5243547_+	transporter	NA	E7DYY8	Enterobacteria_phage	84.8	6.1e-123
AUX59657.1|5243959_5244442_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59658.1|5244809_5245691_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AUX59659.1|5245700_5246609_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
AUX59660.1|5246741_5247200_+|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYZ2	Pandoravirus	33.9	1.6e-11
>prophage 392
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5250488	5252917	5368065		Enterobacteria_phage(50.0%)	2	NA	NA
AUX60007.1|5250488_5252168_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.4	3.3e-46
AUX59665.1|5252164_5252917_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 393
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5267407	5277334	5368065		Lactobacillus_phage(25.0%)	11	NA	NA
AUX59676.1|5267407_5268334_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
AUX59677.1|5268422_5269421_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59678.1|5269417_5269636_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59679.1|5269637_5271653_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
AUX59680.1|5271722_5272784_-	cell division protein ZipA	NA	NA	NA	NA	NA
AUX59681.1|5272834_5272978_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59682.1|5273014_5273776_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AUX59683.1|5273952_5274924_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
AUX60009.1|5275135_5275261_+	hypothetical protein	NA	NA	NA	NA	NA
AUX59684.1|5275304_5275562_+	PTS sugar transporter	NA	NA	NA	NA	NA
AUX59685.1|5275606_5277334_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 394
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5280942	5283067	5368065		Lactococcus_phage(50.0%)	2	NA	NA
AUX59691.1|5280942_5281854_-	cysteine synthase B	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
AUX59692.1|5281972_5283067_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 395
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5286420	5289997	5368065		Pandoravirus(50.0%)	5	NA	NA
AUX59697.1|5286420_5287320_-	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
AUX59698.1|5287414_5287990_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AUX59699.1|5288051_5288501_-	hypothetical protein	NA	NA	NA	NA	NA
AUX59700.1|5288487_5288913_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUX59701.1|5289124_5289997_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 396
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5324896	5325610	5368065		Cyanophage(100.0%)	1	NA	NA
AUX59734.1|5324896_5325610_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 397
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5332254	5335249	5368065		Sodalis_phage(50.0%)	3	NA	NA
AUX59742.1|5332254_5333166_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AUX59743.1|5333162_5333864_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AUX59744.1|5333962_5335249_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
>prophage 398
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5338788	5340464	5368065		Prochlorococcus_phage(100.0%)	2	NA	NA
AUX59748.1|5338788_5339826_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AUX59749.1|5339822_5340464_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
>prophage 399
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5346893	5347067	5368065		Escherichia_phage(100.0%)	1	NA	NA
AUX59753.1|5346893_5347067_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
>prophage 400
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5350836	5354719	5368065	holin	Salmonella_phage(60.0%)	5	NA	NA
AUX59756.1|5350836_5352705_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AUX59757.1|5352924_5353407_-	endopeptidase	NA	Q858E9	Salmonella_phage	77.5	4.8e-59
AUX59758.1|5353403_5354033_-	endolysin	NA	Q858F0	Salmonella_phage	77.9	1.6e-91
AUX59759.1|5354022_5354328_-|holin	holin	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AUX59760.1|5354314_5354719_-	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	6.0e-55
>prophage 401
CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5357815	5361367	5368065		Escherichia_phage(50.0%)	4	NA	NA
AUX60012.1|5357815_5358112_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AUX59762.1|5358210_5358363_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AUX59763.1|5358397_5358694_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	4.4e-47
AUX59764.1|5358892_5361367_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
>prophage 1
CP018886	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence	217456	13412	48786	217456	transposase,holin	Bacillus_phage(28.57%)	32	NA	NA
AUX60023.1|13412_14381_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
AUX60024.1|15053_15311_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60025.1|15912_17367_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUX60026.1|18349_19627_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60214.1|19689_21687_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AUX60027.1|21838_22342_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.2	1.6e-84
AUX60028.1|22260_22536_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	93.4	6.6e-45
AUX60215.1|22726_23563_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.1e-94
AUX60029.1|23945_24914_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.7e-13
AUX60030.1|25129_25675_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.2	2.9e-84
AUX60031.1|25684_26233_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX60032.1|26528_26960_-	copper-binding protein	NA	NA	NA	NA	NA
AUX60033.1|27210_28686_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUX60034.1|28678_29359_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AUX60035.1|29548_30934_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60036.1|30962_31316_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX60037.1|31429_32722_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUX60038.1|32732_35879_+	cation transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AUX60039.1|35965_36406_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60040.1|36532_38980_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AUX60041.1|39020_39218_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60042.1|39251_39989_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AUX60043.1|40277_40727_-	copper resistance protein	NA	NA	NA	NA	NA
AUX60044.1|40960_42778_+	copper oxidase	NA	NA	NA	NA	NA
AUX60045.1|42777_43674_+	copper resistance protein CopB	NA	NA	NA	NA	NA
AUX60046.1|43713_44094_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AUX60047.1|44098_45028_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AUX60048.1|45082_45763_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUX60049.1|45759_47160_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AUX60050.1|47376_47811_+	copper-binding protein	NA	NA	NA	NA	NA
AUX60217.1|48042_48222_-	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AUX60216.1|48282_48786_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018886	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence	217456	64264	114071	217456	transposase,integrase,protease	Escherichia_phage(34.78%)	52	61357:61370	111603:111616
61357:61370	attL	AGGAACAGGAGCAT	NA	NA	NA	NA
AUX60070.1|64264_65623_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX60071.1|66123_66897_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	2.3e-47
AUX60220.1|66845_67325_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60072.1|67465_68428_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AUX60073.1|68414_69164_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUX60074.1|69401_69599_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60075.1|69598_72394_-|protease	Clp protease ClpC	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AUX60076.1|72508_73078_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUX60221.1|73112_73394_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AUX60077.1|73493_74240_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	72.7	4.8e-05
AUX60222.1|74424_74700_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	94.5	8.6e-45
AUX60078.1|74618_75122_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	92.2	1.8e-88
AUX60079.1|75380_76361_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AUX60223.1|76399_76486_-	ABC transporter	NA	NA	NA	NA	NA
AUX60224.1|76537_76864_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60080.1|77569_78439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX60081.1|78432_79443_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AUX60225.1|79451_80279_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AUX60082.1|80287_81151_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX60083.1|81147_81975_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AUX60084.1|82830_83535_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUX60085.1|84838_85507_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
AUX60086.1|85696_86512_-	APH(3') family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AUX60087.1|86662_87367_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUX60088.1|87488_88394_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUX60089.1|88390_89629_+	MFS transporter	NA	NA	NA	NA	NA
AUX60090.1|89628_90213_+	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUX60091.1|90326_90515_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60092.1|90705_91470_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUX60093.1|91498_91681_+	resolvase	NA	NA	NA	NA	NA
AUX60094.1|91696_92002_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUX60095.1|92012_93218_-	chromate transporter	NA	NA	NA	NA	NA
AUX60096.1|93373_93577_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60097.1|93595_93775_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60098.1|93704_94544_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUX60099.1|94537_94885_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUX60100.1|95292_98310_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AUX60101.1|98448_98826_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AUX60102.1|98822_99170_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AUX60103.1|100824_101172_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	98.3	2.6e-62
AUX60104.1|102992_104726_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AUX60105.1|104733_105681_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AUX60106.1|105725_107330_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX60107.1|107342_108263_-	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUX60108.1|108262_109111_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUX60109.1|109107_109701_-	response regulator	NA	NA	NA	NA	NA
AUX60110.1|109697_110825_-	regulator	NA	NA	NA	NA	NA
AUX60111.1|111109_111277_-|integrase	integrase	integrase	NA	NA	NA	NA
AUX60112.1|112379_112901_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
111603:111616	attR	AGGAACAGGAGCAT	NA	NA	NA	NA
AUX60113.1|112897_113380_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUX60114.1|113373_113877_-|transposase	transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AUX60115.1|113795_114071_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 1
CP018887	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence	123208	19674	103045	123208	transposase,integrase,protease	Escherichia_phage(26.67%)	93	12039:12055	111791:111807
12039:12055	attL	GTGTATTGCACAATACA	NA	NA	NA	NA
AUX60251.1|19674_20379_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX60355.1|20477_21278_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	2.3e-50
AUX60252.1|21468_21663_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60253.1|21706_21937_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60356.1|21950_22163_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX60254.1|22187_22556_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60255.1|22599_23094_-	DNA-binding protein	NA	NA	NA	NA	NA
AUX60256.1|23124_23697_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60257.1|23693_23942_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60258.1|24030_24315_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60259.1|24508_24853_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60260.1|24960_25596_-|protease	protease	protease	NA	NA	NA	NA
AUX60261.1|25595_27704_-	colicin V synthesis protein	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
AUX60262.1|27693_28971_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AUX60263.1|30547_30964_-	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUX60264.1|30960_31191_-	antitoxin	NA	NA	NA	NA	NA
AUX60357.1|31853_32060_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60265.1|32441_32771_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60266.1|32796_33195_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60267.1|33201_33534_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60268.1|33533_34316_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AUX60269.1|35170_35365_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60270.1|35529_36003_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUX60271.1|36122_37391_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
AUX60272.1|37395_40653_-	restriction endonuclease	NA	NA	NA	NA	NA
AUX60273.1|40653_41970_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUX60274.1|41966_43994_-	restriction endonuclease subunit M	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AUX60275.1|44105_44321_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60276.1|44545_44878_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60277.1|44897_45083_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60278.1|45254_46229_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AUX60279.1|46225_47431_-	chromosome partitioning protein ParA	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AUX60280.1|47752_48649_-	protein RepA	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AUX60281.1|49049_50321_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AUX60282.1|50320_50752_-	protein impA	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AUX60283.1|50983_51955_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUX60284.1|51957_52629_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUX60285.1|52689_52920_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60286.1|53038_53155_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60287.1|53356_54058_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AUX60288.1|54057_54279_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60289.1|54288_54708_+	adenine-specific methyltransferase	NA	NA	NA	NA	NA
AUX60358.1|54894_55074_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX60290.1|55032_56046_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUX60359.1|55975_56302_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60291.1|56204_56678_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	30.7	8.7e-13
AUX60292.1|56861_57194_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUX60293.1|57442_58066_-	resolvase	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
AUX60294.1|58125_58830_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX60360.1|58865_60410_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
AUX60361.1|60451_60694_+	relaxase	NA	NA	NA	NA	NA
AUX60362.1|60725_61376_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUX60363.1|61463_62681_+	TetA family tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUX60295.1|62712_63597_-	EamA family transporter	NA	NA	NA	NA	NA
AUX60364.1|63734_64127_-	isochorismatase	NA	NA	NA	NA	NA
AUX60296.1|64903_65509_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AUX60297.1|66681_69699_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AUX60298.1|70350_71259_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX60299.1|71255_72473_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX60300.1|72598_73303_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX60365.1|73934_74765_-	class D beta-lactamase	NA	NA	NA	NA	NA
AUX60366.1|74895_75495_-	AacA4 family aminoglycoside N(6')-acetyltransferase	NA	NA	NA	NA	NA
AUX60301.1|75593_76298_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX60302.1|76288_77407_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.1e-34
AUX60367.1|77440_78844_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	6.9e-106
AUX60303.1|78978_79245_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.2	1.2e-40
AUX60304.1|79255_79462_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60305.1|79466_79853_-	restriction endonuclease	NA	NA	NA	NA	NA
AUX60306.1|79903_80872_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
AUX60307.1|81228_81540_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60308.1|81575_81890_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AUX60309.1|81886_82231_-	hypothetical protein	NA	NA	NA	NA	NA
AUX60368.1|82246_82597_-	KorB	NA	NA	NA	NA	NA
AUX60310.1|82660_83398_+	traL protein	NA	NA	NA	NA	NA
AUX60311.1|83406_83688_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX60312.1|83697_83991_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUX60313.1|84041_84359_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AUX60314.1|84358_86959_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AUX60315.1|86976_87690_+	type IV secretion system protein	NA	NA	NA	NA	NA
AUX60316.1|87697_87925_+	entry exclusion protein	NA	NA	NA	NA	NA
AUX60317.1|87940_88981_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AUX60318.1|89063_89210_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AUX60369.1|89283_89898_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AUX60319.1|89908_90793_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AUX60320.1|90792_91953_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AUX60321.1|91994_92990_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUX60322.1|92989_93169_+	hypothetical protein	NA	NA	NA	NA	NA
AUX60323.1|93445_94765_+|transposase	DDE transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUX60324.1|95014_95896_-	KPC family carbapenem-hydrolyzing class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUX60325.1|96282_97062_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUX60326.1|97058_98084_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUX60327.1|98190_101220_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AUX60328.1|101329_103045_+|integrase	integrase	integrase	NA	NA	NA	NA
111791:111807	attR	GTGTATTGCACAATACA	NA	NA	NA	NA
