The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	296470	303375	5309490		Planktothrix_phage(33.33%)	6	NA	NA
AUX54265.1|296470_297334_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AUX49445.1|297344_298118_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AUX49446.1|298358_299255_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AUX49447.1|299497_300859_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AUX49448.1|301177_301900_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AUX49449.1|301896_303375_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	328957	369395	5309490	transposase	Enterobacteria_phage(26.67%)	35	NA	NA
AUX49466.1|328957_329461_-|transposase	transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AUX49467.1|329379_329655_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUX49468.1|329810_329933_-	hypothetical protein	NA	NA	NA	NA	NA
AUX49469.1|330223_331663_+	hypothetical protein	NA	NA	NA	NA	NA
AUX49470.1|331808_332948_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AUX49471.1|332947_333382_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUX49472.1|333399_335562_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
AUX49473.1|335687_337115_+	UDP-phosphate galactose phosphotransferase	NA	NA	NA	NA	NA
AUX49474.1|337145_338057_+	rhamnosyltransferase	NA	NA	NA	NA	NA
AUX49475.1|338112_339177_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	2.8e-99
AUX49476.1|339197_340067_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	3.6e-113
AUX49477.1|340069_340627_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.0	5.0e-60
AUX49478.1|340709_341702_+	hypothetical protein	NA	NA	NA	NA	NA
AUX49479.1|341736_342603_+	hypothetical protein	NA	NA	NA	NA	NA
AUX49480.1|345204_346176_+	hypothetical protein	NA	NA	NA	NA	NA
AUX49481.1|346245_347790_+	hypothetical protein	NA	NA	NA	NA	NA
AUX49482.1|347790_348813_+	exosortase	NA	NA	NA	NA	NA
AUX49483.1|348849_349704_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	44.2	2.0e-47
AUX49484.1|349893_351300_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AUX49485.1|351542_352709_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AUX49486.1|353132_353255_-	hypothetical protein	NA	NA	NA	NA	NA
AUX49487.1|353391_353586_-	hypothetical protein	NA	NA	NA	NA	NA
AUX49488.1|353656_354661_-	protein CapI	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.3	1.4e-31
AUX49489.1|354997_357028_-	hypothetical protein	NA	NA	NA	NA	NA
AUX49490.1|357033_358224_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUX49491.1|358244_360362_-	hypothetical protein	NA	NA	NA	NA	NA
AUX49492.1|360366_361776_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUX49493.1|361765_362578_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUX49494.1|362584_363730_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUX49495.1|364742_365648_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.7e-169
AUX49496.1|365605_365938_-|transposase	transposase	transposase	Q76S41	Shigella_phage	97.9	7.2e-46
AUX54266.1|365930_367490_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	5.9e-175
AUX49497.1|367553_367904_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AUX49498.1|367900_368341_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AUX49499.1|368798_369395_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A1V0SIZ6	Klosneuvirus	34.2	4.8e-16
>prophage 3
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	1251124	1257553	5309490		Escherichia_phage(100.0%)	6	NA	NA
AUX50347.1|1251124_1252213_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUX50348.1|1252857_1253718_+	class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUX50349.1|1253738_1254500_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUX50350.1|1254760_1255663_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AUX50351.1|1255674_1256940_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AUX50352.1|1256932_1257553_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	1482313	1524055	5309490	head,terminase,protease,tail,lysis,integrase	Klebsiella_phage(35.42%)	63	1515168:1515182	1521177:1521191
AUX50566.1|1482313_1485337_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
AUX50567.1|1485392_1485590_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54328.1|1485564_1485696_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50568.1|1485816_1485981_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50569.1|1486455_1487229_-	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AUX50570.1|1487225_1488422_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AUX50571.1|1488421_1488775_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AUX50572.1|1488776_1489430_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AUX54329.1|1489483_1489834_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50573.1|1490086_1490272_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50574.1|1490324_1490666_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AUX50575.1|1490665_1491688_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AUX54330.1|1491690_1491918_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
AUX54331.1|1491993_1492407_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
AUX50576.1|1492592_1494596_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AUX50577.1|1494585_1494738_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AUX50578.1|1494773_1495199_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AUX50579.1|1495202_1495643_-	hypothetical protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AUX50580.1|1495653_1496799_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AUX50581.1|1496802_1497243_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AUX50582.1|1497337_1497724_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AUX50583.1|1497723_1498230_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50584.1|1498226_1498646_-	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AUX50585.1|1498614_1498896_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50586.1|1498935_1499877_-	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AUX50587.1|1499888_1500383_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AUX50588.1|1500386_1501589_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AUX50589.1|1501640_1502189_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AUX50590.1|1502244_1503696_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AUX50591.1|1503933_1505334_-|terminase	terminase	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AUX54332.1|1505284_1505773_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50592.1|1506138_1506459_-	negative regulator GrlR	NA	NA	NA	NA	NA
AUX50593.1|1506693_1507083_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AUX50594.1|1507079_1507610_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AUX50595.1|1507612_1507861_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AUX50596.1|1507878_1508007_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50597.1|1508044_1508200_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50598.1|1508266_1509049_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AUX50599.1|1509045_1509522_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AUX50600.1|1509518_1510496_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AUX50601.1|1510482_1512141_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AUX50602.1|1512449_1512743_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AUX50603.1|1512717_1512939_-	hypothetical protein	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AUX50604.1|1513036_1513705_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AUX50605.1|1513875_1514190_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AUX50606.1|1514182_1514371_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AUX54333.1|1514744_1514906_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
AUX50607.1|1514898_1515153_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
1515168:1515182	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
AUX50608.1|1515220_1515343_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
AUX50609.1|1515339_1515765_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AUX50610.1|1515761_1515956_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50611.1|1515952_1516780_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AUX50612.1|1516884_1517403_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AUX50613.1|1517408_1518119_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AUX50614.1|1518108_1518333_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AUX54334.1|1518428_1518542_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
AUX50615.1|1518538_1519018_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50616.1|1519090_1519237_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
AUX50617.1|1519247_1519439_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
AUX50618.1|1519419_1520601_-|integrase	integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AUX50619.1|1520797_1521346_+|protease	protease	protease	NA	NA	NA	NA
1521177:1521191	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
AUX50620.1|1521544_1523077_-	phosphohydrolase	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AUX50621.1|1523293_1524055_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 5
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	1556988	1621716	5309490	terminase,tail,transposase,integrase,holin	Klebsiella_phage(22.41%)	78	1556770:1556785	1619022:1619037
1556770:1556785	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AUX50653.1|1556988_1557660_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AUX54336.1|1557846_1558674_+	hypothetical protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AUX50654.1|1558749_1560015_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AUX54337.1|1560016_1560436_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AUX50655.1|1560515_1562000_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX50656.1|1561999_1562251_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50657.1|1562897_1563320_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUX50658.1|1563397_1563907_-	DNA invertase	NA	A0A286S1P7	Klebsiella_phage	98.0	2.1e-76
AUX50659.1|1563912_1564617_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX50660.1|1564793_1565558_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUX50661.1|1565645_1565759_+	NTP-binding protein	NA	NA	NA	NA	NA
AUX50662.1|1566064_1566565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX50663.1|1566583_1566763_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50664.1|1566692_1567532_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AUX50665.1|1567525_1567873_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUX54338.1|1568036_1568828_-	ANT(3'') family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AUX50666.1|1568973_1569933_+|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUX50667.1|1569823_1570528_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX50668.1|1570712_1572656_+	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AUX50669.1|1572897_1573497_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50670.1|1573530_1573725_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50671.1|1573721_1574453_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50672.1|1574456_1577411_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AUX50673.1|1577487_1580556_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AUX50674.1|1580552_1580933_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AUX50675.1|1580942_1581425_-	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AUX50676.1|1581605_1582070_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AUX50677.1|1582384_1582720_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50678.1|1582803_1585701_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AUX50679.1|1586378_1586735_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AUX50680.1|1586811_1587018_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50681.1|1587155_1587638_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50682.1|1587691_1588864_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AUX50683.1|1588887_1589280_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUX50684.1|1589276_1589828_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AUX50685.1|1589829_1590213_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AUX50686.1|1590199_1590433_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AUX50687.1|1590442_1590697_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AUX50688.1|1590698_1591094_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AUX50689.1|1591415_1592369_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AUX50690.1|1592379_1593165_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AUX50691.1|1593695_1594808_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AUX50692.1|1594791_1596192_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AUX50693.1|1596191_1597499_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AUX50694.1|1597476_1598481_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AUX50695.1|1599029_1599215_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50696.1|1599343_1599589_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AUX50697.1|1600402_1600597_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AUX50698.1|1600547_1600823_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AUX50699.1|1600819_1601164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AUX50700.1|1601160_1601700_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AUX50701.1|1601696_1602008_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AUX54339.1|1602645_1603335_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AUX50702.1|1603471_1604110_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AUX50703.1|1604102_1604771_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AUX50704.1|1604767_1604935_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AUX50705.1|1604915_1605383_-	protein ninB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AUX50706.1|1605903_1606932_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50707.1|1607335_1608304_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
AUX50708.1|1608506_1608809_-	hypothetical protein	NA	NA	NA	NA	NA
AUX50709.1|1608805_1609654_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AUX50710.1|1610595_1610817_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AUX50711.1|1610857_1611085_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AUX50712.1|1611196_1611895_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AUX50713.1|1612182_1613259_+	nucleotide-binding protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AUX50714.1|1613340_1613544_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AUX50715.1|1613854_1613980_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50716.1|1613972_1614167_+	hypothetical protein	NA	NA	NA	NA	NA
AUX50717.1|1614255_1614540_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AUX50718.1|1614555_1615401_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AUX50719.1|1615686_1616367_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AUX50720.1|1616363_1616792_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AUX50721.1|1616788_1617451_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AUX50722.1|1617447_1617762_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AUX50723.1|1617658_1618876_-|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
AUX50724.1|1619022_1619913_+	antimicrobial peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1619022:1619037	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AUX50725.1|1619912_1620905_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AUX50726.1|1620906_1621716_+	peptide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	2002605	2095556	5309490	head,plate,tRNA,protease,portal,tail,capsid,integrase	Salmonella_phage(57.63%)	100	2058131:2058149	2095631:2095649
AUX51096.1|2002605_2003898_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AUX51097.1|2003988_2005332_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AUX51098.1|2005340_2005952_-	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUX51099.1|2006074_2010328_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AUX51100.1|2010463_2010958_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUX54361.1|2011241_2011373_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51101.1|2011490_2012459_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AUX51102.1|2012573_2014340_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AUX51103.1|2014340_2016062_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AUX51104.1|2016088_2016808_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUX51105.1|2017161_2017380_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUX51106.1|2017500_2019780_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AUX51107.1|2019810_2020128_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AUX51108.1|2020453_2020675_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AUX51109.1|2020629_2020812_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51110.1|2020751_2022692_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AUX51111.1|2022688_2023804_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AUX51112.1|2023950_2025609_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUX51113.1|2026028_2026724_+	aquaporin Z	NA	NA	NA	NA	NA
AUX51114.1|2026839_2027739_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54362.1|2027882_2029535_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AUX51115.1|2029545_2030514_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AUX51116.1|2030725_2031160_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUX54363.1|2031311_2033030_+	pyruvate oxidase	NA	NA	NA	NA	NA
AUX51117.1|2033068_2034070_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUX51118.1|2034080_2035523_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUX51119.1|2035610_2036624_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51120.1|2036620_2037451_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AUX51121.1|2037482_2038622_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUX51122.1|2038674_2038854_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51123.1|2039499_2040015_+	lipoprotein	NA	NA	NA	NA	NA
AUX51124.1|2040241_2040970_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AUX54364.1|2040990_2041722_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX51125.1|2041728_2042445_+	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
AUX51126.1|2042444_2043113_+	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
AUX51127.1|2043296_2044028_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUX51128.1|2044070_2045543_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AUX51129.1|2045539_2046256_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AUX51130.1|2046334_2047462_-	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AUX51131.1|2047503_2047992_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51132.1|2048049_2048895_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUX51133.1|2048891_2049845_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUX54365.1|2049855_2051022_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
AUX51134.1|2051152_2052265_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AUX51135.1|2052613_2053093_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51136.1|2053181_2054084_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AUX51137.1|2054905_2055193_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51138.1|2055395_2055659_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AUX51139.1|2055665_2056049_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54366.1|2056315_2058001_+	transporter	NA	NA	NA	NA	NA
AUX51140.1|2057992_2058115_-	hypothetical protein	NA	NA	NA	NA	NA
2058131:2058149	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AUX54369.1|2058220_2058436_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	68.6	2.2e-19
AUX51141.1|2058530_2059631_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AUX51142.1|2059627_2060113_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AUX54367.1|2060109_2062503_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
AUX54368.1|2062729_2062849_-|tail	phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AUX51143.1|2062863_2063163_-	hypothetical protein	NA	E5G6P9	Salmonella_phage	79.0	3.7e-33
AUX51144.1|2063215_2063731_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AUX51145.1|2063740_2064913_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AUX51146.1|2065051_2066128_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AUX54370.1|2066157_2066319_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51147.1|2066357_2067089_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51148.1|2067092_2070044_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AUX51149.1|2070045_2070645_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AUX51150.1|2070637_2071546_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AUX51151.1|2071532_2071895_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AUX51152.1|2071891_2072464_-|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AUX51153.1|2072578_2072743_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51154.1|2072741_2073251_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51155.1|2073247_2073694_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AUX51156.1|2073686_2074118_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AUX51157.1|2074080_2074227_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
AUX51158.1|2074213_2074642_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AUX51159.1|2074638_2075022_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AUX51160.1|2075026_2075536_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AUX51161.1|2075516_2075732_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AUX51162.1|2075735_2075939_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AUX51163.1|2075938_2076403_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AUX51164.1|2076498_2077149_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AUX51165.1|2077152_2078211_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AUX51166.1|2078227_2079061_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AUX51167.1|2079203_2080970_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AUX51168.1|2080969_2081995_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AUX51169.1|2082056_2083799_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54371.1|2084074_2084305_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51170.1|2084866_2085100_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUX51171.1|2085110_2085299_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AUX51172.1|2085452_2087867_-	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AUX51173.1|2087863_2088721_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AUX51174.1|2088717_2088945_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AUX51175.1|2088944_2089178_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AUX51176.1|2089245_2089587_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AUX51177.1|2089550_2089751_-	hypothetical protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AUX51178.1|2089758_2090268_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AUX51179.1|2090300_2090522_-	regulator	NA	NA	NA	NA	NA
AUX51180.1|2090667_2091546_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AUX51181.1|2091557_2092502_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51182.1|2092600_2094085_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUX51183.1|2094084_2094336_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51184.1|2094575_2095556_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
2095631:2095649	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	2767355	2779009	5309490	integrase	Enterobacteria_phage(70.0%)	15	2767207:2767220	2771420:2771433
2767207:2767220	attL	TCTGACATATTTTT	NA	NA	NA	NA
AUX51816.1|2767355_2768459_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AUX51817.1|2768469_2769723_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AUX51818.1|2770075_2771266_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AUX51819.1|2771253_2772204_+	chromosome partitioning protein	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
2771420:2771433	attR	AAAAATATGTCAGA	NA	NA	NA	NA
AUX51820.1|2772203_2772629_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54399.1|2772975_2773125_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51821.1|2773197_2773764_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AUX51822.1|2773781_2774027_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AUX51823.1|2774023_2774761_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	61.1	1.4e-73
AUX51824.1|2775060_2775198_-	hypothetical protein	NA	NA	NA	NA	NA
AUX51825.1|2775302_2775569_+	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AUX54400.1|2775571_2776123_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AUX51826.1|2776119_2776347_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51827.1|2776343_2776664_+	hypothetical protein	NA	NA	NA	NA	NA
AUX51828.1|2776675_2779009_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 8
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	3246173	3253855	5309490	transposase	Enterobacteria_phage(85.71%)	10	NA	NA
AUX52266.1|3246173_3246881_-|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	2.4e-06
AUX52267.1|3247018_3247285_-|transposase	transposase	transposase	NA	NA	NA	NA
AUX52268.1|3248030_3250364_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
AUX52269.1|3250378_3250699_-	hypothetical protein	NA	NA	NA	NA	NA
AUX52270.1|3250695_3250923_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54417.1|3250919_3251462_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AUX52271.1|3251464_3251731_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AUX52272.1|3252291_3253029_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AUX52273.1|3253025_3253271_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AUX52274.1|3253288_3253855_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 9
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	3446345	3451432	5309490	transposase	Escherichia_phage(33.33%)	8	NA	NA
AUX52460.1|3446345_3447029_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
AUX52461.1|3446985_3447099_-	hypothetical protein	NA	NA	NA	NA	NA
AUX52462.1|3447174_3448092_+	DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AUX52463.1|3448091_3448397_+	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
AUX52464.1|3448565_3449087_+	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AUX52465.1|3449143_3449929_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AUX52466.1|3450094_3450466_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AUX52467.1|3450475_3451432_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 10
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	4312599	4345857	5309490	head,capsid,terminase,tRNA,portal,tail,integrase	uncultured_Caudovirales_phage(75.0%)	36	4330207:4330224	4346202:4346219
AUX53283.1|4312599_4313547_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AUX53284.1|4313561_4314071_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AUX53285.1|4314199_4315324_+	DNA protecting protein DprA	NA	NA	NA	NA	NA
AUX53286.1|4315295_4315769_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53287.1|4315794_4316337_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53288.1|4316341_4316914_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AUX53289.1|4316917_4317736_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUX53290.1|4317732_4317990_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53291.1|4317965_4318616_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUX53292.1|4324315_4324537_-	hypothetical protein	NA	NA	NA	NA	NA
AUX53293.1|4324830_4327941_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUX53294.1|4327953_4329093_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUX53295.1|4329471_4330122_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4330207:4330224	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AUX53296.1|4330397_4331624_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AUX53297.1|4331716_4332658_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53298.1|4332839_4333124_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX53299.1|4333134_4333914_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AUX53300.1|4334037_4334232_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54462.1|4334455_4334635_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AUX53301.1|4334627_4334816_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53302.1|4334892_4335021_-	hypothetical protein	NA	NA	NA	NA	NA
AUX53303.1|4335119_4335488_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AUX53304.1|4335484_4335850_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53305.1|4335849_4337985_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AUX53306.1|4338327_4338663_+	hypothetical protein	NA	NA	NA	NA	NA
AUX53307.1|4338711_4339224_-	hypothetical protein	NA	NA	NA	NA	NA
AUX53308.1|4339487_4340654_+|capsid	capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AUX53309.1|4340705_4341266_+	peptidase	NA	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AUX53310.1|4341267_4342509_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AUX53311.1|4342505_4342841_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AUX53312.1|4342837_4343137_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AUX54463.1|4343307_4343580_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	88.9	1.0e-42
AUX53313.1|4343572_4343725_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
AUX53314.1|4343706_4343898_+|terminase	terminase	terminase	NA	NA	NA	NA
AUX53315.1|4343855_4344212_+|terminase	terminase	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AUX53316.1|4344195_4345857_+|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
4346202:4346219	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 11
CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	5103245	5149479	5309490	head,plate,tRNA,portal,coat,tail,capsid,integrase	Salmonella_phage(83.72%)	61	5101539:5101585	5138105:5138151
5101539:5101585	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AUX54066.1|5103245_5104271_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AUX54067.1|5104273_5104903_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AUX54068.1|5105025_5105268_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AUX54069.1|5105300_5105810_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AUX54070.1|5105817_5106018_+	protein fil	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AUX54071.1|5105981_5106320_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AUX54072.1|5106387_5106621_+	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AUX54073.1|5106620_5106848_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AUX54074.1|5106844_5107696_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AUX54075.1|5107692_5110077_+	endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AUX54076.1|5110239_5110428_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AUX54077.1|5110439_5110673_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AUX54078.1|5110768_5111452_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54079.1|5111438_5112518_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54080.1|5112517_5113519_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54488.1|5114039_5114309_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AUX54081.1|5114365_5115409_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AUX54082.1|5115408_5117172_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AUX54083.1|5117312_5118146_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AUX54084.1|5118162_5119215_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AUX54085.1|5119218_5119872_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AUX54086.1|5119967_5120432_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AUX54087.1|5120431_5120635_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AUX54489.1|5120638_5120854_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AUX54088.1|5120834_5121344_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AUX54089.1|5121348_5121732_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AUX54090.1|5121728_5122157_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AUX54490.1|5122131_5122290_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
AUX54091.1|5122252_5122675_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AUX54092.1|5122667_5123114_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AUX54093.1|5123136_5124003_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54094.1|5124097_5124670_+|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AUX54095.1|5124666_5125029_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AUX54096.1|5125015_5125924_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AUX54097.1|5125916_5126588_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AUX54098.1|5126589_5128539_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AUX54099.1|5128548_5129667_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	2.0e-55
AUX54100.1|5129718_5130792_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AUX54101.1|5130940_5132113_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AUX54102.1|5132122_5132638_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AUX54103.1|5132690_5132990_+	hypothetical protein	NA	E5G6P9	Salmonella_phage	78.0	8.2e-33
AUX54104.1|5133004_5133124_+|tail	phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AUX54491.1|5133350_5135747_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
AUX54105.1|5135743_5136229_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AUX54106.1|5136225_5137320_+	late control protein D	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AUX54107.1|5137386_5137605_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AUX54108.1|5137632_5138010_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54109.1|5138613_5139096_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
5138105:5138151	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AUX54110.1|5139206_5139683_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUX54111.1|5139672_5139963_+	RnfH family protein	NA	NA	NA	NA	NA
AUX54112.1|5140029_5140371_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUX54113.1|5140352_5140493_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54114.1|5140518_5142180_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUX54115.1|5142266_5143145_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUX54116.1|5143269_5143860_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUX54117.1|5143979_5145266_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUX54118.1|5145285_5146077_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54119.1|5146240_5147605_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUX54120.1|5147864_5148113_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUX54121.1|5148131_5148680_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUX54122.1|5148711_5149479_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 1
CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	14105	39229	121863	transposase,protease	Escherichia_phage(38.46%)	34	NA	NA
AUX54505.1|14105_14741_+|protease	protease	protease	NA	NA	NA	NA
AUX54506.1|14848_15193_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54507.1|15386_15671_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54508.1|15759_16008_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54509.1|16004_16577_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54510.1|16607_17102_+	DNA-binding protein	NA	NA	NA	NA	NA
AUX54511.1|17145_17514_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54619.1|17538_17751_+	transcriptional regulator	NA	NA	NA	NA	NA
AUX54512.1|17764_17995_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54513.1|18038_18233_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54514.1|18423_19956_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AUX54515.1|20268_20592_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54516.1|20664_21660_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
AUX54517.1|21956_22607_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
AUX54518.1|22653_23049_-|transposase	transposase	transposase	A0A219Y912	Aeromonas_phage	51.6	4.9e-25
AUX54519.1|23107_23812_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX54520.1|23931_24591_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AUX54521.1|24644_24836_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54522.1|24869_25145_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUX54523.1|25063_25567_+|transposase	transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AUX54524.1|25806_25932_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54525.1|26073_27444_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUX54526.1|27442_27592_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54527.1|27558_28695_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54528.1|28745_28973_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54529.1|29669_30212_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUX54530.1|30224_31085_-	AAC(3) family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
AUX54531.1|31266_32127_-	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUX54532.1|32309_32867_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AUX54533.1|33430_34693_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUX54534.1|34673_34796_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54535.1|34948_35824_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AUX54536.1|35870_36203_-	tryptophan synthase subunit beta like protein	NA	NA	NA	NA	NA
AUX54537.1|38524_39229_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	51158	103914	121863	integrase,transposase	Escherichia_phage(25.0%)	52	57812:57829	93431:93448
AUX54552.1|51158_52127_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
AUX54553.1|52177_52564_+	restriction endonuclease	NA	NA	NA	NA	NA
AUX54554.1|52568_52775_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54555.1|52785_53052_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.2	1.2e-40
AUX54622.1|53186_54590_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	6.9e-106
AUX54556.1|55172_55877_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX54557.1|56189_56369_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54558.1|56645_57965_+|transposase	DDE transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
57812:57829	attL	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
AUX54559.1|58214_59096_-	KPC family carbapenem-hydrolyzing class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUX54560.1|59482_60262_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUX54561.1|60258_61284_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUX54562.1|61390_64420_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AUX54563.1|64529_66245_+|integrase	integrase	integrase	NA	NA	NA	NA
AUX54564.1|66245_66734_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	36.2	1.2e-20
AUX54565.1|66906_67221_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54566.1|67475_67832_-	cupin	NA	NA	NA	NA	NA
AUX54567.1|67821_68223_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54568.1|68219_68510_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUX54569.1|68573_68972_-	FipA	NA	NA	NA	NA	NA
AUX54570.1|69566_69671_-	replication initiator protein	NA	NA	NA	NA	NA
AUX54571.1|69661_70366_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUX54572.1|71155_74173_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AUX54573.1|74215_75199_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AUX54574.1|75293_75938_+	fluoroquinolone resistance protein	NA	NA	NA	NA	NA
AUX54575.1|76117_79135_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AUX54576.1|79786_80695_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX54577.1|80691_81909_+|transposase	transposase	transposase	NA	NA	NA	NA
AUX54578.1|81970_82594_+	resolvase	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
AUX54579.1|82842_83175_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUX54580.1|83358_83832_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	30.7	8.7e-13
AUX54624.1|83734_84061_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54581.1|83990_85004_+|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUX54623.1|84962_85142_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX54582.1|85328_85748_-	adenine-specific methyltransferase	NA	NA	NA	NA	NA
AUX54583.1|85757_85979_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54584.1|85978_86680_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AUX54585.1|86881_86998_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54586.1|87116_87347_-	hypothetical protein	NA	NA	NA	NA	NA
AUX54587.1|87407_88079_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUX54588.1|88081_89053_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUX54589.1|89284_89716_+	protein impA	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AUX54590.1|89715_90987_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AUX54591.1|91387_92284_+	protein RepA	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AUX54592.1|92605_93811_+	chromosome partitioning protein ParA	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
93431:93448	attR	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
AUX54593.1|93807_94782_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AUX54594.1|94953_95139_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54595.1|95158_95491_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54596.1|95715_95931_+	hypothetical protein	NA	NA	NA	NA	NA
AUX54597.1|96042_98070_+	restriction endonuclease subunit M	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AUX54598.1|98066_99383_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUX54599.1|99383_102641_+	restriction endonuclease	NA	NA	NA	NA	NA
AUX54600.1|102645_103914_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
