The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014025	Pseudomonas fulva strain FDAARGOS_167 chromosome, complete genome	4865091	604144	715537	4865091	terminase,holin,capsid,portal,protease,transposase,integrase,head,tail	Pseudomonas_phage(43.75%)	106	631125:631159	674789:674823
AVF54152.1|604144_604978_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF54153.1|605008_606172_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVF54154.1|606186_607536_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AVF54155.1|607556_608756_+	CoA transferase	NA	NA	NA	NA	NA
AVF54156.1|608771_609599_+	CoA ester lyase	NA	NA	NA	NA	NA
AVF54157.1|609756_610755_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVF54158.1|610818_611454_+	TRAP transporter small permease	NA	NA	NA	NA	NA
AVF54159.1|611450_612734_+	TRAP transporter large permease	NA	NA	NA	NA	NA
AVF54160.1|612883_614476_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AVF54161.1|614952_615645_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54162.1|616529_616793_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54163.1|616881_617124_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54164.1|618767_621404_+	hypothetical protein	NA	NA	NA	NA	NA
AVF57687.1|621414_624024_+	adenosine deaminase	NA	NA	NA	NA	NA
AVF54165.1|625528_626731_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.0	3.7e-76
AVF54166.1|626733_627819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54167.1|628593_629070_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.6	4.8e-35
AVF54168.1|629185_630622_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	49.1	2.1e-105
631125:631159	attL	AATTTGGTGGAGCCGGGGGGATTTGAACCCCCGTC	NA	NA	NA	NA
AVF54169.1|631211_631763_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54170.1|631832_633014_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	80.5	9.7e-178
AVF54171.1|633173_633947_-	hypothetical protein	NA	NA	NA	NA	NA
AVF57688.1|634060_634378_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54172.1|634506_634896_-	carbon storage regulator	NA	NA	NA	NA	NA
AVF54173.1|634981_635461_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54174.1|635460_636027_-	hypothetical protein	NA	A0A0A0RNU5	Citrobacter_phage	46.8	3.0e-44
AVF54175.1|636769_637168_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	59.5	2.0e-26
AVF54176.1|637303_638044_-	Cro/Cl family transcriptional regulator	NA	A0A0H5BBV1	Pseudomonas_phage	48.6	2.9e-47
AVF54177.1|638601_638919_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54178.1|638915_639233_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54179.1|639972_640578_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54180.1|640574_640805_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54181.1|640801_641596_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	60.4	1.2e-43
AVF54182.1|641582_642401_+	DNA replication protein DnaC	NA	A0A2H4J2L2	uncultured_Caudovirales_phage	44.8	2.1e-54
AVF54183.1|642397_643810_+	helicase DnaB	NA	A0A0A0YUG7	Pseudomonas_phage	74.9	8.0e-187
AVF54184.1|643796_644303_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54185.1|644299_644863_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54186.1|644859_645147_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	43.7	1.5e-12
AVF54187.1|645143_645533_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	57.8	1.6e-36
AVF54188.1|645638_646100_-	transcriptional regulator	NA	Q7Y3V7	Yersinia_phage	36.9	4.8e-16
AVF54189.1|646145_646328_-	mRNA interferase	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	64.4	8.8e-14
AVF54190.1|646436_647369_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54191.1|647416_647791_+	hypothetical protein	NA	A0A2H4J7X6	uncultured_Caudovirales_phage	79.8	7.5e-52
AVF54192.1|647791_648073_+|holin	phage holin family protein	holin	A0A2H4J0H1	uncultured_Caudovirales_phage	93.5	3.7e-43
AVF54193.1|648122_648335_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54194.1|648395_648752_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54195.1|648742_649111_+	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	60.9	9.8e-20
AVF54196.1|649247_649730_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	73.4	2.6e-60
AVF54197.1|649726_651451_+|terminase	terminase	terminase	A0A2D1GNU5	Pseudomonas_phage	84.1	3.0e-289
AVF54198.1|651450_652851_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	83.7	1.3e-224
AVF54199.1|652865_653741_+	peptidase	NA	A0A0U4B0J0	Pseudomonas_phage	70.3	1.3e-107
AVF54200.1|653756_654971_+|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	80.8	4.5e-178
AVF54201.1|655407_655884_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	40.3	3.7e-19
AVF54202.1|655883_656225_+|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	50.4	6.9e-20
AVF54203.1|656217_656703_+	hypothetical protein	NA	Q9MCA7	Pseudomonas_phage	73.8	3.0e-53
AVF54204.1|656699_657068_+	hypothetical protein	NA	Q9MCA6	Pseudomonas_phage	61.5	3.2e-39
AVF54205.1|657119_657611_+|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	64.5	1.6e-49
AVF54206.1|657619_658087_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	58.5	2.8e-35
AVF54207.1|658110_658308_+	hypothetical protein	NA	A0A0U4J8S9	Pseudomonas_phage	45.3	6.0e-08
AVF57689.1|658441_658690_+	peptidase	NA	NA	NA	NA	NA
AVF54208.1|658730_661262_+|tail	phage tail tape measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	48.5	3.1e-157
AVF54209.1|661261_661609_+|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	50.9	7.0e-28
AVF54210.1|661643_662345_+|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	75.2	3.3e-101
AVF54211.1|662348_663131_+	hydrolase Nlp/P60	NA	A0A2D1GNP8	Pseudomonas_phage	77.7	1.4e-127
AVF54212.1|663127_663712_+|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	68.9	2.0e-67
AVF54213.1|663766_671359_+	host specificity protein	NA	A0A2D1GNE3	Pseudomonas_phage	60.5	0.0e+00
AVF54214.1|671355_671742_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54215.1|671947_672175_+	hypothetical protein	NA	NA	NA	NA	NA
AVF54216.1|672235_672682_+	structural protein P5	NA	A0A2R3UAM8	Myoviridae_environmental_samples	54.1	1.2e-35
AVF54217.1|672678_673173_+	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	66.3	2.5e-34
AVF54218.1|673184_673409_+	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	66.2	3.8e-19
AVF54219.1|673518_674028_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54220.1|674036_674561_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54221.1|675282_675576_-	hypothetical protein	NA	NA	NA	NA	NA
674789:674823	attR	AATTTGGTGGAGCCGGGGGGATTTGAACCCCCGTC	NA	NA	NA	NA
AVF54222.1|675799_676168_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVF54223.1|676225_676921_-	glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	25.4	1.8e-06
AVF54224.1|676957_678019_-	hypothetical protein	NA	NA	NA	NA	NA
AVF54225.1|678015_678978_-	aminobenzoate oxygenase	NA	NA	NA	NA	NA
AVF54226.1|679101_680316_-	MFS transporter	NA	NA	NA	NA	NA
AVF54227.1|680573_681872_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	47.4	5.6e-86
AVF54228.1|681881_683378_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AVF54229.1|683509_684592_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	39.8	7.0e-66
AVF54230.1|684711_685959_+	benzoate transporter	NA	NA	NA	NA	NA
AVF54231.1|685958_686801_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVF54232.1|686824_688006_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVF54233.1|688029_689295_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	49.5	3.5e-93
AVF54234.1|689661_690609_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	37.4	9.3e-30
AVF54235.1|690860_693665_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
AVF54236.1|693739_694885_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AVF54237.1|694948_696619_-	L-lactate permease	NA	NA	NA	NA	NA
AVF54238.1|696873_697641_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AVF54239.1|697784_698267_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.0	1.1e-26
AVF54240.1|698430_698871_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVF54241.1|698994_699522_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVF54242.1|699619_700024_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AVF54243.1|700126_701800_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVF54244.1|701993_702551_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVF54245.1|702652_704578_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	49.6	1.3e-150
AVF54246.1|704769_705894_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.9	4.5e-23
AVF54247.1|705907_706711_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AVF54248.1|707010_708147_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.5	1.6e-44
AVF54249.1|708251_711473_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AVF57690.1|711475_711952_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVF54250.1|711929_712379_+	MFS transporter	NA	NA	NA	NA	NA
AVF54251.1|712391_712700_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AVF54252.1|712802_713429_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
AVF54253.1|713632_715537_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	48.0	2.1e-113
>prophage 2
CP014025	Pseudomonas fulva strain FDAARGOS_167 chromosome, complete genome	4865091	2084328	2147927	4865091	terminase,tRNA,capsid,portal,protease,integrase,head,tail	Pseudomonas_phage(50.0%)	77	2109511:2109526	2128589:2128604
AVF55377.1|2084328_2085711_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.3	3.7e-43
AVF55378.1|2086827_2088219_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVF55379.1|2088196_2088877_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVF55380.1|2089069_2089963_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AVF55381.1|2090133_2091108_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AVF55382.1|2091270_2092773_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	5.4e-56
AVF55383.1|2092773_2093475_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AVF55384.1|2093490_2094114_-	riboflavin synthase	NA	NA	NA	NA	NA
AVF55385.1|2094190_2096257_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AVF55386.1|2096367_2097216_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55387.1|2097206_2098427_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
AVF55388.1|2098644_2099889_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AVF55389.1|2099922_2101020_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AVF55390.1|2101213_2101423_+	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
AVF55391.1|2101561_2102482_-	serine dehydratase	NA	NA	NA	NA	NA
AVF55392.1|2102478_2103153_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55393.1|2103234_2104938_-	amidase	NA	NA	NA	NA	NA
AVF55394.1|2105190_2106030_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
AVF55395.1|2106219_2107263_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AVF55396.1|2107244_2108831_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	2.9e-60
AVF55397.1|2108866_2110045_-|integrase	site-specific integrase	integrase	J7HXC4	Pseudomonas_phage	57.8	1.3e-121
2109511:2109526	attL	AGCGCTTCGGCAGGTC	NA	NA	NA	NA
AVF55398.1|2110257_2110581_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55399.1|2110637_2110871_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55400.1|2110846_2111272_-	DUF2591 domain-containing protein	NA	A0A2H4J8F6	uncultured_Caudovirales_phage	46.3	9.2e-22
AVF55401.1|2111268_2111577_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55402.1|2111573_2111795_-	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	52.9	2.2e-11
AVF57770.1|2111791_2112121_-	hypothetical protein	NA	A0A059VA44	Pseudomonas_phage	57.3	2.7e-29
AVF55403.1|2112316_2112541_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55404.1|2112537_2112969_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55405.1|2113245_2113524_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55406.1|2113634_2114054_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55407.1|2114465_2115089_-	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	54.0	2.0e-57
AVF55408.1|2115203_2115932_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55409.1|2116054_2116870_-	hypothetical protein	NA	A0A2R2Z323	Escherichia_phage	41.8	3.2e-47
AVF55410.1|2116897_2117245_-	hypothetical protein	NA	I3PUY8	Vibrio_phage	50.0	3.6e-24
AVF55411.1|2117333_2117792_-	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	60.5	3.4e-46
AVF55412.1|2117788_2118049_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55413.1|2118065_2118449_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	57.8	6.2e-25
AVF55414.1|2118784_2119090_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55415.1|2119153_2119333_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	57.7	2.2e-09
AVF55416.1|2120038_2120365_+	hypothetical protein	NA	A0A2D1GND3	Pseudomonas_phage	60.2	1.1e-27
AVF55417.1|2120409_2121540_-	hypothetical protein	NA	NA	NA	NA	NA
AVF57771.1|2122168_2123011_-	phage repressor protein	NA	A0A2D1GNH0	Pseudomonas_phage	62.1	8.1e-70
AVF57772.1|2123589_2124276_+	DNA-binding protein	NA	A0A1B0YZY9	Pseudomonas_phage	50.7	2.4e-48
AVF55418.1|2124277_2125249_+	phage replication protein	NA	A0A1B0VME0	Pseudomonas_phage	67.7	2.1e-109
AVF55419.1|2125235_2126015_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	56.7	6.2e-64
AVF55420.1|2126142_2126439_+	DUF1364 domain-containing protein	NA	Q8HAF2	Salmonella_phage	66.0	8.9e-32
AVF55421.1|2126435_2126864_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	71.1	2.8e-50
AVF55422.1|2126860_2128159_+|integrase	integrase	integrase	A0A2D1GND4	Pseudomonas_phage	54.7	4.5e-128
AVF55423.1|2128155_2128386_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55424.1|2128382_2128700_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	61.0	1.2e-29
2128589:2128604	attR	AGCGCTTCGGCAGGTC	NA	NA	NA	NA
AVF55425.1|2128711_2129053_+	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	82.6	2.7e-48
AVF55426.1|2129184_2129649_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55427.1|2129729_2130101_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	70.7	6.6e-40
AVF55428.1|2130100_2130430_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	60.3	6.9e-17
AVF55429.1|2130584_2130923_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	57.1	3.3e-22
AVF55430.1|2131079_2131625_+|terminase	terminase	terminase	S4TNN3	Salmonella_phage	34.8	1.7e-15
AVF55431.1|2131624_2133310_+|terminase	terminase	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	81.8	3.3e-248
AVF55432.1|2133460_2134762_+|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	72.1	1.0e-183
AVF55433.1|2134765_2135623_+|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	57.9	6.3e-86
AVF55434.1|2135625_2136813_+|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	64.7	1.3e-134
AVF55435.1|2136862_2137375_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55436.1|2137378_2137720_+	hypothetical protein	NA	Q3HQT2	Burkholderia_phage	43.0	2.1e-16
AVF55437.1|2137716_2138043_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JC00	uncultured_Caudovirales_phage	46.4	6.2e-18
AVF55438.1|2138228_2138729_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	69.7	9.7e-63
AVF55439.1|2138721_2139108_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	84.4	2.6e-55
AVF55440.1|2139162_2139663_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	73.2	5.5e-66
AVF55441.1|2139703_2140048_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55442.1|2140044_2140287_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55443.1|2140326_2143638_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	37.1	3.0e-91
AVF55444.1|2143637_2143976_+|tail	phage tail protein	tail	A0A1S5R1J0	Pseudomonas_phage	36.6	7.4e-14
AVF55445.1|2143972_2144722_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.9	1.1e-121
AVF55446.1|2144724_2145480_+	hydrolase Nlp/P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	76.8	5.0e-119
AVF55447.1|2145669_2146191_-	hypothetical protein	NA	NA	NA	NA	NA
AVF55448.1|2146380_2146794_+	hypothetical protein	NA	NA	NA	NA	NA
AVF55449.1|2146891_2147311_+	hypothetical protein	NA	A0A1B0VMK5	Pseudomonas_phage	48.9	3.8e-28
AVF55450.1|2147351_2147927_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	72.8	9.5e-70
>prophage 3
CP014025	Pseudomonas fulva strain FDAARGOS_167 chromosome, complete genome	4865091	2810327	2815054	4865091		uncultured_Caudovirales_phage(85.71%)	7	NA	NA
AVF55968.1|2810327_2810999_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	88.8	3.8e-102
AVF55969.1|2811227_2812607_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	51.8	1.9e-28
AVF55970.1|2812675_2813068_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.8	1.3e-51
AVF55971.1|2813068_2813428_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	3.6e-35
AVF55972.1|2813427_2813724_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	60.6	2.5e-26
AVF55973.1|2813720_2814056_+	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	74.8	4.4e-43
AVF55974.1|2814052_2815054_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	82.3	5.5e-158
