The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014018	Pandoraea apista strain FDAARGOS_126 chromosome, complete genome	5326503	4170596	4288287	5326503	plate,integrase,tail,tRNA,coat,transposase,terminase,holin	Burkholderia_virus(20.0%)	135	4252783:4252818	4292017:4292052
AVF41459.1|4170596_4173458_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.8	4.9e-143
AVF41460.1|4173487_4174372_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.7	1.6e-71
AVF42777.1|4174449_4174677_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
AVF41461.1|4174786_4175317_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AVF42778.1|4175554_4176850_+	chloride channel protein	NA	NA	NA	NA	NA
AVF41462.1|4176880_4177996_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVF41463.1|4178086_4178281_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AVF41464.1|4178404_4179175_-	class II aldolase	NA	NA	NA	NA	NA
AVF41465.1|4179276_4180542_-	MFS transporter	NA	NA	NA	NA	NA
AVF41466.1|4180897_4183522_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	6.4e-81
AVF41467.1|4183774_4184998_+	CoA transferase	NA	NA	NA	NA	NA
AVF41468.1|4185112_4185976_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AVF41469.1|4185972_4187388_-	3-ketosteroid dehydrogenase	NA	NA	NA	NA	NA
AVF41470.1|4187384_4188002_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVF41471.1|4188024_4190097_-	hydantoin utilization protein A	NA	NA	NA	NA	NA
AVF41472.1|4190093_4191788_-	hydantoin utilization protein B	NA	NA	NA	NA	NA
AVF41473.1|4191781_4192330_-	3-isopropylmalate dehydratase	NA	NA	NA	NA	NA
AVF41474.1|4192353_4193622_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AVF41475.1|4193626_4194337_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.6	2.4e-14
AVF42779.1|4194333_4195092_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	5.0e-10
AVF41476.1|4195084_4196101_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF41477.1|4196117_4196990_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF41478.1|4196994_4198206_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF41479.1|4198226_4199024_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVF41480.1|4199203_4200388_-	porin	NA	NA	NA	NA	NA
AVF42780.1|4200936_4201830_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.7	1.3e-22
AVF41481.1|4201995_4202523_+	sugar ABC transporter	NA	NA	NA	NA	NA
AVF41482.1|4202572_4203424_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVF41483.1|4203599_4204190_-	deaminase	NA	NA	NA	NA	NA
AVF41484.1|4204427_4204844_+	transcriptional regulator	NA	NA	NA	NA	NA
AVF41485.1|4205294_4205924_-	hypothetical protein	NA	C7BGE4	Burkholderia_phage	46.3	7.0e-50
AVF41486.1|4205972_4206569_-	hypothetical protein	NA	NA	NA	NA	NA
AVF42781.1|4206741_4206999_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41487.1|4207011_4207767_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41488.1|4207866_4208229_-	hypothetical protein	NA	A0A0E3Y4V5	Fusobacterium_phage	40.2	9.0e-10
AVF41489.1|4208225_4208651_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41490.1|4208661_4208976_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41491.1|4208972_4209167_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41492.1|4209163_4209679_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41493.1|4209734_4210028_-|holin	holin	holin	C7BGD7	Burkholderia_phage	50.0	1.2e-17
AVF41494.1|4210043_4210577_-	hypothetical protein	NA	Q6J1Q5	Burkholderia_virus	57.6	9.8e-45
AVF41495.1|4210862_4212314_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	39.9	5.7e-39
AVF42782.1|4212380_4212974_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41496.1|4213051_4214176_-|plate	baseplate protein	plate	B3GAJ9	uncultured_virus	44.2	1.6e-60
AVF41497.1|4214172_4214574_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVF41498.1|4214573_4215227_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AVF41499.1|4215223_4216354_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41500.1|4216346_4217306_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41501.1|4217302_4219234_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	23.8	2.4e-24
AVF41502.1|4219232_4219457_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41503.1|4219444_4219933_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41504.1|4220105_4220477_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41505.1|4220478_4220910_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41506.1|4221049_4222591_-|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	48.6	7.6e-106
AVF41507.1|4222826_4223657_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41508.1|4223656_4224328_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41509.1|4224337_4224739_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41510.1|4224739_4225039_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41511.1|4225108_4226398_-|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	53.2	2.8e-98
AVF41512.1|4226462_4227236_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	1.1e-52
AVF41513.1|4227375_4228764_-	DNA-binding protein	NA	A0A0S2SYJ5	Pseudomonas_phage	45.5	8.1e-99
AVF42783.1|4228777_4230064_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	65.3	2.7e-157
AVF41514.1|4230050_4230626_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	50.6	4.6e-32
AVF41515.1|4230682_4232059_-	chromosome partitioning protein ParB	NA	R4THK0	Halovirus	41.2	3.9e-85
AVF41516.1|4232141_4232867_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41517.1|4233088_4233280_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	53.3	5.6e-11
AVF41518.1|4233276_4233672_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AVF41519.1|4234203_4234830_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41520.1|4234862_4235336_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	57.6	4.0e-42
AVF41521.1|4235332_4235536_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41522.1|4235539_4236310_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41523.1|4237273_4237705_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41524.1|4237761_4238031_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41525.1|4238032_4238254_-	hypothetical protein	NA	NA	NA	NA	NA
AVF42784.1|4238520_4238727_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AVF42785.1|4238872_4239514_+	peptidase S24	NA	B5WZX5	Pseudomonas_phage	31.5	2.0e-12
AVF42786.1|4239872_4240499_+	peptidase S24	NA	A0A0M3LSL8	Mannheimia_phage	41.6	1.7e-27
AVF41526.1|4240555_4241284_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41527.1|4241388_4241808_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41528.1|4241792_4242767_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41529.1|4243277_4243925_+	hypothetical protein	NA	A0A0U4JX72	Pseudomonas_phage	50.2	6.7e-56
AVF41530.1|4244900_4245179_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41531.1|4245171_4245444_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41532.1|4245850_4246660_+	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	57.7	3.5e-86
AVF41533.1|4246669_4247809_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	55.8	1.6e-68
AVF41534.1|4247927_4249667_+	DNA repair protein	NA	H2BD46	Pseudomonas_phage	39.0	3.8e-90
AVF41535.1|4249757_4250258_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41536.1|4250488_4251571_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41537.1|4251648_4251861_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41538.1|4251857_4252484_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	44.1	4.7e-38
AVF41539.1|4252486_4252762_-	hypothetical protein	NA	NA	NA	NA	NA
4252783:4252818	attL	ATGAGACAGAACGAGATCATTCTGGGCGACTGCCGG	NA	NA	NA	NA
AVF42787.1|4253082_4253760_-	hypothetical protein	NA	NA	NA	NA	NA
AVF42788.1|4253601_4254528_+	hypothetical protein	NA	Q8W6P4	Burkholderia_virus	55.2	1.3e-65
AVF41540.1|4254887_4256057_+|integrase	integrase	integrase	A0A1B0Z061	Pseudomonas_phage	32.8	6.7e-46
AVF42789.1|4256539_4257088_+	curli assembly protein CsgG	NA	NA	NA	NA	NA
AVF41541.1|4258150_4258504_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41542.1|4258564_4259038_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVF41543.1|4259197_4259410_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVF41544.1|4259890_4261066_-	porin	NA	NA	NA	NA	NA
AVF41545.1|4261542_4262259_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41546.1|4262446_4262701_-	hypothetical protein	NA	NA	NA	NA	NA
AVF42790.1|4262995_4264154_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.7	3.5e-79
AVF42791.1|4264395_4264812_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41547.1|4266595_4266853_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41548.1|4266865_4267480_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41549.1|4268172_4268661_-	hypothetical protein	NA	Q6J1Q4	Burkholderia_virus	44.1	2.3e-24
AVF41550.1|4268657_4269077_-	lysozyme	NA	A0A1Q1PW74	Pseudoalteromonas_phage	46.6	9.7e-24
AVF42792.1|4269069_4269342_-|holin	holin	holin	Q6J1Q6	Burkholderia_virus	56.7	8.5e-21
AVF41551.1|4269341_4269683_-|holin	holin	holin	Q6J1Q7	Burkholderia_virus	67.3	3.9e-31
AVF41552.1|4269752_4270112_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41553.1|4270510_4270813_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41554.1|4270812_4273974_-	host specificity protein J	NA	Q8W6T0	Burkholderia_virus	55.6	0.0e+00
AVF41555.1|4274032_4274617_-|tail	phage tail protein	tail	Q6JIL3	Burkholderia_virus	58.8	1.8e-55
AVF41556.1|4274619_4275333_-	peptidase P60	NA	A0A1B1IV85	uncultured_Mediterranean_phage	52.4	2.5e-72
AVF41557.1|4275332_4276037_-|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	62.3	7.0e-83
AVF42793.1|4277261_4277600_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	53.6	1.8e-28
AVF41558.1|4277599_4279708_-	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	29.7	9.6e-19
AVF41559.1|4279704_4279938_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41560.1|4280018_4280348_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41561.1|4280349_4280832_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41562.1|4280895_4281258_-	hypothetical protein	NA	A0A2H4J359	uncultured_Caudovirales_phage	32.5	3.9e-05
AVF41563.1|4281267_4281663_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41564.1|4281745_4282030_-	hypothetical protein	NA	Q6UAS2	Klebsiella_phage	44.4	1.9e-07
AVF41565.1|4282655_4283264_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41566.1|4283277_4283661_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41567.1|4283653_4283956_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	57.6	5.8e-10
AVF42794.1|4283837_4284284_-	hypothetical protein	NA	A0A1X9HVJ6	Ruegeria_phage	35.1	5.7e-06
AVF41568.1|4284578_4285235_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	63.0	2.7e-73
AVF41569.1|4285231_4286038_-	helix-turn-helix domain-containing protein	NA	Q3HQZ6	Burkholderia_phage	68.3	4.0e-98
AVF41570.1|4286034_4286298_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41571.1|4286308_4286530_-	hypothetical protein	NA	NA	NA	NA	NA
AVF41572.1|4286526_4286967_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	76.0	7.5e-59
AVF41573.1|4287020_4287596_+	hypothetical protein	NA	NA	NA	NA	NA
AVF41574.1|4287613_4287829_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF41575.1|4287900_4288287_+	XRE family transcriptional regulator	NA	E5AGE6	Erwinia_phage	48.6	4.0e-08
4292017:4292052	attR	ATGAGACAGAACGAGATCATTCTGGGCGACTGCCGG	NA	NA	NA	NA
