The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026847	Weissella koreensis strain WiKim0080 chromosome, complete genome	1495237	217491	274488	1495237	terminase,portal,capsid,tail,integrase,protease	Oenococcus_phage(20.93%)	71	224197:224256	268618:268692
AVH74692.1|217491_218235_-|portal	portal protein	portal	V9QKI8	Oenococcus_phage	46.4	4.2e-54
AVH74693.1|218512_218875_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74694.1|219590_219929_+	XRE family transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	40.7	1.4e-12
AVH74695.1|220040_220382_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AVH75815.1|220436_220625_+	hypothetical protein	NA	NA	NA	NA	NA
AVH75816.1|220789_221206_+	hypothetical protein	NA	A0A173G9H4	Propionibacterium_phage	72.0	7.2e-11
AVH74696.1|221280_221619_+	hypothetical protein	NA	NA	NA	NA	NA
AVH74697.1|221996_222932_+	hypothetical protein	NA	NA	NA	NA	NA
AVH74698.1|223218_223398_+	hypothetical protein	NA	NA	NA	NA	NA
AVH74699.1|223394_224075_+|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	41.0	1.9e-32
224197:224256	attL	AAAACAAACCCCGTCATATCAACGATTATCGCGATACAACGGGATTTGTTTTTTTATATT	NA	NA	NA	NA
AVH74700.1|224621_225278_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74701.1|225369_225675_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
AVH74702.1|225661_227371_-	ATP-dependent exonuclease	NA	NA	NA	NA	NA
AVH74703.1|227536_228103_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74704.1|228282_229305_-	endolysin	NA	Q8LTJ6	Lactococcus_phage	51.5	1.1e-55
AVH74705.1|229308_229719_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74706.1|229733_229991_-	hypothetical protein	NA	Q9AZX0	Lactococcus_phage	52.7	2.8e-05
AVH74707.1|229992_230427_-	hypothetical protein	NA	A0A1I9KKA6	Lactobacillus_phage	29.3	1.6e-05
AVH75817.1|230423_233711_-	hypothetical protein	NA	A0A1B0Y2S0	Lactobacillus_phage	37.6	2.3e-99
AVH74708.1|235642_236002_-	hypothetical protein	NA	A0A1S5SBJ8	Streptococcus_phage	56.3	2.0e-30
AVH74709.1|236017_240871_-|tail	phage tail protein	tail	A0A059NT57	Lactococcus_phage	48.8	8.3e-191
AVH74710.1|240882_241191_-	hypothetical protein	NA	D7RWJ9	Brochothrix_phage	45.0	5.1e-14
AVH74711.1|241283_241688_-	hypothetical protein	NA	A0A182BQ86	Lactococcus_phage	58.5	7.7e-34
AVH74712.1|241710_241977_-	hypothetical protein	NA	A0A1D6Z291	Staphylococcus_phage	54.7	4.9e-13
AVH74713.1|241958_242435_-|tail	phage tail protein	tail	V9QKJ6	Oenococcus_phage	58.9	6.9e-42
AVH74714.1|242446_242812_-	hypothetical protein	NA	Q6SE74	Lactobacillus_prophage	45.5	1.1e-23
AVH74715.1|242813_243359_-	hypothetical protein	NA	V5USK0	Oenococcus_phage	59.9	2.9e-52
AVH74716.1|243351_243696_-	hypothetical protein	NA	D7RWJ2	Brochothrix_phage	53.2	1.8e-23
AVH74717.1|243692_244013_-	hypothetical protein	NA	A0A059NT99	Lactococcus_phage	45.7	1.8e-17
AVH74718.1|244027_245089_-|capsid	major capsid protein E	capsid	V9QKJ3	Oenococcus_phage	62.4	8.3e-120
AVH74719.1|245111_245474_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	58.9	7.1e-31
AVH75818.1|245486_246092_-|capsid	phage capsid protein	capsid	Q6SE80	Lactobacillus_prophage	34.3	5.4e-15
AVH74720.1|246206_247397_-	hypothetical protein	NA	V5UTD3	Oenococcus_phage	47.4	1.3e-89
AVH74721.1|247400_247715_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	44.2	1.3e-09
AVH74722.1|247662_249105_-|portal	phage portal protein	portal	V9QKI8	Oenococcus_phage	55.3	3.6e-150
AVH74723.1|249115_250411_-|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	66.0	1.4e-169
AVH74724.1|250388_251192_-|terminase	terminase	terminase	V9QKX0	Oenococcus_phage	42.6	5.8e-49
AVH74725.1|251503_251758_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74726.1|252188_252578_-	transcriptional regulator	NA	E3W8E2	Leuconostoc_phage	31.2	4.7e-12
AVH74727.1|252593_252872_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74728.1|252872_253148_-	hypothetical protein	NA	A0A2H4J550	uncultured_Caudovirales_phage	39.1	8.9e-10
AVH74729.1|253150_253342_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74730.1|253344_253785_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74731.1|253777_254065_-	DUF2829 domain-containing protein	NA	A0MZD8	Enterobacteria_phage	45.5	2.5e-10
AVH74732.1|254453_254642_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74733.1|254765_255026_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74734.1|255015_255468_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74735.1|255436_255748_-	hypothetical protein	NA	D7RWH1	Brochothrix_phage	44.9	6.3e-12
AVH74736.1|255900_256107_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74737.1|256093_257002_-	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	34.2	7.8e-18
AVH74738.1|257015_257477_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.5	2.6e-38
AVH74739.1|257469_258165_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74740.1|258178_258997_-	recombinase RecT	NA	E3W8C7	Leuconostoc_phage	63.6	2.9e-80
AVH74741.1|259034_259280_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74742.1|259285_259507_-	hypothetical protein	NA	NA	NA	NA	NA
AVH74743.1|259633_260368_-	hypothetical protein	NA	B8R674	Lactobacillus_phage	39.3	2.3e-36
AVH74744.1|260380_260608_-	transcriptional regulator	NA	NA	NA	NA	NA
AVH74745.1|260863_261217_+	transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	39.6	3.8e-13
AVH74746.1|261220_261634_+	hypothetical protein	NA	NA	NA	NA	NA
AVH74747.1|261681_262308_+	hypothetical protein	NA	NA	NA	NA	NA
AVH75819.1|262854_263313_+	hypothetical protein	NA	A0A0A1ERB0	Lactobacillus_phage	66.0	7.2e-12
AVH74748.1|264365_264686_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	42.9	2.2e-12
AVH74749.1|264765_265104_+	hypothetical protein	NA	NA	NA	NA	NA
AVH74750.1|265369_265876_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
AVH74751.1|265878_266493_+	molecular chaperone Tir	NA	A0A0S2MYG4	Enterococcus_phage	58.3	3.0e-53
AVH74752.1|266501_266705_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	66.1	1.2e-16
AVH75820.1|267816_268545_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	40.4	1.4e-33
AVH74753.1|268880_269879_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.2	5.5e-25
268618:268692	attR	AAAACAAACCCCGTCATATCAACGATTATCGCGATACAACGGGATTTGTTTTTTTATATTAAGGAGACAACGGGA	NA	NA	NA	NA
AVH74754.1|270093_271194_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AVH74755.1|271327_272290_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.8	2.3e-121
AVH74756.1|272316_274488_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	58.9	1.6e-247
>prophage 2
CP026847	Weissella koreensis strain WiKim0080 chromosome, complete genome	1495237	540940	547934	1495237		Escherichia_phage(33.33%)	7	NA	NA
AVH74988.1|540940_542542_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.6	8.3e-140
AVH74989.1|542727_543321_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AVH74990.1|543436_544273_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.6	1.3e-32
AVH74991.1|544315_545353_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	1.1e-73
AVH74992.1|545366_545960_-	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	A0A218MN57	uncultured_virus	32.9	2.5e-09
AVH74993.1|545966_546839_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.5	1.1e-98
AVH74994.1|546947_547934_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.3	1.1e-06
>prophage 3
CP026847	Weissella koreensis strain WiKim0080 chromosome, complete genome	1495237	1277391	1286665	1495237	tRNA	Catovirus(16.67%)	7	NA	NA
AVH75624.1|1277391_1279788_+	endonuclease MutS2	NA	A0A1V0SC35	Catovirus	24.8	1.7e-16
AVH75625.1|1279924_1280764_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.1	1.6e-65
AVH75626.1|1281205_1282414_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	1.2e-42
AVH75627.1|1282414_1283578_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AVH75628.1|1283688_1284129_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	35.6	5.3e-20
AVH75629.1|1284157_1285057_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9FZW0	Bacillus_phage	31.9	2.1e-15
AVH75630.1|1285336_1286665_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.1	3.1e-23
