The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	7192	55424	4987160	transposase,plate	Vibrio_phage(33.33%)	45	NA	NA
AVE92315.1|7192_8188_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVE92316.1|8184_10068_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVE92317.1|10083_10578_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVE92318.1|10574_11405_-	impE family protein	NA	NA	NA	NA	NA
AVE92319.1|11391_12306_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
AVE92320.1|12637_15271_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	33.9	9.3e-80
AVE92321.1|15283_15847_+	peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AVE92322.1|15849_16140_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92323.1|16201_16747_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVE96908.1|16789_18286_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVE92324.1|18338_18824_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92325.1|18820_19192_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92326.1|19304_19790_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVE92327.1|19857_20391_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVE92328.1|20394_21738_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVE92329.1|21734_23051_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AVE92330.1|23142_23511_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AVE92331.1|23512_23956_+	Shiga toxin A subunit	NA	NA	NA	NA	NA
AVE92332.1|23966_24134_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AVE92333.1|24283_28150_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVE92334.1|28146_28395_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92335.1|28396_29092_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92336.1|29088_29565_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92337.1|29753_30554_+	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
AVE92338.1|30706_31441_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92339.1|31437_31809_+	hypothetical protein	NA	NA	NA	NA	NA
AVE96909.1|33036_33522_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92340.1|33518_33905_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92341.1|33929_36143_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVE92342.1|36167_36611_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AVE92343.1|40756_41377_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92344.1|41466_41931_-	hypothetical protein	NA	NA	NA	NA	NA
AVE92345.1|44700_45243_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92346.1|45388_45598_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92347.1|45631_46768_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVE92348.1|46798_47569_-	amidohydrolase	NA	NA	NA	NA	NA
AVE92349.1|47722_48196_+	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AVE92350.1|48238_50683_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVE92351.1|50922_51501_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVE92352.1|51616_52384_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVE92353.1|52354_53095_-	transpeptidase	NA	NA	NA	NA	NA
AVE92354.1|53250_53529_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVE92355.1|53531_53792_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVE96910.1|54001_54751_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
AVE92356.1|54926_55424_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	368109	425629	4987160	tRNA,integrase,protease,lysis,portal,capsid,tail,terminase	Enterobacteria_phage(50.88%)	76	378260:378306	426053:426099
AVE92660.1|368109_369495_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AVE92661.1|369530_370052_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVE92662.1|370159_370372_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AVE92663.1|370373_371240_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVE92664.1|371711_372254_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AVE92665.1|372472_373165_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AVE92666.1|373195_375805_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVE92667.1|375817_376825_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AVE92668.1|376835_377351_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AVE92669.1|377353_377986_-	DNA-binding response regulator	NA	NA	NA	NA	NA
378260:378306	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AVE92670.1|378319_379483_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
AVE92671.1|379338_379710_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AVE92672.1|379681_379960_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.1e-47
AVE92673.1|379937_380270_-	RNA-binding protein	NA	A5VWB6	Enterobacteria_phage	93.6	6.5e-47
AVE92674.1|380269_380491_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	91.8	1.3e-32
AVE92675.1|380589_380871_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	94.6	1.1e-44
AVE92676.1|380881_381439_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AVE92677.1|381431_381593_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.0	1.6e-22
AVE92678.1|381589_382270_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	98.2	1.9e-130
AVE92679.1|382266_383052_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVE92680.1|383057_383354_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AVE92681.1|383429_383636_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVE92682.1|384229_384985_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.0e-92
AVE92683.1|385023_385254_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVE92684.1|385323_385863_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AVE92685.1|385859_386879_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.4	8.0e-112
AVE92686.1|386875_387598_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	9.0e-126
AVE92687.1|387750_388416_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92688.1|388430_389390_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92689.1|389584_389758_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92690.1|390021_390630_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
AVE92691.1|390865_391375_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92692.1|391471_391573_+	hypothetical protein	NA	NA	NA	NA	NA
AVE92693.1|391569_392025_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	1.7e-61
AVE92694.1|392024_392195_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVE92695.1|392187_392478_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AVE92696.1|392474_392837_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
AVE92697.1|392833_392974_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AVE92698.1|393059_393437_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AVE92699.1|393592_394117_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AVE92700.1|394309_395269_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AVE92701.1|395611_396352_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE92702.1|396540_396756_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AVE92703.1|396755_397253_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.3e-88
AVE92704.1|397249_397708_+	FAD-dependent thymidylate synthase	NA	K7PJW6	Enterobacteria_phage	80.3	6.2e-56
AVE92705.1|397909_398407_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
AVE92706.1|398403_398661_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
AVE92707.1|398737_398902_-	hypothetical protein	NA	NA	NA	NA	NA
AVE92708.1|398947_399358_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVE92709.1|399414_399648_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AVE96922.1|399753_399897_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVE92710.1|400036_400582_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AVE92711.1|400556_402482_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AVE92712.1|402478_402685_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AVE92713.1|402681_404283_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
AVE92714.1|404263_405595_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.2	2.2e-231
AVE92715.1|405604_405937_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
AVE92716.1|405992_407018_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.6e-184
AVE92717.1|407059_407455_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
AVE92718.1|407466_407820_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AVE92719.1|407831_408410_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
AVE92720.1|408406_408802_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AVE96923.1|408809_409550_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	2.9e-132
AVE92721.1|409565_409988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	9.4e-59
AVE92722.1|409969_410404_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
AVE92723.1|410396_412943_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.0	0.0e+00
AVE92724.1|412939_413269_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
AVE92725.1|413268_413967_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
AVE92726.1|413972_414716_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
AVE92727.1|414613_415285_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	1.8e-104
AVE92728.1|415345_418744_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.6	0.0e+00
AVE92729.1|418810_419410_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
AVE92730.1|419468_422957_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	65.8	1.3e-257
AVE96924.1|423011_423131_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.9	3.2e-09
AVE92731.1|423676_424426_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE92732.1|424675_425629_-|protease	protease 7	protease	NA	NA	NA	NA
426053:426099	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	759911	773189	4987160	head,integrase,protease,capsid,terminase	uncultured_Caudovirales_phage(28.57%)	17	759237:759251	764113:764127
759237:759251	attL	CGGGCTGGCATTTTG	NA	NA	NA	NA
AVE93039.1|759911_761150_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.0	2.0e-125
AVE93040.1|761569_761779_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	7.5e-17
AVE93041.1|761789_762704_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93042.1|762696_763017_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93043.1|763023_763323_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVE93044.1|763319_765443_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
764113:764127	attR	CGGGCTGGCATTTTG	NA	NA	NA	NA
AVE93045.1|765821_766064_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93046.1|766060_766417_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVE93047.1|766702_767743_+|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
AVE93048.1|767752_768094_+|head	head decoration protein	head	NA	NA	NA	NA
AVE93049.1|768105_768489_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVE93050.1|768481_768691_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93051.1|768690_769233_+|terminase	terminase	terminase	O64316	Escherichia_phage	47.5	3.2e-35
AVE96933.1|769484_769775_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93052.1|770225_770423_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93053.1|770561_770882_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVE93054.1|770912_773189_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 4
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1028673	1076033	4987160	head,tRNA,holin,integrase,lysis,portal,capsid,tail,terminase	Enterobacteria_phage(57.69%)	63	1033915:1033937	1081296:1081318
AVE93292.1|1028673_1029780_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVE93293.1|1029833_1030295_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVE93294.1|1030304_1030943_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVE93295.1|1031275_1031611_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AVE93296.1|1031610_1032060_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93297.1|1032640_1033891_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1033915:1033937	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
AVE93298.1|1034004_1035147_-|integrase	integrase	integrase	O21929	Phage_21	99.7	8.1e-206
AVE93299.1|1035136_1035373_-	excisionase	NA	NA	NA	NA	NA
AVE93300.1|1035512_1035752_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.8e-36
AVE93301.1|1035729_1036062_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	1.3e-47
AVE93302.1|1036061_1036283_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AVE93303.1|1036381_1036663_-	nickel pincer cofactor biosynthesis protein LarC	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AVE93304.1|1036673_1036865_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AVE93305.1|1036837_1037020_-	cruciferin	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	3.4e-26
AVE93306.1|1037016_1037697_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.6	1.0e-131
AVE93307.1|1037693_1038479_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
AVE93308.1|1038484_1038781_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.5e-47
AVE93309.1|1038856_1039063_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVE93310.1|1039543_1040050_-	hypothetical protein	NA	U5P455	Shigella_phage	34.0	4.1e-08
AVE93311.1|1040071_1041094_-	hypothetical protein	NA	U5P4L0	Shigella_phage	52.3	3.3e-97
AVE93312.1|1041216_1041972_-	transcriptional repressor LexA	NA	Q76H56	Enterobacteria_phage	75.0	2.3e-92
AVE93313.1|1042010_1042241_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVE93314.1|1042310_1042850_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
AVE93315.1|1042846_1043866_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.0e-111
AVE93316.1|1043862_1044585_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	93.9	6.6e-121
AVE96947.1|1044629_1044788_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AVE93317.1|1044930_1046124_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93318.1|1046133_1047921_-	heme ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVE93319.1|1048345_1048447_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93320.1|1048443_1048899_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	7.0e-60
AVE93321.1|1048898_1049069_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AVE93322.1|1049061_1049352_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	5.1e-48
AVE93323.1|1049348_1049711_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
AVE93324.1|1049707_1049848_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
AVE93325.1|1049844_1050534_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.6	1.9e-56
AVE93326.1|1050843_1051161_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AVE93327.1|1051147_1051624_+	lysozyme	NA	A5VW81	Enterobacteria_phage	96.2	1.0e-85
AVE93328.1|1051620_1052064_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	91.8	1.6e-69
AVE93329.1|1052102_1052477_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.7e-48
AVE93330.1|1052575_1052758_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93331.1|1053101_1053647_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	2.3e-94
AVE93332.1|1053621_1055547_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AVE93333.1|1055543_1055750_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVE93334.1|1055746_1057348_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	7.7e-311
AVE93335.1|1057328_1058648_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	3.1e-233
AVE93336.1|1058657_1058990_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
AVE93337.1|1059045_1060071_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	5.6e-190
AVE93338.1|1060112_1060511_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.0e-58
AVE93339.1|1060522_1060876_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	97.4	6.4e-61
AVE93340.1|1060887_1061466_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.3e-79
AVE93341.1|1061462_1061858_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.1e-69
AVE96948.1|1061865_1062606_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	5.6e-131
AVE93342.1|1062621_1063044_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVE93343.1|1063025_1063460_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AVE93344.1|1063452_1066002_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	86.0	0.0e+00
AVE93345.1|1065998_1066328_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
AVE93346.1|1066327_1067026_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AVE93347.1|1067031_1067775_+	invasion associated endopeptidase	NA	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
AVE93348.1|1067672_1068344_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	6.9e-104
AVE93349.1|1068404_1071803_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.0	0.0e+00
AVE93350.1|1071869_1072469_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	5.7e-110
AVE96949.1|1072533_1075449_+	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	99.1	5.0e-58
AVE93351.1|1075448_1076033_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
1081296:1081318	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1269688	1323747	4987160	tRNA,coat,lysis,tail,terminase	Escherichia_phage(50.0%)	62	NA	NA
AVE96966.1|1269688_1270921_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AVE93532.1|1271175_1272159_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVE93533.1|1272433_1272607_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93534.1|1272636_1274010_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
AVE93535.1|1274138_1275074_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVE93536.1|1275125_1276361_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.0	2.5e-237
AVE93537.1|1276362_1276578_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVE93538.1|1276677_1276866_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AVE93539.1|1276858_1277053_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.3	1.3e-31
AVE93540.1|1277109_1277919_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AVE93541.1|1277911_1280512_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	4.4e-247
AVE93542.1|1280613_1280889_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVE96967.1|1280963_1281134_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVE93543.1|1281133_1281355_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AVE93544.1|1281483_1281762_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93545.1|1281796_1282285_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVE93546.1|1282281_1282437_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-08
AVE93547.1|1282447_1282627_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93548.1|1282614_1282833_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93549.1|1282869_1283289_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AVE93550.1|1283368_1283623_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AVE93551.1|1283619_1284042_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	96.4	5.3e-70
AVE93552.1|1284054_1284912_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.9	7.0e-69
AVE93553.1|1284918_1285665_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	8.4e-111
AVE93554.1|1285636_1286449_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	8.3e-120
AVE93555.1|1286464_1286887_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
AVE96968.1|1287305_1287551_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
AVE93556.1|1287982_1289134_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
AVE93557.1|1289101_1290091_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93558.1|1290090_1291482_-	ATPase	NA	NA	NA	NA	NA
AVE93559.1|1291981_1292581_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
AVE93560.1|1292580_1292871_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	3.3e-47
AVE93561.1|1292867_1293410_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AVE96969.1|1294694_1294910_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
AVE93562.1|1294909_1295407_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AVE93563.1|1295623_1295809_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AVE93564.1|1296005_1297463_+	potassium transporter TrkG	NA	NA	NA	NA	NA
AVE93565.1|1297401_1297683_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93566.1|1297600_1298395_+	transcriptional regulator	NA	R4TG31	Halovirus	40.7	7.5e-49
AVE93567.1|1298387_1299320_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
AVE93568.1|1299297_1299507_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93569.1|1299510_1300605_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
AVE93570.1|1300585_1301887_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
AVE93571.1|1301889_1303296_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
AVE93572.1|1303279_1304392_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	8.4e-115
AVE93573.1|1304496_1305261_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	1.5e-86
AVE93574.1|1305359_1306499_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	3.3e-159
AVE93575.1|1306721_1307117_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	40.0	2.2e-09
AVE93576.1|1307116_1307500_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
AVE93577.1|1307500_1307881_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
AVE93578.1|1307877_1308270_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVE93579.1|1308296_1309259_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
AVE93580.1|1309319_1309769_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93581.1|1309876_1310077_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93582.1|1310240_1313474_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.1e-112
AVE93583.1|1313466_1313805_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AVE93584.1|1313804_1314503_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	94.8	7.1e-128
AVE93585.1|1314507_1315251_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	7.3e-147
AVE93586.1|1315148_1315820_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.8	3.2e-101
AVE93587.1|1315880_1319279_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
AVE93588.1|1319345_1319945_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
AVE93589.1|1320003_1323747_+	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	68.7	5.0e-305
>prophage 6
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1510170	1562045	4987160	tail,portal,lysis,terminase	Enterobacteria_phage(54.35%)	66	NA	NA
AVE93747.1|1510170_1510404_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVE93748.1|1510720_1511311_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVE93749.1|1511408_1511528_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
AVE93750.1|1511582_1514888_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.3e-283
AVE93751.1|1514952_1515552_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	1.2e-110
AVE93752.1|1515618_1519017_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
AVE93753.1|1519076_1519724_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
AVE93754.1|1519621_1520365_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.2e-146
AVE93755.1|1520370_1521069_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
AVE93756.1|1521078_1521408_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVE93757.1|1521407_1524473_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.4	0.0e+00
AVE93758.1|1524444_1524774_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AVE96977.1|1524782_1525169_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	9.8e-63
AVE93759.1|1525229_1525973_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
AVE96978.1|1525983_1526385_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AVE93760.1|1526381_1526960_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AVE93761.1|1526971_1527247_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVE93762.1|1527239_1527608_-	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	99.1	9.7e-52
AVE93763.1|1527649_1529677_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
AVE93764.1|1529621_1531130_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.7e-288
AVE93765.1|1531129_1531342_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVE93766.1|1531338_1533438_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
AVE96979.1|1533446_1533986_-	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
AVE93767.1|1534546_1534753_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AVE93768.1|1534907_1535108_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	4.5e-11
AVE93769.1|1535053_1535464_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AVE93770.1|1535615_1535789_-	protein GnsB	NA	NA	NA	NA	NA
AVE93771.1|1535960_1536233_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93772.1|1536263_1536452_-	cold-shock protein	NA	NA	NA	NA	NA
AVE93773.1|1536462_1536675_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVE93774.1|1536696_1536828_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
AVE93775.1|1537533_1538067_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVE93776.1|1538063_1538375_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVE93777.1|1538379_1538595_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVE93778.1|1538814_1538985_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AVE93779.1|1539348_1539564_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVE93780.1|1539864_1540077_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AVE93781.1|1540498_1541251_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
AVE93782.1|1541264_1542314_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
AVE93783.1|1542315_1542594_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93784.1|1542660_1542912_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93785.1|1543128_1543341_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
AVE93786.1|1543499_1543643_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93787.1|1544085_1545420_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
AVE93788.1|1545657_1546080_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
AVE93789.1|1546120_1547140_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AVE93790.1|1547066_1547588_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93791.1|1547571_1547802_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AVE93792.1|1547885_1548293_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AVE93793.1|1548459_1548615_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVE93794.1|1548574_1549192_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93795.1|1549678_1549867_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AVE93796.1|1549863_1550055_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVE93797.1|1550147_1552619_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVE93798.1|1552691_1552943_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVE93799.1|1552962_1554258_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AVE93800.1|1554277_1554388_-	transporter	NA	NA	NA	NA	NA
AVE93801.1|1554445_1555465_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
AVE93802.1|1555476_1556691_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVE93803.1|1556671_1556860_-	hypothetical protein	NA	NA	NA	NA	NA
AVE93804.1|1556896_1557223_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
AVE93805.1|1557357_1557699_+	hypothetical protein	NA	NA	NA	NA	NA
AVE93806.1|1557733_1558294_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AVE93807.1|1558296_1559007_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVE93808.1|1559114_1559420_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVE93809.1|1559618_1562045_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
>prophage 7
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1915295	1985025	4987160	head,integrase,holin,protease,lysis,portal,capsid,tail,terminase	Escherichia_phage(37.5%)	91	1918320:1918334	1997088:1997102
AVE94155.1|1915295_1915610_+|integrase	integrase	integrase	NA	NA	NA	NA
AVE96998.1|1915529_1915844_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AVE94156.1|1915888_1916083_-	hypothetical protein	NA	NA	NA	NA	NA
AVE94157.1|1916058_1917717_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AVE94158.1|1917709_1918705_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
1918320:1918334	attL	ACCTGATGAAAACGC	NA	NA	NA	NA
AVE94159.1|1918697_1919384_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AVE94160.1|1919383_1920757_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AVE94161.1|1920775_1921219_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AVE94162.1|1921215_1922343_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AVE94163.1|1922447_1922912_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AVE94164.1|1922916_1923921_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AVE94165.1|1923917_1924331_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AVE94166.1|1924333_1924699_+	flagellar protein FliO	NA	NA	NA	NA	NA
AVE94167.1|1924698_1925436_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AVE94168.1|1925445_1925715_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AVE94169.1|1925723_1926509_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AVE94170.1|1926798_1927422_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVE94171.1|1927465_1927708_-	DsrB protein	NA	NA	NA	NA	NA
AVE94172.1|1927640_1927829_-	hypothetical protein	NA	NA	NA	NA	NA
AVE94173.1|1927816_1928044_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AVE94174.1|1928341_1929157_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AVE94175.1|1929153_1930848_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.8	2.9e-18
AVE94176.1|1930768_1930957_-	hypothetical protein	NA	NA	NA	NA	NA
AVE94177.1|1931018_1931201_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVE94178.1|1931279_1932197_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVE94179.1|1932369_1933290_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVE94180.1|1933278_1933749_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.1e-34
AVE94181.1|1933729_1935148_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	54.7	6.7e-101
AVE94182.1|1935214_1935910_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	5.6e-08
AVE94183.1|1935948_1936314_-	permease	NA	NA	NA	NA	NA
AVE94184.1|1936406_1936661_+	hypothetical protein	NA	NA	NA	NA	NA
AVE94185.1|1936878_1938066_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	52.4	4.2e-96
AVE94186.1|1938656_1939508_+	protein deglycase HchA	NA	NA	NA	NA	NA
AVE94187.1|1939615_1940974_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AVE96999.1|1940973_1941645_-	two-component system response regulator BasR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
AVE94188.1|1941777_1942191_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVE94189.1|1942299_1943304_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVE94190.1|1943304_1943940_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVE94191.1|1944196_1944847_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AVE94192.1|1944882_1945212_+	hypothetical protein	NA	NA	NA	NA	NA
AVE94193.1|1945772_1945952_-	hypothetical protein	NA	NA	NA	NA	NA
AVE97000.1|1945924_1946053_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.1	8.3e-11
AVE94194.1|1946107_1949389_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	72.6	8.1e-307
AVE94195.1|1949453_1950053_-	Ail/Lom family protein	NA	K7PJP9	Enterobacteria_phage	98.0	3.7e-109
AVE94196.1|1950123_1953537_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AVE94197.1|1953597_1954269_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AVE94198.1|1954166_1954910_-	invasion associated endopeptidase	NA	K7PLW1	Enterobacteria_phage	98.4	1.1e-150
AVE94199.1|1954915_1955614_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	4.7e-132
AVE94200.1|1955613_1955970_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
AVE97001.1|1955947_1959175_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
AVE97002.1|1959220_1959481_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	6.0e-40
AVE94201.1|1959522_1959909_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
AVE94202.1|1959908_1960613_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	4.3e-117
AVE94203.1|1960672_1961017_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
AVE94204.1|1961013_1961463_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
AVE94205.1|1961459_1961798_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
AVE94206.1|1961806_1962112_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
AVE94207.1|1962123_1962312_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
AVE94208.1|1962363_1963569_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	7.7e-223
AVE94209.1|1963583_1964270_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AVE94210.1|1964211_1965453_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
AVE94211.1|1965452_1965635_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
AVE94212.1|1965646_1967404_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
AVE94213.1|1967403_1967886_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
AVE94214.1|1968034_1968385_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	3.6e-64
AVE94215.1|1968427_1968895_-|lysis	lysis protein	lysis	A0A1B5FPA1	Escherichia_phage	91.6	7.7e-70
AVE94216.1|1968891_1969425_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AVE94217.1|1969488_1969839_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
AVE94218.1|1969843_1970059_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AVE94219.1|1970855_1971545_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
AVE94220.1|1971541_1971901_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
AVE94221.1|1971913_1972963_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.7e-107
AVE94222.1|1972964_1973243_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
AVE94223.1|1973539_1973932_-	hypothetical protein	NA	NA	NA	NA	NA
AVE94224.1|1974075_1974288_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AVE94225.1|1974467_1975133_-	hypothetical protein	NA	NA	NA	NA	NA
AVE94226.1|1975307_1975733_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
AVE94227.1|1975748_1976519_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AVE94228.1|1976540_1977287_-	chromosomal replication initiator protein DnaA	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AVE97003.1|1977293_1978256_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
AVE94229.1|1978278_1978704_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVE94230.1|1978687_1978969_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AVE94231.1|1979069_1979489_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AVE97004.1|1979754_1979910_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.0e-06
AVE94232.1|1979869_1980040_+	hypothetical protein	NA	NA	NA	NA	NA
AVE94233.1|1980069_1980288_+	hypothetical protein	NA	NA	NA	NA	NA
AVE94234.1|1980841_1981030_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVE94235.1|1981026_1981218_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVE94236.1|1981311_1983738_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.6	6.5e-112
AVE94237.1|1983796_1984000_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVE94238.1|1983999_1985025_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
1997088:1997102	attR	ACCTGATGAAAACGC	NA	NA	NA	NA
>prophage 8
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	2169301	2177610	4987160		Enterobacteria_phage(83.33%)	9	NA	NA
AVE94387.1|2169301_2171302_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AVE94388.1|2171426_2171888_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVE94389.1|2171928_2172399_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	98.7	1.1e-81
AVE94390.1|2172445_2173165_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVE94391.1|2173161_2174847_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AVE94392.1|2175068_2175800_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
AVE94393.1|2175859_2175967_+	hypothetical protein	NA	NA	NA	NA	NA
AVE94394.1|2175947_2176679_-	ABC transporter permease	NA	NA	NA	NA	NA
AVE94395.1|2176683_2177610_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	2438473	2451395	4987160	integrase	Escherichia_phage(83.33%)	6	2443970:2443983	2452440:2452453
AVE94627.1|2438473_2439406_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AVE94628.1|2439993_2440524_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
AVE94629.1|2440571_2448485_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	93.8	0.0e+00
2443970:2443983	attL	TATCAAAAATCAGG	NA	NA	NA	NA
AVE94630.1|2448509_2449130_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	1.6e-118
AVE94631.1|2449447_2450077_-	pilus assembly protein	NA	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
AVE94632.1|2450825_2451395_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
2452440:2452453	attR	CCTGATTTTTGATA	NA	NA	NA	NA
