The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	563122	574009	5451057		Escherichia_phage(87.5%)	9	NA	NA
AVF10149.1|563122_566230_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVF10150.1|566284_567550_+	MFS transporter	NA	NA	NA	NA	NA
AVF10151.1|567580_568669_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AVF10152.1|568755_569016_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AVF10153.1|569313_570174_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AVF10154.1|570194_570956_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVF10155.1|571216_572119_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVF10156.1|572130_573396_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AVF10157.1|573388_574009_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
>prophage 2
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	740364	798245	5451057	transposase,plate,tRNA,protease	Escherichia_phage(37.5%)	55	NA	NA
AVF10308.1|740364_741300_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AVF10309.1|741345_742719_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AVF10310.1|742733_742928_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10311.1|742906_743140_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10312.1|743243_744227_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVF14604.1|744505_745249_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
AVF10313.1|745265_746330_+	oxidoreductase	NA	NA	NA	NA	NA
AVF10314.1|746566_746761_+	hypothetical protein	NA	NA	NA	NA	NA
AVF10315.1|746873_747620_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10316.1|747870_749250_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AVF10317.1|749584_750064_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVF10318.1|750315_750930_+	YitT family protein	NA	NA	NA	NA	NA
AVF10319.1|750968_752168_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVF10320.1|752196_752865_-	ABC transporter permease	NA	NA	NA	NA	NA
AVF10321.1|752857_753871_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	2.2e-29
AVF10322.1|753879_754686_-	methionine-binding protein	NA	NA	NA	NA	NA
AVF10323.1|754906_756082_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVF10324.1|756126_757161_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AVF10325.1|757249_757798_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVF10326.1|757852_758764_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AVF10327.1|758756_759623_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVF10328.1|759713_760637_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF10329.1|760656_761562_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF10330.1|761700_762630_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AVF10331.1|762655_762862_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVF10332.1|762912_763791_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AVF10333.1|763949_764705_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVF10334.1|764709_765303_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVF10335.1|765376_766090_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVF10336.1|766156_766651_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10337.1|766778_767321_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVF10338.1|767298_768378_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVF10339.1|768341_770096_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVF10340.1|770172_770643_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10341.1|771725_773324_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVF10342.1|773320_776779_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVF10343.1|776775_777387_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10344.1|777385_778366_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVF14605.1|778404_778515_-	ABC transporter	NA	NA	NA	NA	NA
AVF10345.1|778898_779996_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
AVF10346.1|780188_780710_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10347.1|780889_781657_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10348.1|781643_781904_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10349.1|781900_783661_-	M23 family peptidase	NA	NA	NA	NA	NA
AVF10350.1|783696_784059_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10351.1|784065_785298_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10352.1|785290_787810_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
AVF10353.1|787802_790457_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	2.9e-97
AVF10354.1|790721_791213_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVF10355.1|791217_792924_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10356.1|792920_793610_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVF14606.1|793606_794947_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVF10357.1|794959_796504_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVF10358.1|796546_797038_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVF10359.1|797678_798245_+|protease	protease	protease	NA	NA	NA	NA
>prophage 3
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	972070	984677	5451057	tail,tRNA	Enterobacteria_phage(62.5%)	16	NA	NA
AVF10522.1|972070_972571_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVF10523.1|972687_973134_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVF14610.1|973117_973909_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVF10524.1|974010_975195_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVF10525.1|975226_975919_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10526.1|976064_976574_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVF10527.1|976560_976917_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVF10528.1|976906_977146_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVF10529.1|977410_977662_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AVF10530.1|977705_978845_-	hypothetical protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AVF10531.1|978999_980172_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AVF10532.1|980171_980687_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AVF10533.1|980732_981050_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AVF14611.1|981049_981208_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AVF10534.1|981194_984170_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	6.1e-221
AVF10535.1|984185_984677_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.5	4.8e-54
>prophage 4
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	988521	1017235	5451057	integrase,plate,terminase,tail,capsid,portal	Enterobacteria_phage(54.17%)	37	977294:977315	1013500:1013521
977294:977315	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVF10537.1|988521_989619_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	28.2	2.7e-09
AVF10538.1|989603_989819_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10539.1|989815_992845_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AVF10540.1|992834_993758_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	6.4e-52
AVF10541.1|993759_994110_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
AVF10542.1|994106_994694_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.5	5.7e-54
AVF10543.1|994690_995326_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	4.6e-57
AVF10544.1|995322_995790_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
AVF10545.1|995971_996301_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVF10546.1|996312_996858_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.6	9.7e-32
AVF10547.1|996854_997139_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVF10548.1|997129_997330_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AVF10549.1|997329_997845_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	2.2e-41
AVF10550.1|997957_998815_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	60.9	8.3e-70
AVF10551.1|998864_999899_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
AVF10552.1|999908_1000748_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
AVF10553.1|1000904_1002632_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
AVF10554.1|1002625_1003687_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.0	9.1e-143
AVF10555.1|1004293_1005154_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
AVF10556.1|1005150_1006398_-	AAA family ATPase	NA	NA	NA	NA	NA
AVF10557.1|1008646_1009582_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AVF14612.1|1009578_1009806_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AVF10558.1|1009814_1010381_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
AVF10559.1|1010377_1010602_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10560.1|1010679_1010943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10561.1|1010958_1011336_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10562.1|1011351_1011570_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AVF10563.1|1011590_1011869_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AVF10564.1|1011989_1012289_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AVF10565.1|1012404_1013388_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AVF10566.1|1013652_1014666_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1013500:1013521	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVF10567.1|1014723_1014825_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14613.1|1014824_1014899_+	hypothetical protein	NA	NA	NA	NA	NA
AVF10568.1|1015016_1015139_+	hypothetical protein	NA	NA	NA	NA	NA
AVF10569.1|1015198_1015462_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVF10570.1|1015592_1016231_-	leucine efflux protein	NA	NA	NA	NA	NA
AVF10571.1|1016320_1017235_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 5
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	1313887	1323350	5451057	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AVF10818.1|1313887_1315609_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AVF10819.1|1315653_1316355_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVF10820.1|1316708_1316927_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVF10821.1|1317046_1319326_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVF10822.1|1319356_1319674_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVF10823.1|1319999_1320221_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVF10824.1|1320154_1320358_-	hypothetical protein	NA	NA	NA	NA	NA
AVF10825.1|1320297_1322238_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVF10826.1|1322234_1323350_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	3762636	3821150	5451057	integrase,plate,transposase,capsid,portal,tail,head,tRNA	Salmonella_phage(74.42%)	70	3757425:3757441	3826370:3826386
3757425:3757441	attL	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
AVF13004.1|3762636_3765879_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
AVF13005.1|3765883_3766498_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVF14735.1|3766850_3767165_+	HdeB family protein	NA	NA	NA	NA	NA
AVF13006.1|3767233_3767506_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13007.1|3768127_3769213_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
AVF13008.1|3769216_3769837_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.5	3.3e-36
AVF13009.1|3769937_3770174_+	regulator	NA	NA	NA	NA	NA
AVF13010.1|3770208_3770718_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	84.6	5.4e-77
AVF13011.1|3770725_3770926_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
AVF13012.1|3770889_3771228_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVF13013.1|3771295_3771529_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.0e-30
AVF13014.1|3771528_3771756_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	90.7	5.6e-34
AVF13015.1|3771752_3772640_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.9	3.1e-120
AVF13016.1|3772620_3775026_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.0	0.0e+00
AVF14737.1|3775212_3775401_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
AVF14736.1|3775414_3775648_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.5e-31
AVF13017.1|3775724_3775982_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13018.1|3776276_3777086_+	TIGR04255 family protein	NA	NA	NA	NA	NA
AVF13019.1|3777399_3777768_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVF13020.1|3777777_3778626_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13021.1|3778803_3779784_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVF14738.1|3779822_3779936_-	ABC transporter	NA	NA	NA	NA	NA
AVF13022.1|3779884_3780895_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	5.9e-168
AVF13023.1|3780894_3782658_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
AVF13024.1|3782798_3783632_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
AVF13025.1|3783648_3784713_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
AVF13026.1|3784716_3785367_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	85.2	5.3e-101
AVF13027.1|3785463_3785928_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	6.0e-75
AVF13028.1|3785927_3786131_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVF13029.1|3786134_3786350_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AVF13030.1|3786330_3786840_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	2.5e-82
AVF13031.1|3786844_3787228_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	9.5e-18
AVF13032.1|3787224_3787653_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVF13033.1|3787748_3788171_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	3.1e-62
AVF13034.1|3788163_3788616_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.5	3.1e-52
AVF13035.1|3788651_3789269_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13036.1|3789375_3789948_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	1.6e-77
AVF13037.1|3789944_3790307_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.2e-48
AVF13038.1|3790293_3791202_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	69.5	1.2e-111
AVF13039.1|3791194_3791803_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.6	8.8e-58
AVF13040.1|3793934_3794675_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13041.1|3794694_3795774_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	45.5	1.8e-29
AVF13042.1|3795912_3797085_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
AVF13043.1|3797094_3797610_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVF13044.1|3797662_3797962_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AVF14739.1|3797976_3798096_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVF13045.1|3798088_3800716_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	5.0e-118
AVF13046.1|3800712_3801198_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AVF13047.1|3801194_3802292_+	late control protein D	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
AVF13048.1|3802362_3802581_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AVF13049.1|3802593_3802971_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13050.1|3803298_3803805_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVF13051.1|3803904_3805746_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVF13052.1|3805964_3807710_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AVF13053.1|3807821_3808037_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVF13054.1|3808035_3808266_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13055.1|3808274_3809288_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.1e-108
AVF13056.1|3809332_3810940_-	allantoin permease	NA	NA	NA	NA	NA
AVF13057.1|3811093_3811711_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AVF13058.1|3811719_3812394_-	urease accessory protein UreF	NA	NA	NA	NA	NA
AVF13059.1|3812395_3812872_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AVF13060.1|3813147_3814152_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVF13061.1|3815904_3816225_-	urease subunit beta	NA	NA	NA	NA	NA
AVF13062.1|3816234_3816537_-	urease subunit gamma	NA	NA	NA	NA	NA
AVF13063.1|3816546_3817371_-	urease accessory protein	NA	NA	NA	NA	NA
AVF13064.1|3817360_3817507_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AVF13065.1|3817768_3818386_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVF13066.1|3818493_3818877_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVF13067.1|3819075_3819897_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVF13068.1|3819908_3821150_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
3826370:3826386	attR	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
>prophage 7
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4386940	4434108	5451057	holin,coat,tail,terminase	Salmonella_phage(26.53%)	64	NA	NA
AVF13594.1|4386940_4388170_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	96.3	1.3e-238
AVF13595.1|4388147_4388423_-	excisionase	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AVF14758.1|4388460_4388700_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AVF13596.1|4388707_4389016_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
AVF13597.1|4389012_4389624_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
AVF13598.1|4389616_4389955_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13599.1|4389989_4391099_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.2	2.5e-183
AVF13600.1|4391111_4394222_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.7	1.3e-293
AVF13601.1|4394359_4394515_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AVF13602.1|4394523_4394715_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVF13603.1|4395201_4395405_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
AVF13604.1|4395453_4396260_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AVF13605.1|4396256_4397105_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13606.1|4397275_4397671_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
AVF13607.1|4397775_4398009_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AVF13608.1|4398011_4398548_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	3.6e-63
AVF13609.1|4398635_4398824_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13610.1|4398838_4399747_+	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
AVF13611.1|4399749_4400499_+	chromosomal replication initiator protein DnaA	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AVF13612.1|4400506_4400842_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AVF13613.1|4400834_4401626_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.2e-64
AVF13614.1|4401618_4402236_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	52.1	3.7e-19
AVF13615.1|4402232_4402412_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13616.1|4402408_4402885_+	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
AVF13617.1|4403646_4403880_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AVF13618.1|4403986_4404235_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AVF13619.1|4404269_4404866_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
AVF13620.1|4404865_4405072_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.8e-24
AVF13621.1|4405074_4405371_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AVF13622.1|4405367_4405724_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	2.0e-41
AVF13623.1|4405839_4406661_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
AVF13624.1|4406925_4407330_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13625.1|4407349_4407745_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AVF13626.1|4407731_4408013_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AVF13627.1|4408012_4408642_+	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AVF13628.1|4408649_4408925_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	1.6e-14
AVF13629.1|4408914_4409070_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.4	3.2e-17
AVF13630.1|4409160_4409445_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13631.1|4409577_4409850_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13632.1|4410163_4410409_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	50.6	4.5e-13
AVF13633.1|4410477_4411473_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	42.9	6.5e-34
AVF13634.1|4411450_4412755_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	2.2e-146
AVF13635.1|4412759_4414184_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	7.5e-193
AVF13636.1|4414167_4415280_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.2	1.8e-109
AVF13637.1|4415456_4415696_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13638.1|4415814_4416579_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	3.9e-79
AVF13639.1|4416666_4417803_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	2.6e-156
AVF13640.1|4417852_4418137_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13641.1|4418140_4418551_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	1.6e-10
AVF13642.1|4418552_4418936_+	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	49.6	1.5e-23
AVF13643.1|4418937_4419489_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.1	7.0e-30
AVF13644.1|4419485_4419878_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVF13645.1|4419901_4421074_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.4e-22
AVF13646.1|4421128_4421611_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13647.1|4421778_4421946_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13648.1|4422122_4422653_+	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
AVF13649.1|4422734_4423232_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13650.1|4423277_4423640_+	hypothetical protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
AVF13651.1|4423735_4427302_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.7	4.2e-83
AVF13652.1|4427301_4427766_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	6.1e-59
AVF13653.1|4427946_4428429_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	92.5	3.8e-80
AVF13654.1|4428438_4428819_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
AVF13655.1|4428815_4431878_+	kinase	NA	A0A286S259	Klebsiella_phage	94.1	0.0e+00
AVF13656.1|4431954_4434108_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
>prophage 8
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4500350	4515072	5451057	tail,integrase	Morganella_phage(50.0%)	17	4500103:4500123	4520167:4520187
4500103:4500123	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
AVF14761.1|4500350_4501604_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
AVF13716.1|4501699_4502707_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13717.1|4502837_4503056_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVF13718.1|4503055_4503490_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
AVF13719.1|4503503_4504106_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
AVF13720.1|4504105_4504285_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVF13721.1|4504281_4505247_+	HAD family hydrolase	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
AVF13722.1|4505243_4505747_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13723.1|4505743_4505953_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13724.1|4505949_4506576_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
AVF13725.1|4506585_4506936_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
AVF13726.1|4506928_4509691_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
AVF14762.1|4510030_4510477_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVF14763.1|4510490_4510841_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVF13727.1|4510845_4511319_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13728.1|4511672_4511999_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13729.1|4512006_4515072_+|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
4520167:4520187	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 9
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4612449	4699792	5451057	holin,terminase,transposase,capsid,portal,tail,protease,head,tRNA	Klebsiella_phage(43.33%)	101	NA	NA
AVF13820.1|4612449_4613868_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AVF13821.1|4613919_4614312_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13822.1|4614315_4614669_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13823.1|4615173_4617345_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVF13824.1|4617393_4618596_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AVF13825.1|4618942_4620184_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AVF13826.1|4620241_4620601_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AVF13827.1|4620731_4621724_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AVF14767.1|4621904_4623566_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AVF13828.1|4625061_4626027_+	glucokinase	NA	NA	NA	NA	NA
AVF14768.1|4626080_4626818_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AVF13829.1|4626829_4628527_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AVF13830.1|4628635_4628821_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AVF13831.1|4628909_4630124_+	alanine transaminase	NA	NA	NA	NA	NA
AVF14769.1|4630194_4630266_-	membrane protein YpdK	NA	NA	NA	NA	NA
AVF13832.1|4630604_4631801_-	cyanate transporter	NA	NA	NA	NA	NA
AVF13833.1|4631797_4632256_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
AVF13834.1|4632388_4633297_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
AVF13835.1|4633306_4634188_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AVF13836.1|4634556_4635039_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVF13837.1|4635557_4636727_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	85.0	4.0e-200
AVF13838.1|4636759_4637695_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	7.5e-08
AVF13839.1|4637710_4637896_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
AVF13840.1|4637903_4638578_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	47.9	8.3e-41
AVF13841.1|4638574_4638787_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	1.8e-10
AVF13842.1|4638783_4639236_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13843.1|4639232_4639439_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
AVF13844.1|4639435_4639846_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13845.1|4639973_4640759_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	7.6e-62
AVF13846.1|4640758_4641058_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13847.1|4641145_4642069_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
AVF14770.1|4642358_4642598_-	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	78.3	2.1e-23
AVF14771.1|4642826_4643474_-	phage repressor protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
AVF13848.1|4643578_4643776_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AVF13849.1|4643801_4644263_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AVF13850.1|4644500_4644713_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
AVF13851.1|4644669_4645584_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
AVF13852.1|4645580_4646390_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
AVF13853.1|4646399_4646777_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AVF13854.1|4646789_4647770_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.9e-134
AVF13855.1|4647783_4648362_+	fatty acid metabolism transcriptional regulator FadR	NA	A0A0U2S606	Escherichia_phage	57.2	9.9e-51
AVF13856.1|4648674_4648932_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	3.7e-42
AVF13857.1|4648837_4649284_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13858.1|4649454_4650501_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AVF13859.1|4650945_4651341_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AVF13860.1|4651327_4651609_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AVF13861.1|4651608_4652238_+	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AVF13862.1|4652245_4652521_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	6.8e-10
AVF13863.1|4652471_4652666_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.8e-25
AVF13864.1|4653479_4653725_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
AVF13865.1|4653796_4654003_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	100.0	2.7e-35
AVF13866.1|4654074_4654365_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	1.2e-52
AVF13867.1|4654377_4654587_+	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	65.2	3.4e-17
AVF13868.1|4654709_4655144_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AVF13869.1|4655153_4656686_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
AVF13870.1|4656688_4657966_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AVF13871.1|4657971_4658652_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AVF13872.1|4658663_4659827_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
AVF13873.1|4660053_4660380_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	97.2	3.7e-55
AVF13874.1|4660440_4660638_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	95.4	5.4e-25
AVF13875.1|4660639_4660972_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	7.6e-56
AVF13876.1|4660964_4661504_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	99.4	1.0e-94
AVF13877.1|4661500_4661866_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	3.3e-60
AVF13878.1|4661922_4662414_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
AVF13879.1|4662457_4662811_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	80.3	1.3e-48
AVF13880.1|4662843_4663107_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	97.7	1.3e-42
AVF14772.1|4663103_4663535_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	4.4e-64
AVF13881.1|4663597_4666024_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	84.6	0.0e+00
AVF13882.1|4666023_4666503_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AVF13883.1|4666489_4666972_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
AVF13884.1|4666981_4667362_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
AVF13885.1|4667358_4670427_+	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
AVF13886.1|4670502_4672656_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.5	1.9e-54
AVF13887.1|4672668_4673403_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13888.1|4673414_4673744_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13889.1|4673780_4674110_-	hypothetical protein	NA	NA	NA	NA	NA
AVF13890.1|4674563_4674815_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13891.1|4674814_4676299_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVF13892.1|4676373_4676613_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
AVF13893.1|4676569_4676941_+	translesion error-prone DNA polymerase V subunit UmuD	NA	K7PGV5	Enterobacterial_phage	50.0	9.2e-26
AVF13894.1|4677147_4678077_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
AVF13895.1|4678366_4679128_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVF13896.1|4679189_4680518_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AVF13897.1|4680885_4681170_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVF13898.1|4681329_4682640_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVF13899.1|4682639_4684784_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVF13900.1|4684993_4685479_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVF13901.1|4685499_4686051_-	endonuclease SmrB	NA	NA	NA	NA	NA
AVF13902.1|4686218_4687151_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVF13903.1|4687192_4688278_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
AVF13904.1|4688280_4689105_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVF13905.1|4689104_4689914_+	hypothetical protein	NA	NA	NA	NA	NA
AVF13906.1|4689913_4690462_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVF14773.1|4690493_4690775_+	YfcL family protein	NA	NA	NA	NA	NA
AVF13907.1|4690836_4692825_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVF13908.1|4692983_4694204_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AVF13909.1|4694413_4695592_+	arabinose transporter	NA	NA	NA	NA	NA
AVF13910.1|4695678_4696656_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AVF13911.1|4696766_4697903_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AVF13912.1|4697966_4698980_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVF13913.1|4698979_4699792_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 10
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4897663	4904568	5451057		Planktothrix_phage(33.33%)	6	NA	NA
AVF14781.1|4897663_4898527_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AVF14081.1|4898537_4899311_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVF14782.1|4899551_4900445_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVF14082.1|4900690_4902052_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVF14083.1|4902370_4903093_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVF14084.1|4903089_4904568_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 11
CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	5126167	5186078	5451057	coat,terminase,head,tRNA	Cronobacter_phage(17.24%)	81	NA	NA
AVF14263.1|5126167_5127901_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AVF14264.1|5128136_5128706_+	VOC family protein	NA	NA	NA	NA	NA
AVF14265.1|5128782_5129526_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVF14266.1|5129607_5130612_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVF14267.1|5130608_5131352_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AVF14268.1|5131391_5131787_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14269.1|5131839_5132619_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AVF14270.1|5132615_5133875_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
AVF14271.1|5133917_5134163_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
AVF14272.1|5134166_5134385_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	58.5	1.6e-09
AVF14273.1|5134381_5135146_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.8	2.5e-70
AVF14274.1|5135142_5135415_-	hypothetical protein	NA	Q716F1	Shigella_phage	64.7	2.8e-24
AVF14275.1|5135411_5135636_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14793.1|5135632_5136160_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
AVF14276.1|5136188_5136812_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	4.0e-58
AVF14277.1|5136808_5137555_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
AVF14278.1|5137571_5137856_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
AVF14279.1|5137863_5138835_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
AVF14280.1|5138922_5139117_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14281.1|5139629_5140328_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AVF14282.1|5140327_5140648_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14794.1|5140693_5141416_-	XRE family transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.7	1.1e-75
AVF14283.1|5141484_5141712_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
AVF14284.1|5141750_5141972_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVF14795.1|5142105_5142834_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.9	9.3e-38
AVF14285.1|5142830_5143607_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
AVF14286.1|5143606_5143909_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14287.1|5143905_5144295_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.3	4.1e-16
AVF14288.1|5144291_5145200_+	hypothetical protein	NA	A0A140XFY9	Salmonella_phage	81.0	1.3e-145
AVF14289.1|5145196_5145883_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	50.6	3.8e-33
AVF14290.1|5146055_5146343_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14291.1|5146342_5146600_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
AVF14292.1|5146695_5147292_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	53.8	3.6e-56
AVF14796.1|5147297_5147468_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.6	6.3e-14
AVF14293.1|5147460_5148099_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	9.8e-76
AVF14294.1|5148095_5148737_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	1.1e-34
AVF14295.1|5148870_5149560_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	8.4e-57
AVF14296.1|5149962_5150235_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14297.1|5150303_5150618_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
AVF14298.1|5150620_5151124_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
AVF14299.1|5151120_5151498_+	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
AVF14300.1|5151478_5151664_+	rz1 lytic protein	NA	Q8SBD8	Shigella_phage	57.1	2.1e-10
AVF14301.1|5152029_5152632_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
AVF14302.1|5152631_5154104_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	9.0e-250
AVF14303.1|5154116_5155580_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	1.1e-149
AVF14304.1|5155512_5156514_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.2e-115
AVF14305.1|5156784_5158140_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.3	1.3e-130
AVF14306.1|5158139_5158601_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AVF14307.1|5158597_5159653_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
AVF14308.1|5159685_5159925_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14309.1|5159927_5160308_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AVF14310.1|5160307_5160481_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	4.1e-13
AVF14311.1|5160480_5160843_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
AVF14312.1|5160845_5161214_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	8.5e-48
AVF14313.1|5161210_5161594_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14314.1|5161596_5161818_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14315.1|5161877_5162642_+	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	43.2	3.3e-38
AVF14316.1|5162710_5163424_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.7e-63
AVF14317.1|5163640_5164192_+	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	91.4	1.8e-86
AVF14797.1|5164550_5164910_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	1.1e-15
AVF14798.1|5165383_5165854_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14318.1|5165925_5169189_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	59.7	2.9e-232
AVF14799.1|5169288_5169708_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.6e-29
AVF14319.1|5169707_5170178_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	5.6e-28
AVF14320.1|5170174_5170570_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	3.6e-36
AVF14321.1|5170556_5173034_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	3.9e-197
AVF14322.1|5173120_5175304_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.4	3.0e-92
AVF14323.1|5175316_5176051_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14324.1|5176062_5176392_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14325.1|5176428_5176758_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14326.1|5177211_5177463_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14327.1|5177462_5178947_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVF14328.1|5179024_5179264_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	51.3	7.2e-16
AVF14329.1|5179263_5179581_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	5.3e-22
AVF14330.1|5179977_5180544_-	hydrolase	NA	NA	NA	NA	NA
AVF14331.1|5180811_5182599_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AVF14332.1|5182600_5183044_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVF14333.1|5183071_5183812_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF14334.1|5183846_5184368_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AVF14335.1|5184447_5185059_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVF14336.1|5185067_5186078_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
>prophage 1
CP026752	Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence	211813	1686	47990	211813	transposase,protease,integrase	Escherichia_phage(25.0%)	39	9684:9697	19914:19927
AVF14814.1|1686_2691_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVF14994.1|2988_3231_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14815.1|3561_3855_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AVF14816.1|3953_4721_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AVF14817.1|4721_5678_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AVF14818.1|5674_6673_-	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AVF14819.1|6669_7572_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AVF14820.1|7616_9941_-	TonB-dependent vitamin B12 receptor BtuB	NA	NA	NA	NA	NA
9684:9697	attL	CAGCTGTTGCAGGC	NA	NA	NA	NA
AVF14821.1|10026_10980_-	FecR family protein	NA	NA	NA	NA	NA
AVF14822.1|10976_11498_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVF14823.1|12600_12768_+|integrase	integrase	integrase	NA	NA	NA	NA
AVF14824.1|13052_14180_+	regulator	NA	NA	NA	NA	NA
AVF14825.1|14176_14770_+	response regulator	NA	NA	NA	NA	NA
AVF14826.1|14766_15615_+	nickel ABC transporter permease subunit NikC	NA	NA	NA	NA	NA
AVF14827.1|15614_16535_+	ABC transporter permease	NA	NA	NA	NA	NA
AVF14828.1|16547_18152_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AVF14829.1|18196_19144_+	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AVF14830.1|19151_20885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
19914:19927	attR	CAGCTGTTGCAGGC	NA	NA	NA	NA
AVF14831.1|22666_22858_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14832.1|22911_23571_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AVF14833.1|23771_24149_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVF14834.1|24459_25464_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVF14835.1|25542_28509_-|transposase	Tn3 family transposase TnAs3	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVF14836.1|28731_29436_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF14837.1|30291_31119_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AVF14838.1|31115_31979_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF14995.1|31987_32815_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AVF14839.1|32823_33834_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AVF14840.1|33827_34697_+	transcriptional regulator CynR	NA	NA	NA	NA	NA
AVF14997.1|35402_35729_-	hypothetical protein	NA	NA	NA	NA	NA
AVF14996.1|35780_35867_+	ABC transporter	NA	NA	NA	NA	NA
AVF14841.1|35905_36886_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVF14998.1|38872_39154_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AVF14842.1|39188_39758_+	heat shock protein IbpA	NA	NA	NA	NA	NA
AVF14843.1|39872_42668_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AVF14844.1|42667_42865_+	hypothetical protein	NA	NA	NA	NA	NA
AVF14845.1|43102_43852_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVF14846.1|43838_44801_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AVF14999.1|46643_47990_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP026752	Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence	211813	85447	93375	211813	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
AVF14886.1|85447_86128_+	two-component system response regulator BasR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AVF14887.1|86120_87596_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVF14888.1|87846_88278_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AVF14889.1|88923_89328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AVF14890.1|89324_89672_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVF14891.1|89720_91259_+|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AVF15002.1|92168_93375_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
>prophage 1
CP026753	Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence	70730	6275	47430	70730	transposase,integrase	Escherichia_phage(31.58%)	51	4472:4531	42372:42487
4472:4531	attL	CGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTT	NA	NA	NA	NA
AVF15018.1|6275_6878_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.3	3.2e-76
AVF15091.1|8764_9211_+	EamA-like transporter family protein	NA	NA	NA	NA	NA
AVF15019.1|9427_9640_+	resolvase	NA	NA	NA	NA	NA
AVF15020.1|9652_10861_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AVF15021.1|10894_12328_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AVF15022.1|12709_12916_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15023.1|12920_13433_-	restriction endonuclease	NA	NA	NA	NA	NA
AVF15024.1|13457_14162_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF15025.1|14195_14687_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15026.1|14793_15531_+	resolvase	NA	NA	NA	NA	NA
AVF15027.1|15527_15752_+	hypothetical protein	NA	NA	NA	NA	NA
AVF15028.1|15962_16502_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVF15029.1|16473_17310_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVF15030.1|17309_18113_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVF15031.1|18173_18989_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVF15032.1|19392_20097_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF15092.1|20179_20263_+	mercury resistance protein	NA	NA	NA	NA	NA
AVF15033.1|20246_20483_-	mercury resistance protein	NA	NA	NA	NA	NA
AVF15034.1|20479_20845_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF15035.1|20862_22548_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AVF15036.1|22586_23012_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AVF15037.1|23039_23315_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AVF15038.1|23330_23696_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AVF15039.1|23767_24223_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVF15040.1|24482_25010_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AVF15041.1|25042_25474_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15042.1|25953_26919_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AVF15043.1|27126_27396_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15044.1|27388_28873_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVF15045.1|28872_29124_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15046.1|29281_29713_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AVF15047.1|29712_30984_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AVF15048.1|31065_32043_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AVF15049.1|32039_33245_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AVF15050.1|33659_33929_+	hypothetical protein	NA	NA	NA	NA	NA
AVF15051.1|33961_34159_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15052.1|34285_35152_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AVF15053.1|35919_36177_+	hypothetical protein	NA	NA	NA	NA	NA
AVF15054.1|36234_37011_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AVF15055.1|37007_37751_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15056.1|37801_38152_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15093.1|38295_38730_-	hypothetical protein	NA	NA	NA	NA	NA
AVF15057.1|38713_38944_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVF15058.1|38940_39357_+	PIN domain nuclease	NA	NA	NA	NA	NA
AVF15059.1|39430_40141_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AVF15060.1|40956_41817_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVF15061.1|42516_43341_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
42372:42487	attR	AAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGTTCAAGGTGAGCGGACTCGCGCGGCTTTATGCGCGAGGTCCGCTCGAGCGCAGGGT	NA	NA	NA	NA
AVF15062.1|43400_44189_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVF15094.1|44258_44813_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVF15063.1|45046_45604_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AVF15064.1|46167_47430_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
