The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	361907	421722	5919083	terminase,integrase,portal,holin,tail	Pseudomonas_phage(46.88%)	78	352697:352745	424375:424423
352697:352745	attL	TTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCATGCA	NA	NA	NA	NA
AVD85934.1|361907_362330_+	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	70.0	2.0e-53
AVD85935.1|362371_362971_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	68.5	3.9e-66
AVD85936.1|363938_365237_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	71.2	9.0e-185
AVD85937.1|365387_367067_-|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	61.0	2.8e-194
AVD85938.1|367220_367559_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	60.3	2.8e-21
AVD85939.1|367558_367882_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	63.2	3.8e-28
AVD85940.1|367978_368236_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85941.1|368278_369274_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85942.1|369277_370000_-	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	65.6	2.2e-79
AVD85943.1|370011_370329_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	61.9	1.1e-30
AVD90722.1|371343_372279_+|integrase	integrase	integrase	A0A2D1GN00	Marinobacter_phage	37.0	3.0e-49
AVD85944.1|372585_372792_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85945.1|372781_373090_-	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	72.2	2.4e-35
AVD90723.1|373169_373394_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	75.7	8.0e-25
AVD85946.1|375808_376333_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	77.4	4.9e-41
AVD85947.1|376329_376776_-	structural protein P5	NA	A0A2R3UAM8	Myoviridae_environmental_samples	57.5	1.8e-36
AVD90724.1|376834_377230_-	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	64.1	2.8e-36
AVD85948.1|377427_378240_-|tail	phage tail protein	tail	A0A0S2SY45	Pseudomonas_phage	45.2	1.2e-46
AVD85949.1|378255_379131_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85950.1|379131_379446_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85951.1|379442_382910_-	host specificity protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	55.4	0.0e+00
AVD85952.1|382965_383550_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	76.8	8.1e-77
AVD85953.1|383592_384012_-	hypothetical protein	NA	J9Q806	Salmonella_phage	42.5	2.3e-25
AVD85954.1|384188_384452_+	hypothetical protein	NA	NA	NA	NA	NA
AVD85955.1|384674_385430_-	hydrolase Nlp/P60	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	78.5	9.7e-123
AVD85956.1|385432_386182_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.5	1.1e-121
AVD85957.1|386191_386530_-|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	72.3	4.0e-44
AVD85958.1|386529_389931_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	53.3	4.1e-205
AVD90725.1|389934_390186_-	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	77.8	2.3e-28
AVD85959.1|390248_390632_-	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	58.3	3.7e-38
AVD85960.1|390641_391301_-|tail	phage tail protein	tail	A0A0S2SYG8	Pseudomonas_phage	72.4	4.1e-85
AVD85961.1|391340_391769_-	hypothetical protein	NA	A0A2H4J5P1	uncultured_Caudovirales_phage	94.2	2.3e-68
AVD85962.1|391765_392437_-	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	53.6	6.7e-59
AVD85963.1|392439_392826_-	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	63.8	6.8e-40
AVD85964.1|392827_393196_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	53.5	5.4e-26
AVD85965.1|393195_393492_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	53.3	1.0e-06
AVD85966.1|393533_394502_-	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	79.8	1.4e-142
AVD85967.1|394511_395258_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	77.2	2.7e-93
AVD85968.1|395409_396486_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	51.5	1.7e-96
AVD85969.1|396485_397898_-	DNA-binding protein	NA	A0A0H5AWC7	Pseudomonas_phage	64.6	3.0e-173
AVD85970.1|397894_399214_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	93.4	1.5e-248
AVD85971.1|399188_399665_-	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	82.9	3.5e-70
AVD85972.1|399695_400307_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	71.4	1.3e-85
AVD85973.1|400327_400543_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85974.1|400602_400839_+	hypothetical protein	NA	NA	NA	NA	NA
AVD85975.1|400876_401146_-	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	58.8	1.1e-17
AVD85976.1|401145_401457_-	peptidase M48, Ste24p	NA	A0A1B0VME9	Pseudomonas_phage	52.3	2.2e-17
AVD85977.1|401948_402245_+	hypothetical protein	NA	NA	NA	NA	NA
AVD85978.1|402271_402952_-	hypothetical protein	NA	A0A2H4IZI6	uncultured_Caudovirales_phage	98.7	4.2e-109
AVD85979.1|403067_403670_-	ninG protein	NA	L7TH85	Pseudomonas_virus	55.3	2.1e-56
AVD85980.1|403660_403984_-	hypothetical protein	NA	A0A2H4J249	uncultured_Caudovirales_phage	45.0	5.0e-12
AVD85981.1|403980_404451_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	65.4	6.1e-59
AVD85982.1|405072_405333_-	hypothetical protein	NA	A0A2H4J0W8	uncultured_Caudovirales_phage	61.8	1.9e-25
AVD85983.1|405329_406136_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	52.3	3.3e-60
AVD85984.1|406122_407049_-	helix-turn-helix domain-containing protein	NA	A0A1B0VME0	Pseudomonas_phage	69.6	7.6e-53
AVD85985.1|407045_407513_-	hypothetical protein	NA	NA	NA	NA	NA
AVD85986.1|407509_408373_-	transporter	NA	Q8W644	Enterobacteria_phage	41.6	9.6e-50
AVD85987.1|408460_408673_-	hypothetical protein	NA	A0A2H4J8V2	uncultured_Caudovirales_phage	66.2	1.5e-17
AVD85988.1|408692_408896_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	92.5	7.7e-27
AVD85989.1|408928_409132_-	hypothetical protein	NA	W6MWX8	Pseudomonas_phage	58.2	4.6e-11
AVD85990.1|409254_409941_+	peptidase	NA	W6MVG5	Pseudomonas_phage	62.4	1.7e-73
AVD85991.1|410016_410517_+	hypothetical protein	NA	NA	NA	NA	NA
AVD85992.1|410935_411367_+	hypothetical protein	NA	A0A2I6PHZ0	Pseudomonas_phage	96.2	4.2e-06
AVD85993.1|411719_412118_+	hypothetical protein	NA	W8VT00	Pseudomonas_phage	58.8	1.4e-16
AVD85994.1|412145_412748_+	hypothetical protein	NA	A0A2I7RAN1	Vibrio_phage	39.2	1.1e-28
AVD85995.1|412879_413308_+	hypothetical protein	NA	A0A1B0VMC3	Pseudomonas_phage	42.0	1.1e-17
AVD85996.1|413304_413532_+	hypothetical protein	NA	A0A2H4IZT6	uncultured_Caudovirales_phage	36.0	7.1e-05
AVD85997.1|413982_415107_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	66.1	1.1e-53
AVD85998.1|415114_415873_+	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	46.3	9.6e-46
AVD85999.1|415876_416494_+	exonuclease	NA	A0A1B0VMB3	Pseudomonas_phage	84.4	1.1e-100
AVD86000.1|416501_417014_+	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	33.1	1.8e-11
AVD86001.1|417262_417625_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	46.6	2.8e-11
AVD86002.1|417694_419533_+	DNA methyltransferase	NA	Q5QF27	Pseudomonas_virus	64.2	1.5e-246
AVD86003.1|419546_420272_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86004.1|420363_420786_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86005.1|420785_421055_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	68.5	6.9e-23
AVD86006.1|421093_421306_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86007.1|421302_421722_+	DUF2591 domain-containing protein	NA	A0A125RNP6	Pseudomonas_phage	36.8	1.3e-15
424375:424423	attR	TTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCATGCA	NA	NA	NA	NA
>prophage 2
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	628668	678011	5919083	head,integrase,terminase,tRNA	Pseudomonas_phage(32.14%)	81	637081:637095	677420:677434
AVD86176.1|628668_629100_-	muraminidase	NA	A0A0S2SYD0	Pseudomonas_phage	77.3	3.1e-57
AVD86177.1|629098_630382_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86178.1|630378_631203_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86179.1|631218_632688_-	hypothetical protein	NA	A0A2I7QLN8	Vibrio_phage	37.2	5.6e-26
AVD86180.1|632838_633693_-	hypothetical protein	NA	A0A2H4N7B0	Pectobacterium_phage	58.2	1.9e-21
AVD86181.1|633694_634336_-	hypothetical protein	NA	N0DSE2	Edwardsiella_phage	61.0	2.6e-68
AVD86182.1|634332_635550_-	hypothetical protein	NA	A0A291LBS4	Klebsiella_phage	64.8	2.1e-143
AVD86183.1|635542_635890_-	hypothetical protein	NA	N0DP77	Edwardsiella_phage	71.9	1.3e-37
AVD86184.1|635886_636543_-	hypothetical protein	NA	A0A2H4N7C1	Pectobacterium_phage	58.0	2.0e-63
AVD86185.1|636553_637969_-	hypothetical protein	NA	N0DQR5	Edwardsiella_phage	44.2	1.5e-108
637081:637095	attL	ACACCGGCGGCTTCG	NA	NA	NA	NA
AVD86186.1|637971_638274_-	hypothetical protein	NA	L0MZ23	Edwardsiella_phage	68.8	2.6e-34
AVD86187.1|638273_638933_-	hypothetical protein	NA	L0MX82	Edwardsiella_phage	57.3	3.7e-62
AVD86188.1|638935_640279_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86189.1|640439_640841_-	hypothetical protein	NA	N0DSC4	Edwardsiella_phage	48.3	2.7e-23
AVD86190.1|640844_641252_-	hypothetical protein	NA	B5AX66	Iodobacteriophage	76.3	1.6e-55
AVD86191.1|641264_642407_-	hypothetical protein	NA	L0MYG2	Edwardsiella_phage	67.0	1.4e-141
AVD86192.1|642425_642971_-	hypothetical protein	NA	B5AX63	Iodobacteriophage	58.5	1.6e-50
AVD86193.1|642967_643336_-	hypothetical protein	NA	A0A2H4N7F0	Pectobacterium_phage	58.1	2.2e-35
AVD86194.1|643332_643932_-	hypothetical protein	NA	L0MXE9	Edwardsiella_phage	59.2	3.9e-58
AVD86195.1|643931_644351_-	DUF4054 domain-containing protein	NA	L0MXZ2	Edwardsiella_phage	61.4	3.2e-43
AVD86196.1|644396_644714_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86197.1|644779_645811_-	hypothetical protein	NA	H9C0E5	Vibrio_phage	71.2	1.5e-129
AVD86198.1|645814_646309_-	hypothetical protein	NA	H9C117	Vibrio_phage	59.3	2.1e-41
AVD86199.1|646311_647475_-	hypothetical protein	NA	L0MX79	Edwardsiella_phage	56.7	1.0e-94
AVD86200.1|647499_648315_-|head	phage head morphogenesis protein	head	B5AX44	Iodobacteriophage	55.1	1.0e-77
AVD86201.1|648436_649825_-	hypothetical protein	NA	A0A1I9SES0	Klebsiella_phage	67.8	2.2e-165
AVD86202.1|649840_651391_-|terminase	terminase	terminase	E5AGA3	Erwinia_phage	47.2	4.6e-135
AVD86203.1|651390_651864_-	hypothetical protein	NA	A0A125RNL6	Pseudomonas_phage	68.5	1.2e-46
AVD86204.1|651895_652507_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	71.4	2.9e-85
AVD86205.1|652527_652743_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86206.1|652802_653039_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86207.1|653076_653346_-	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	58.8	1.1e-17
AVD86208.1|653345_653657_-	peptidase M48, Ste24p	NA	A0A1B0VME9	Pseudomonas_phage	50.5	6.5e-17
AVD86209.1|653798_654389_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	58.8	6.5e-66
AVD86210.1|654504_655107_-	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	56.3	2.4e-55
AVD86211.1|655097_655397_-	LuxR family transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	44.4	1.8e-08
AVD86212.1|655393_655864_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	66.0	1.2e-59
AVD86213.1|656015_656777_-	Replication protein P	NA	A0A2D1GNB3	Pseudomonas_phage	60.8	3.5e-72
AVD86214.1|656773_657550_-	hypothetical protein	NA	A0A2D1GNQ6	Pseudomonas_phage	49.6	1.9e-25
AVD86215.1|657546_658284_-	phage antirepressor protein	NA	A0A059VF66	Pseudomonas_phage	74.7	1.0e-100
AVD86216.1|658428_658668_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86217.1|658828_659023_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86218.1|659054_659261_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86219.1|659279_659480_-	hypothetical protein	NA	A0A2H4J115	uncultured_Caudovirales_phage	59.4	6.3e-13
AVD86220.1|659510_659726_-	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	53.5	1.0e-13
AVD86221.1|659829_660636_+	XRE family transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	49.3	6.8e-66
AVD86222.1|660638_660869_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86223.1|660923_661259_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86224.1|661412_661796_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86225.1|661859_662441_-	hypothetical protein	NA	NA	NA	NA	NA
AVD86226.1|662527_662854_-	hypothetical protein	NA	A0A2D1GND3	Pseudomonas_phage	66.7	1.2e-29
AVD86227.1|663309_663627_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86228.1|663656_663869_+	hypothetical protein	NA	A0A2H4JGV5	uncultured_Caudovirales_phage	63.6	1.7e-16
AVD86229.1|663914_664133_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86230.1|664601_664964_+	hypothetical protein	NA	A0A2H4JGG9	uncultured_Caudovirales_phage	73.4	1.6e-19
AVD86231.1|664960_665221_+	hypothetical protein	NA	A0A0S2SY95	Pseudomonas_phage	58.1	3.5e-24
AVD86232.1|665241_665655_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86233.1|665651_665846_+	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	59.7	1.1e-14
AVD86234.1|665842_666058_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86235.1|666054_666258_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86236.1|666542_667274_+	hypothetical protein	NA	A0A2H4J2D5	uncultured_Caudovirales_phage	85.6	2.7e-114
AVD86237.1|667270_667834_+	hypothetical protein	NA	A0A2H4IZG3	uncultured_Caudovirales_phage	95.2	3.5e-93
AVD86238.1|667841_668354_+	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	33.7	4.0e-11
AVD86239.1|668357_668552_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86240.1|668593_668941_+	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	83.5	2.4e-44
AVD86241.1|668915_669278_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	48.9	1.1e-12
AVD86242.1|669346_670057_+	HNH endonuclease	NA	A0A1S5SDS7	Streptococcus_phage	28.6	3.6e-18
AVD86243.1|670049_670271_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86244.1|670283_671024_+	hypothetical protein	NA	A0A2L0V0X4	Agrobacterium_phage	42.6	1.5e-06
AVD86245.1|671114_671303_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86246.1|671299_671521_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	56.3	1.0e-11
AVD86247.1|671517_671730_+	hypothetical protein	NA	NA	NA	NA	NA
AVD90735.1|671735_672134_+	hypothetical protein	NA	J7I4M3	Pseudomonas_phage	34.7	4.9e-09
AVD86248.1|672130_672484_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86249.1|672530_672842_+	hypothetical protein	NA	NA	NA	NA	NA
AVD86250.1|672893_673391_+	hypothetical protein	NA	A0A1B0VM52	Pseudomonas_phage	61.5	2.0e-36
AVD86251.1|673428_674163_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	63.7	1.5e-88
AVD86252.1|674364_674646_+	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	78.7	1.3e-32
AVD86253.1|674614_675757_-|integrase	integrase	integrase	L7TP61	Pseudomonas_virus	75.5	8.2e-166
AVD90736.1|675890_676865_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVD86254.1|677084_678011_+	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	35.4	1.1e-11
677420:677434	attR	CGAAGCCGCCGGTGT	NA	NA	NA	NA
>prophage 3
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	2726111	2823272	5919083	capsid,terminase,integrase,transposase,portal,tail,holin,head,protease	uncultured_Caudovirales_phage(27.27%)	100	2785295:2785341	2801232:2801278
AVD87983.1|2726111_2728115_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.0	1.3e-20
AVD87984.1|2728177_2729011_-	taurine dioxygenase	NA	NA	NA	NA	NA
AVD87985.1|2729058_2729889_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
AVD87986.1|2729885_2730680_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	36.8	1.8e-31
AVD87987.1|2730704_2731676_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD87988.1|2732177_2733518_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVD87989.1|2733681_2734320_+	peroxiredoxin	NA	NA	NA	NA	NA
AVD87990.1|2734780_2735374_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AVD87991.1|2735467_2736433_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD87992.1|2736492_2737641_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AVD87993.1|2737651_2738449_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AVD87994.1|2738445_2739258_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	9.7e-28
AVD87995.1|2739289_2739505_+	transporter	NA	NA	NA	NA	NA
AVD87996.1|2739543_2740176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVD87997.1|2740175_2741768_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVD87998.1|2741949_2742333_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AVD87999.1|2742332_2744660_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AVD88000.1|2744889_2745630_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.7	3.5e-32
AVD88001.1|2745751_2747065_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	4.7e-08
AVD88002.1|2747190_2748096_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.6e-39
AVD88003.1|2748092_2748575_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
AVD88004.1|2748684_2749086_+	RNA-binding protein	NA	NA	NA	NA	NA
AVD88005.1|2749185_2749980_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVD88006.1|2750091_2750991_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AVD88007.1|2751170_2752718_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	46.7	1.0e-126
AVD88008.1|2752944_2753385_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVD88009.1|2753441_2753921_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88010.1|2754159_2756505_-	CbbBc protein	NA	NA	NA	NA	NA
AVD88011.1|2756510_2757341_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
AVD88012.1|2757515_2757956_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	45.9	2.8e-05
AVD88013.1|2758019_2758682_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
AVD88014.1|2758746_2759313_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AVD88015.1|2759309_2760137_+	3'(2'),5'-bisphosphate nucleotidase	NA	NA	NA	NA	NA
AVD88016.1|2760179_2760635_-	thioesterase	NA	NA	NA	NA	NA
AVD88017.1|2760631_2762041_-	Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	29.5	4.6e-09
AVD88018.1|2762037_2763852_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVD88019.1|2763932_2764478_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	5.5e-51
AVD88020.1|2764876_2765983_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.0	3.9e-104
AVD88021.1|2766169_2766367_+	hypothetical protein	NA	NA	NA	NA	NA
AVD88022.1|2766809_2768132_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVD88023.1|2768160_2769831_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AVD88024.1|2769978_2771355_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AVD88025.1|2771347_2772067_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.8e-30
AVD90804.1|2772223_2774503_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVD88026.1|2774842_2775082_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	82.3	1.2e-29
AVD88027.1|2775071_2775371_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	81.9	6.1e-36
AVD88028.1|2775492_2776348_+|transposase	DDE transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.8	8.1e-17
AVD88029.1|2776902_2777241_+	hypothetical protein	NA	NA	NA	NA	NA
AVD88030.1|2777230_2778319_+	hypothetical protein	NA	A0A075BTZ7	Microcystis_phage	38.6	3.6e-09
AVD90805.1|2778319_2779222_-	hypothetical protein	NA	NA	NA	NA	NA
AVD90806.1|2779241_2780030_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88031.1|2780091_2781057_-	thymidylate synthase	NA	A0A1G5SB41	Enterococcus_phage	33.0	4.8e-26
AVD88032.1|2781070_2781373_-	DUF4031 domain-containing protein	NA	A0A0M7QF68	Escherichia_phage	38.6	9.8e-10
AVD88033.1|2781704_2781980_-	hypothetical protein	NA	NA	NA	NA	NA
AVD90807.1|2781976_2782957_-|integrase	integrase	integrase	NA	NA	NA	NA
AVD88034.1|2783887_2784229_-|integrase	integrase	integrase	G8DCP8	Silicibacter_phage	42.2	3.2e-09
AVD88035.1|2784360_2784711_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVD88036.1|2784707_2785031_-	transcriptional regulator	NA	NA	NA	NA	NA
2785295:2785341	attL	TATGGTGCCGGCACCAGGAATCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
AVD88037.1|2785439_2786615_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.5	6.9e-75
AVD88038.1|2786611_2786824_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88039.1|2787030_2787585_-	hypothetical protein	NA	W8VMA8	Pseudomonas_phage	39.6	1.3e-23
AVD88040.1|2787581_2787833_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88041.1|2787829_2788243_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVD88042.1|2788239_2788524_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88043.1|2788590_2788884_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88044.1|2788897_2791633_-	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	63.4	0.0e+00
AVD88045.1|2791777_2792506_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88046.1|2792502_2793336_-	peptidoglycan-binding protein	NA	Q9ZXL6	Pseudomonas_virus	61.6	2.5e-87
AVD88047.1|2793332_2793647_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	53.0	1.4e-22
AVD88048.1|2793683_2793896_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	76.9	9.3e-23
AVD88049.1|2793895_2794372_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	57.6	2.1e-43
AVD88050.1|2794469_2795171_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	60.6	7.2e-64
AVD88051.1|2795174_2796245_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	72.8	3.6e-139
AVD88052.1|2796278_2797127_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	59.9	1.2e-84
AVD90808.1|2797279_2799031_+|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	79.9	2.7e-269
AVD88053.1|2799030_2800074_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	77.9	2.0e-155
AVD88054.1|2800107_2800509_-	hypothetical protein	NA	NA	NA	NA	NA
AVD90809.1|2801407_2801656_-	hypothetical protein	NA	NA	NA	NA	NA
2801232:2801278	attR	TATGGTGCCGGCACCAGGAATCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
AVD88055.1|2802172_2802439_+	hypothetical protein	NA	NA	NA	NA	NA
AVD88056.1|2802444_2802717_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
AVD90810.1|2803044_2804250_-	methyltransferase	NA	NA	NA	NA	NA
AVD88057.1|2804322_2805012_-	ABC transporter permease	NA	NA	NA	NA	NA
AVD88058.1|2805011_2805704_-	ABC transporter permease	NA	NA	NA	NA	NA
AVD88059.1|2805759_2806512_-	amino acid ABC transporter	NA	NA	NA	NA	NA
AVD88060.1|2806523_2807297_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	2.9e-21
AVD88061.1|2807903_2809292_+	GABA permease	NA	NA	NA	NA	NA
AVD88062.1|2809434_2809878_-	hypothetical protein	NA	NA	NA	NA	NA
AVD88063.1|2809931_2810921_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
AVD88064.1|2811317_2811590_-	oxidative damage protection protein	NA	NA	NA	NA	NA
AVD88065.1|2811586_2812654_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
AVD88066.1|2812650_2814888_-	AsmA family protein	NA	NA	NA	NA	NA
AVD88067.1|2815209_2816868_+	MFS transporter	NA	NA	NA	NA	NA
AVD90811.1|2817082_2817676_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
AVD88068.1|2817676_2818315_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AVD88069.1|2818315_2818576_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
AVD88070.1|2818603_2819341_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AVD88071.1|2819351_2820122_+	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AVD88072.1|2820218_2821397_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.2	3.2e-24
AVD88073.1|2821393_2822239_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
AVD88074.1|2822324_2823272_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	4639247	4647731	5919083		uncultured_Caudovirales_phage(37.5%)	14	NA	NA
AVD89606.1|4639247_4640735_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	48.4	8.9e-104
AVD89607.1|4640868_4641951_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89608.1|4642344_4642524_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89609.1|4642597_4642894_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89610.1|4642971_4643220_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89611.1|4643260_4643674_-	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	59.5	1.8e-38
AVD89612.1|4643872_4644271_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89613.1|4644286_4644598_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	52.0	5.7e-21
AVD89614.1|4644572_4644920_-	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	83.5	6.3e-45
AVD89615.1|4644961_4645156_-	hypothetical protein	NA	NA	NA	NA	NA
AVD89616.1|4645158_4645698_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	52.0	8.4e-44
AVD89617.1|4645706_4646378_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	71.3	2.0e-95
AVD89618.1|4646374_4647241_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	60.6	6.2e-73
AVD89619.1|4647515_4647731_-	hypothetical protein	NA	A0A2H4J1S2	uncultured_Caudovirales_phage	56.9	6.7e-13
>prophage 5
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	4652056	4686106	5919083	transposase,terminase,tail	Pseudomonas_phage(64.1%)	50	NA	NA
AVD90882.1|4652056_4652722_-	phage repressor protein	NA	A0A2H4J868	uncultured_Caudovirales_phage	63.6	8.2e-49
AVD89626.1|4652810_4653020_+	Rha family transcriptional regulator	NA	H2BD64	Pseudomonas_phage	71.6	5.5e-20
AVD89627.1|4653052_4653253_+	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	97.0	3.7e-29
AVD89628.1|4653272_4653485_+	hypothetical protein	NA	A0A2H4J8V2	uncultured_Caudovirales_phage	70.6	1.1e-18
AVD89629.1|4653543_4653750_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89630.1|4653769_4653979_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89631.1|4654052_4654304_+	hypothetical protein	NA	H2BD65	Pseudomonas_phage	63.3	8.1e-18
AVD89632.1|4654585_4655440_+	transporter	NA	F1C5A3	Cronobacter_phage	42.1	7.8e-36
AVD89633.1|4655436_4655688_+	hypothetical protein	NA	F8TVH0	EBPR_siphovirus	52.9	1.4e-14
AVD89634.1|4655684_4656161_+	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	60.4	5.9e-25
AVD89635.1|4656157_4656937_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	64.4	1.1e-44
AVD89636.1|4656933_4657695_+	Replication protein P	NA	A0A2D1GNB3	Pseudomonas_phage	64.1	1.9e-73
AVD89637.1|4657846_4658317_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	66.0	9.5e-60
AVD89638.1|4658313_4658637_+	hypothetical protein	NA	A0A2H4J249	uncultured_Caudovirales_phage	45.9	6.4e-15
AVD89639.1|4658627_4659230_+	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	55.8	1.0e-53
AVD89640.1|4659226_4659493_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89641.1|4659608_4660289_+	hypothetical protein	NA	A0A2H4IZI6	uncultured_Caudovirales_phage	98.7	2.5e-109
AVD89642.1|4660827_4661139_+	peptidase M48, Ste24p	NA	A0A1B0VME9	Pseudomonas_phage	52.3	2.2e-17
AVD89643.1|4661138_4661408_+	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	58.8	1.1e-17
AVD89644.1|4661445_4661682_-	hypothetical protein	NA	NA	NA	NA	NA
AVD89645.1|4661741_4661957_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89646.1|4661977_4662589_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	71.4	1.7e-85
AVD89647.1|4662619_4663096_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	82.9	3.5e-70
AVD89648.1|4663070_4664390_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	93.6	5.3e-249
AVD89649.1|4664386_4665799_+	DNA-binding protein	NA	A0A0H5AWC7	Pseudomonas_phage	64.6	7.8e-174
AVD89650.1|4665798_4666875_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	52.4	1.2e-97
AVD89651.1|4667026_4667773_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	77.2	3.5e-93
AVD89652.1|4667782_4668751_+	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	79.8	1.1e-142
AVD89653.1|4668792_4669089_+	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	53.3	1.0e-06
AVD89654.1|4669088_4669460_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	56.7	6.8e-29
AVD89655.1|4669461_4669845_+	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	47.6	2.1e-25
AVD89656.1|4669847_4670237_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	52.4	3.8e-30
AVD89657.1|4670233_4670641_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVD89658.1|4670640_4670832_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89659.1|4670897_4672067_+	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	40.1	5.4e-56
AVD89660.1|4672124_4672568_+	hypothetical protein	NA	NA	NA	NA	NA
AVD90883.1|4672735_4672930_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89661.1|4672944_4675809_+|tail	tail length tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.8	2.9e-95
AVD89662.1|4675805_4676261_+|transposase	transposase	transposase	B5WZT5	Pseudomonas_phage	45.5	5.1e-34
AVD89663.1|4676257_4676764_+	hypothetical protein	NA	B5WZT6	Pseudomonas_phage	47.5	4.5e-39
AVD89664.1|4676773_4677169_+	hypothetical protein	NA	A0A2H4PI57	Pseudomonas_phage	58.0	2.3e-38
AVD89665.1|4677165_4679877_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	55.7	2.0e-287
AVD89666.1|4679935_4681726_+	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	45.7	2.2e-40
AVD89667.1|4681792_4683736_-	hypothetical protein	NA	B5WZU0	Pseudomonas_phage	36.3	5.9e-55
AVD89668.1|4684022_4684208_+	hypothetical protein	NA	NA	NA	NA	NA
AVD89669.1|4684265_4684709_+	structural protein P5	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	52.3	3.8e-34
AVD89670.1|4684705_4685239_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AVD89671.1|4685281_4685506_+	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	82.4	1.3e-27
AVD89672.1|4685586_4685895_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	72.2	2.4e-35
AVD89673.1|4685884_4686106_+	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	49.3	3.0e-08
>prophage 6
CP026674	Pseudomonas sp. SWI44 chromosome, complete genome	5919083	4757372	4766859	5919083	tRNA	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
AVD89740.1|4757372_4758653_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	4.2e-94
AVD89741.1|4758653_4760045_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVD89742.1|4760077_4761037_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
AVD89743.1|4761131_4762148_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	78.5	2.4e-153
AVD89744.1|4762144_4762480_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	4.4e-43
AVD89745.1|4762476_4762773_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	64.6	3.0e-27
AVD89746.1|4762772_4763132_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.0	2.5e-36
AVD89747.1|4763133_4763526_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.1	1.9e-53
AVD89748.1|4763609_4763858_-	hypothetical protein	NA	NA	NA	NA	NA
AVD89749.1|4763850_4764633_-	ABC transporter	NA	NA	NA	NA	NA
AVD89750.1|4764799_4765507_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVD89751.1|4765572_4766859_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	22.8	2.5e-09
