The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	0	35453	5883411		Amsacta_moorei_entomopoxvirus(100.0%)	40	NA	NA
AVE75734.1|1079_2159_+	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
AVE75735.1|2905_3772_-	GHMP kinase	NA	NA	NA	NA	NA
AVE75736.1|3936_5151_-	acetate kinase	NA	NA	NA	NA	NA
AVE75737.1|5135_5588_-	ethanolamine utilization protein EutP	NA	NA	NA	NA	NA
AVE75738.1|5592_5943_-	propanediol utilization protein PduU	NA	NA	NA	NA	NA
AVE75739.1|5942_6497_-	propanediol utilization protein	NA	NA	NA	NA	NA
AVE75740.1|6499_7855_-	electron transport complex protein RnfC	NA	NA	NA	NA	NA
AVE75741.1|7851_8964_-	propanediol utilization protein	NA	NA	NA	NA	NA
AVE75742.1|8975_10367_-	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
AVE75743.1|10363_11374_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AVE75744.1|11383_11659_-	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AVE75745.1|11662_12154_-	microcompartment protein PduM	NA	NA	NA	NA	NA
AVE75746.1|12150_12783_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
AVE75747.1|12782_13265_-	BMC domain-containing protein	NA	NA	NA	NA	NA
AVE75748.1|13268_13544_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
AVE75749.1|13536_13914_-	propanediol dehydratase	NA	NA	NA	NA	NA
AVE75750.1|13903_15736_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AVE75751.1|15872_16394_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AVE75752.1|16408_17083_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
AVE75753.1|17093_18758_-	propanediol dehydratase	NA	NA	NA	NA	NA
AVE75754.1|18776_19589_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
AVE75755.1|19585_19870_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
AVE75756.1|20394_21195_+	propanediol diffusion facilitator PduF	NA	NA	NA	NA	NA
AVE75757.1|21383_22295_+	regulatory protein PocR	NA	NA	NA	NA	NA
AVE75758.1|22851_24231_+	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AVE75759.1|24227_25187_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AVE75760.1|25197_25830_+	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
AVE75761.1|25826_26966_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
AVE75762.1|26959_27565_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
AVE75763.1|27554_28124_+	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
AVE75764.1|28116_28890_+	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
AVE75765.1|28870_29926_+	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
AVE75766.1|29925_30651_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
AVE75767.1|30647_31433_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
AVE75768.1|31443_32238_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
AVE75769.1|32234_32948_+	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
AVE75770.1|32944_33682_+	cobalt ECF transporter S component CbiM	NA	NA	NA	NA	NA
AVE75771.1|33683_33965_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE75772.1|33951_34629_+	energy-coupling factor ABC transporter transmembrane protein	NA	NA	NA	NA	NA
AVE75773.1|34637_35453_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.6	2.5e-07
>prophage 2
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	40486	43061	5883411	tRNA	Pandoravirus(50.0%)	3	NA	NA
AVE75778.1|40486_41296_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
AVE75779.1|41418_41856_-	cysteine desulfurase, sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVE75780.1|41855_43061_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
>prophage 3
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	53594	54350	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE75790.1|53594_54350_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 4
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	66749	67595	5883411		Vibrio_phage(100.0%)	1	NA	NA
AVE75799.1|66749_67595_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 5
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	75036	80445	5883411		Streptococcus_phage(33.33%)	3	NA	NA
AVE75807.1|75036_76176_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
AVE75808.1|76225_78979_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	2.0e-48
AVE75809.1|79101_80445_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
>prophage 6
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	83867	89192	5883411		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
AVE75812.1|83867_85505_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
AVE75813.1|85585_86884_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	3.7e-130
AVE75814.1|86950_88060_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AVE80865.1|88520_89192_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
>prophage 7
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	107694	109727	5883411		Hokovirus(50.0%)	2	NA	NA
AVE75830.1|107694_109122_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
AVE75831.1|109121_109727_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
>prophage 8
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	112800	116575	5883411		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVE75837.1|112800_113562_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.9e-58
AVE75838.1|113555_114182_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
AVE75839.1|114304_115423_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
AVE75840.1|115582_116575_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 9
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	122684	125246	5883411		Catovirus(100.0%)	1	NA	NA
AVE75848.1|122684_125246_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	4.0e-27
>prophage 10
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	135414	140626	5883411		Planktothrix_phage(66.67%)	3	NA	NA
AVE75860.1|135414_137526_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	6.9e-17
AVE75861.1|137522_138683_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVE75862.1|138682_140626_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
>prophage 11
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	153457	156788	5883411		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
AVE75876.1|153457_154225_-	gluconate 5-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.1e-20
AVE75877.1|154563_155817_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.9	1.0e-44
AVE75878.1|156008_156788_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
>prophage 12
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	164757	165579	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVE75887.1|164757_165579_-	manganese/iron transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 13
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	205632	206598	5883411		Tetraselmis_virus(100.0%)	1	NA	NA
AVE75924.1|205632_206598_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 14
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	212207	220491	5883411	tRNA	Staphylococcus_phage(20.0%)	9	NA	NA
AVE75933.1|212207_212885_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.5e-07
AVE75934.1|212881_213745_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVE80870.1|213753_214632_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE75935.1|214668_214896_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75936.1|215100_215598_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
AVE75937.1|215678_216737_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
AVE75938.1|216808_217309_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVE75939.1|217439_220067_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
AVE75940.1|220305_220491_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 15
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	235420	240711	5883411		Bacillus_virus(25.0%)	5	NA	NA
AVE75955.1|235420_236623_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
AVE75956.1|236968_237931_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	2.5e-131
AVE75957.1|237941_240086_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
AVE75958.1|240058_240469_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AVE75959.1|240465_240711_-	NrdH-redoxin	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
>prophage 16
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	256014	259500	5883411		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
AVE75976.1|256014_256809_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	29.3	3.5e-06
AVE75977.1|256844_257618_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE75978.1|257657_258578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE75979.1|258723_259500_+	NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
>prophage 17
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	262564	263206	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE80872.1|262564_263206_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	26.8	5.9e-12
>prophage 18
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	270578	272099	5883411		Pithovirus(100.0%)	1	NA	NA
AVE75990.1|270578_272099_-	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 19
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	285560	286154	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE76002.1|285560_286154_-	hypothetical protein	NA	O21975	Escherichia_phage	55.2	5.9e-59
>prophage 20
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	304868	307305	5883411	integrase	Escherichia_phage(50.0%)	2	287525:287539	311946:311960
287525:287539	attL	CCATTGCGATGGTTG	NA	NA	NA	NA
AVE76011.1|304868_306110_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	1.1e-99
AVE76012.1|306822_307305_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
311946:311960	attR	CCATTGCGATGGTTG	NA	NA	NA	NA
>prophage 21
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	322568	323639	5883411		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVE76031.1|322568_323639_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
>prophage 22
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	330442	333016	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE76038.1|330442_333016_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	1.2e-127
>prophage 23
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	338845	340873	5883411		Synechococcus_phage(50.0%)	2	NA	NA
AVE80878.1|338845_339301_+	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.0	2.8e-32
AVE76039.1|339574_340873_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
>prophage 24
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	346172	350693	5883411	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
AVE76044.1|346172_346598_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
AVE76045.1|346801_347875_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVE76046.1|347930_348620_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
AVE76047.1|348932_349316_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
AVE76048.1|349361_350693_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
>prophage 25
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	356470	360167	5883411		Streptococcus_phage(50.0%)	4	NA	NA
AVE76055.1|356470_358270_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
AVE76056.1|358285_359260_+	signal peptidase I	NA	NA	NA	NA	NA
AVE76057.1|359312_359543_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76058.1|359486_360167_+	ribonuclease 3	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
>prophage 26
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	363174	378807	5883411	tRNA	Bacillus_phage(33.33%)	13	NA	NA
AVE76063.1|363174_363435_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
AVE76064.1|363601_364450_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVE76065.1|364658_365294_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVE76066.1|365313_365859_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
AVE76067.1|365855_367472_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AVE80881.1|367646_371534_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.7e-130
AVE80882.1|372096_373533_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	1.3e-11
AVE76068.1|373546_374251_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVE76069.1|374237_375575_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
AVE76070.1|375640_375979_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVE76071.1|376037_377228_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVE76072.1|377172_377352_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76073.1|377553_378807_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	2.5e-99
>prophage 27
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	393130	399489	5883411		Faustovirus(20.0%)	8	NA	NA
AVE76084.1|393130_394345_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
AVE76085.1|394371_394758_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AVE76086.1|394777_395101_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AVE76087.1|395174_395690_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVE76088.1|395705_397556_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	2.5e-103
AVE76089.1|397557_397893_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVE76090.1|397894_398095_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVE76091.1|398202_399489_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
>prophage 28
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	411660	412092	5883411		Powai_lake_megavirus(100.0%)	1	NA	NA
AVE80884.1|411660_412092_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 29
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	423641	426643	5883411		Bodo_saltans_virus(50.0%)	2	NA	NA
AVE76111.1|423641_425018_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
AVE76112.1|425176_426643_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
>prophage 30
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	430623	430833	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE76116.1|430623_430833_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	73.9	2.5e-20
>prophage 31
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	443255	444931	5883411		Prochlorococcus_phage(100.0%)	2	NA	NA
AVE76124.1|443255_443897_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
AVE76125.1|443893_444931_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
>prophage 32
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	448434	449724	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE76129.1|448434_449724_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	7.1e-65
>prophage 33
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	456990	458691	5883411		Cyanophage(50.0%)	2	NA	NA
AVE76138.1|456990_457704_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
AVE76139.1|457824_458691_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
>prophage 34
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	492420	501013	5883411		Paenibacillus_phage(25.0%)	11	NA	NA
AVE76166.1|492420_493296_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
AVE76167.1|493288_493486_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76168.1|493507_493933_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVE76169.1|493919_494369_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76170.1|494432_495008_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVE76171.1|495101_496001_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
AVE76172.1|496226_497243_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE76173.1|497242_498076_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AVE76174.1|498075_498951_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AVE76175.1|498940_500035_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
AVE80891.1|500101_501013_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.7e-57
>prophage 35
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	505261	515196	5883411		Hokovirus(25.0%)	9	NA	NA
AVE76182.1|505261_506989_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
AVE76183.1|507033_507291_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVE76184.1|507672_508644_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.5e-75
AVE76185.1|508803_509565_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVE80892.1|509798_510794_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVE76186.1|510868_512893_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.4	1.2e-146
AVE76187.1|512885_513104_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76188.1|513100_514099_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVE76189.1|514188_515196_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	9.6e-09
>prophage 36
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	533037	533781	5883411		Clostridioides_phage(100.0%)	1	NA	NA
AVE80893.1|533037_533781_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	1.6e-13
>prophage 37
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	538942	543899	5883411		Lactobacillus_phage(33.33%)	5	NA	NA
AVE76206.1|538942_539875_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	8.0e-10
AVE76207.1|540055_540919_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.2	4.5e-07
AVE76208.1|541514_541769_-	late histone H1	NA	NA	NA	NA	NA
AVE76209.1|542439_542775_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVE76210.1|543002_543899_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
>prophage 38
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	553018	554107	5883411		Pandoravirus(100.0%)	1	NA	NA
AVE76218.1|553018_554107_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 39
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	562519	563656	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVE76226.1|562519_563656_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 40
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	570078	571596	5883411		Mollivirus(100.0%)	1	NA	NA
AVE76234.1|570078_571596_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 41
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	575889	578094	5883411		Salmonella_phage(66.67%)	4	NA	NA
AVE76241.1|575889_576663_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
AVE80897.1|576704_577202_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVE76242.1|577269_577836_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	58.3	7.2e-46
AVE76243.1|577839_578094_-	hypothetical protein	NA	J9Q735	Salmonella_phage	43.4	4.1e-09
>prophage 42
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	582359	583379	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE76250.1|582359_583379_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	7.9e-19
>prophage 43
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	595195	595795	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE76261.1|595195_595795_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 44
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	614934	615486	5883411	integrase	Escherichia_phage(100.0%)	1	608558:608571	616237:616250
608558:608571	attL	AACGTCAGGATCTG	NA	NA	NA	NA
AVE76278.1|614934_615486_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
AVE76278.1|614934_615486_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
616237:616250	attR	CAGATCCTGACGTT	NA	NA	NA	NA
>prophage 45
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	637063	639541	5883411	transposase	Sodalis_phage(50.0%)	2	NA	NA
AVE76300.1|637063_638044_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.3	5.4e-73
AVE76301.1|638092_639541_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
>prophage 46
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	642646	643852	5883411		Oenococcus_phage(100.0%)	1	NA	NA
AVE76305.1|642646_643852_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
>prophage 47
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	651708	663493	5883411		Pseudomonas_phage(33.33%)	7	NA	NA
AVE76311.1|651708_652779_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
AVE76312.1|652850_653105_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
AVE76313.1|653104_654235_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
AVE76314.1|654338_656624_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
AVE76315.1|656968_657697_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVE76316.1|657882_660516_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
AVE76317.1|660646_663493_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	1.9e-41
>prophage 48
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	667637	676215	5883411		Enterobacteria_phage(25.0%)	7	NA	NA
AVE76320.1|667637_668738_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.2e-118
AVE76321.1|668840_669893_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVE76322.1|669965_671030_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
AVE76323.1|671029_671680_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AVE76324.1|671756_673400_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.3	3.2e-09
AVE76325.1|673568_675005_+	magnesium transporter	NA	NA	NA	NA	NA
AVE76326.1|674967_676215_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
>prophage 49
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	687262	689773	5883411		Ralstonia_phage(100.0%)	1	NA	NA
AVE76335.1|687262_689773_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.0	7.9e-20
>prophage 50
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	703371	712431	5883411		Vibrio_phage(50.0%)	9	NA	NA
AVE76347.1|703371_704379_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
AVE76348.1|704428_705187_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVE76349.1|705267_705861_+	GDP-mannose pyrophosphatase	NA	NA	NA	NA	NA
AVE76350.1|705922_706207_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVE76351.1|706344_708102_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.2	2.2e-101
AVE76352.1|708250_708970_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVE76353.1|708966_710163_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
AVE76354.1|710493_710838_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76355.1|710841_712431_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.1	4.0e-17
>prophage 51
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	718190	722498	5883411		Clostridioides_phage(50.0%)	4	NA	NA
AVE76359.1|718190_718760_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
AVE76360.1|719186_719894_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76361.1|719935_720913_-	GTP-binding protein	NA	NA	NA	NA	NA
AVE76362.1|721031_722498_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	1.7e-43
>prophage 52
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	733723	734581	5883411		Catovirus(100.0%)	1	NA	NA
AVE76372.1|733723_734581_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	9.0e-24
>prophage 53
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	738699	742666	5883411		Acinetobacter_phage(50.0%)	3	NA	NA
AVE76377.1|738699_740673_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
AVE76378.1|740792_741629_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVE76379.1|741997_742666_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
>prophage 54
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	746424	747945	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVE76383.1|746424_747945_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 55
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	763854	764589	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE76399.1|763854_764589_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	1.3e-50
>prophage 56
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	768784	769339	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVE76404.1|768784_769339_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	5.1e-20
>prophage 57
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	775912	784863	5883411	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
AVE76409.1|775912_776860_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
AVE76410.1|776843_777581_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVE76411.1|777555_777669_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76412.1|778167_778926_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.3	3.1e-76
AVE76413.1|779136_780825_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
AVE76414.1|780818_781538_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVE76415.1|781591_782059_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
AVE76416.1|782162_782630_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AVE76417.1|782829_784863_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	1.4e-54
>prophage 58
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	793202	795179	5883411		Tetraselmis_virus(100.0%)	1	NA	NA
AVE76426.1|793202_795179_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	6.8e-160
>prophage 59
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	803218	804586	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVE76433.1|803218_804586_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.5	5.6e-44
>prophage 60
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	813219	821614	5883411		Bacillus_phage(33.33%)	8	NA	NA
AVE80904.1|813219_814083_+	peptide ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	1.1e-08
AVE76441.1|814093_814867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	2.7e-27
AVE76442.1|815283_816084_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AVE76443.1|816070_816541_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76444.1|816541_817435_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
AVE76445.1|817679_819041_-	U32 family peptidase	NA	Q6DW11	Phage_TP	91.8	4.7e-200
AVE76446.1|819359_820082_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
AVE76447.1|820078_821614_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	27.6	6.3e-28
>prophage 61
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	840115	841090	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE76462.1|840115_841090_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.6e-08
>prophage 62
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	853981	860869	5883411		Catovirus(25.0%)	5	NA	NA
AVE76471.1|853981_854623_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
AVE76472.1|854713_855295_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
AVE76473.1|855322_857170_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVE76474.1|857409_858996_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.9e-36
AVE80907.1|859978_860869_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.3e-45
>prophage 63
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	876073	897818	5883411		Tupanvirus(20.0%)	16	NA	NA
AVE76486.1|876073_877492_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.4e-50
AVE76487.1|877508_878885_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	4.0e-34
AVE76488.1|878962_880105_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AVE76489.1|880213_881257_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76490.1|881367_882774_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
AVE80908.1|883144_884146_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.9	1.7e-34
AVE76491.1|884416_885583_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.1e-112
AVE76492.1|886751_887756_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
AVE76493.1|889061_889829_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE76494.1|889828_890569_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.5e-06
AVE76495.1|890582_892475_+	glycosyl transferase	NA	NA	NA	NA	NA
AVE76496.1|892493_893648_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
AVE76497.1|893644_894538_+	glycosyl transferase	NA	NA	NA	NA	NA
AVE76498.1|894550_895684_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVE76499.1|895815_897135_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
AVE76500.1|897218_897818_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
>prophage 64
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	903362	904262	5883411		Cellulophaga_phage(100.0%)	1	NA	NA
AVE80909.1|903362_904262_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 65
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	916785	918843	5883411		Faustovirus(50.0%)	2	NA	NA
AVE76520.1|916785_917988_-	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.5	4.5e-29
AVE76521.1|918018_918843_-	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
>prophage 66
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	932021	937001	5883411		Streptococcus_phage(50.0%)	3	NA	NA
AVE76532.1|932021_934124_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
AVE76533.1|934229_935654_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AVE76534.1|935828_937001_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.0	1.4e-184
>prophage 67
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	971160	976696	5883411		Caulobacter_phage(50.0%)	3	NA	NA
AVE76566.1|971160_972105_+	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	38.4	8.0e-50
AVE76567.1|972408_973188_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AVE76568.1|973171_976696_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	25.2	2.0e-16
>prophage 68
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	987114	987309	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVE76581.1|987114_987309_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	49.0	7.7e-08
>prophage 69
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	999628	1005880	5883411	integrase	Leptospira_phage(50.0%)	3	996816:996828	1007122:1007134
996816:996828	attL	GACGGCGGCTATT	NA	NA	NA	NA
AVE76592.1|999628_1002820_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.5e-63
AVE76593.1|1002816_1003986_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVE76594.1|1004629_1005880_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.8	3.3e-75
1007122:1007134	attR	GACGGCGGCTATT	NA	NA	NA	NA
>prophage 70
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1012411	1013326	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
AVE76601.1|1012411_1013326_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 71
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1016845	1019966	5883411		Vibrio_virus(50.0%)	3	NA	NA
AVE76606.1|1016845_1018252_+	hypothetical protein	NA	A2I2Y7	Vibrio_virus	67.5	3.8e-64
AVE76607.1|1018488_1019061_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVE76608.1|1019255_1019966_-	short-chain dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.1	2.0e-08
>prophage 72
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1032432	1033182	5883411	integrase	Pseudomonas_phage(100.0%)	1	1020419:1020432	1034455:1034468
1020419:1020432	attL	GCGCAGCGCCGGGT	NA	NA	NA	NA
AVE76620.1|1032432_1033182_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	6.4e-34
AVE76620.1|1032432_1033182_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	6.4e-34
1034455:1034468	attR	ACCCGGCGCTGCGC	NA	NA	NA	NA
>prophage 73
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1042437	1050288	5883411		Leptospira_phage(33.33%)	4	NA	NA
AVE76627.1|1042437_1045500_-	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	22.3	4.0e-26
AVE76628.1|1045499_1046585_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVE76629.1|1047118_1047550_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	42.8	5.0e-23
AVE76630.1|1047600_1050288_+	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	6.2e-71
>prophage 74
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1057664	1058426	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE76639.1|1057664_1058426_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.5e-30
>prophage 75
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1069002	1081179	5883411		Burkholderia_phage(28.57%)	12	NA	NA
AVE76648.1|1069002_1070460_-	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	40.7	4.5e-100
AVE76649.1|1070456_1071449_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	39.2	2.2e-50
AVE76650.1|1071445_1071835_-	GtrA family protein	NA	NA	NA	NA	NA
AVE76651.1|1072486_1073557_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
AVE76652.1|1074183_1074465_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76653.1|1074507_1075203_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
AVE80915.1|1075259_1076693_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	1.7e-96
AVE76654.1|1076673_1077168_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
AVE76655.1|1077142_1078054_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVE76656.1|1078237_1079149_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76657.1|1079224_1079404_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVE80916.1|1079511_1081179_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
>prophage 76
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1087884	1088637	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE76666.1|1087884_1088637_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 77
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1105914	1107429	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVE76683.1|1105914_1107429_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 78
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1114452	1121098	5883411	tRNA	Tupanvirus(33.33%)	7	NA	NA
AVE76691.1|1114452_1116186_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.1e-84
AVE76692.1|1116415_1116985_+	VOC family protein	NA	NA	NA	NA	NA
AVE76693.1|1117061_1117805_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVE76694.1|1118028_1119051_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVE76695.1|1119047_1119791_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
AVE76696.1|1119830_1120226_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76697.1|1120279_1121098_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	1.5e-57
>prophage 79
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1124970	1131311	5883411		Bacillus_virus(25.0%)	7	NA	NA
AVE76702.1|1124970_1125492_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVE76703.1|1125573_1126185_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVE76704.1|1126193_1127204_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
AVE76705.1|1127412_1128198_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVE76706.1|1128197_1128950_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
AVE76707.1|1129028_1129973_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE76708.1|1129988_1131311_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
>prophage 80
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1136334	1142008	5883411		Dickeya_phage(50.0%)	4	NA	NA
AVE76713.1|1136334_1137669_+	malate permease	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
AVE76714.1|1137733_1139176_-	pyruvate kinase	NA	NA	NA	NA	NA
AVE76715.1|1139301_1140171_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AVE76716.1|1140532_1142008_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
>prophage 81
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1149462	1150431	5883411		Pseudoalteromonas_phage(50.0%)	2	NA	NA
AVE76723.1|1149462_1150122_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
AVE76724.1|1150200_1150431_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
>prophage 82
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1159680	1160334	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE76733.1|1159680_1160334_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 83
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1167802	1169851	5883411		Moraxella_phage(100.0%)	1	NA	NA
AVE76740.1|1167802_1169851_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.6e-85
>prophage 84
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1175104	1175314	5883411		Morganella_phage(100.0%)	1	NA	NA
AVE76749.1|1175104_1175314_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 85
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1182750	1184310	5883411		Moraxella_phage(100.0%)	1	NA	NA
AVE76757.1|1182750_1184310_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 86
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1188154	1189510	5883411		Pandoravirus(100.0%)	1	NA	NA
AVE76761.1|1188154_1189510_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	34.5	2.5e-44
>prophage 87
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1196672	1204757	5883411	tRNA	Bacillus_phage(66.67%)	7	NA	NA
AVE76767.1|1196672_1197767_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	28.5	1.7e-14
AVE80922.1|1197774_1198914_+	alginate lyase	NA	NA	NA	NA	NA
AVE76768.1|1199084_1199429_-	RidA family protein	NA	NA	NA	NA	NA
AVE76769.1|1199561_1201472_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
AVE76770.1|1201539_1202235_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVE76771.1|1202278_1202863_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76772.1|1203071_1204757_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
>prophage 88
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1220354	1220966	5883411		Geobacillus_virus(100.0%)	1	NA	NA
AVE76788.1|1220354_1220966_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 89
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1242098	1248295	5883411		Planktothrix_phage(25.0%)	6	NA	NA
AVE80925.1|1242098_1243187_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
AVE76805.1|1243365_1244052_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
AVE76806.1|1244111_1245005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE76807.1|1245320_1246961_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.2	1.0e-132
AVE76808.1|1247194_1247689_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AVE76809.1|1247767_1248295_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	58.2	8.4e-49
>prophage 90
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1255112	1255571	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
AVE76813.1|1255112_1255571_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 91
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1258593	1260066	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE76815.1|1258593_1260066_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 92
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1278646	1279654	5883411	integrase	uncultured_Caudovirales_phage(100.0%)	1	1264840:1264859	1289093:1289112
1264840:1264859	attL	GCTGGCTTCCTGCTCGACAA	NA	NA	NA	NA
AVE76828.1|1278646_1279654_-|integrase	integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
AVE76828.1|1278646_1279654_-|integrase	integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
1289093:1289112	attR	TTGTCGAGCAGGAAGCCAGC	NA	NA	NA	NA
>prophage 93
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1283330	1286207	5883411		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVE76833.1|1283330_1285010_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	8.7e-23
AVE80928.1|1285259_1286207_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
>prophage 94
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1289420	1295126	5883411		Pseudomonas_phage(33.33%)	7	NA	NA
AVE76837.1|1289420_1290503_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
AVE76838.1|1290502_1291342_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVE76839.1|1291338_1291731_+	siroheme synthase	NA	NA	NA	NA	NA
AVE76840.1|1291734_1292547_+	hypothetical protein	NA	NA	NA	NA	NA
AVE76841.1|1292586_1293441_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
AVE76842.1|1293529_1294630_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVE76843.1|1294895_1295126_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
>prophage 95
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1300487	1301276	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE76850.1|1300487_1301276_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 96
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1317710	1327785	5883411		Escherichia_phage(20.0%)	10	NA	NA
AVE76858.1|1317710_1319246_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
AVE76859.1|1319242_1319953_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVE76860.1|1319952_1320630_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVE76861.1|1321511_1322354_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
AVE76862.1|1322396_1322855_-	hypothetical protein	NA	NA	NA	NA	NA
AVE76863.1|1322967_1323876_+	patatin family protein	NA	NA	NA	NA	NA
AVE76864.1|1323956_1324970_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
AVE76865.1|1325167_1326070_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.2	1.7e-57
AVE76866.1|1326204_1326612_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVE76867.1|1327167_1327785_+	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
>prophage 97
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1336086	1338983	5883411		Bacillus_virus(66.67%)	3	NA	NA
AVE76873.1|1336086_1337100_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G3M9Y6	Bacillus_virus	27.2	6.4e-13
AVE76874.1|1337096_1338101_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
AVE76875.1|1338146_1338983_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
>prophage 98
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1348345	1366332	5883411	tRNA	Tupanvirus(25.0%)	17	NA	NA
AVE76886.1|1348345_1350274_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
AVE76887.1|1350277_1350820_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
AVE76888.1|1350916_1351114_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVE76889.1|1351164_1351521_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVE76890.1|1351918_1352902_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
AVE76891.1|1352917_1355305_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVE76892.1|1355309_1355609_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
AVE80929.1|1355709_1356696_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AVE76893.1|1356722_1357523_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AVE76894.1|1357747_1358299_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVE76895.1|1358298_1359048_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
AVE76896.1|1359129_1359594_+	endopeptidase	NA	NA	NA	NA	NA
AVE76897.1|1359755_1361198_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	2.6e-55
AVE76898.1|1361232_1361460_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVE76899.1|1361577_1362624_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
AVE76900.1|1362777_1363611_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AVE76901.1|1363953_1366332_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
>prophage 99
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1384038	1385259	5883411		environmental_halophage(100.0%)	1	NA	NA
AVE76917.1|1384038_1385259_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	5.8e-93
>prophage 100
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1403407	1405371	5883411		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVE76936.1|1403407_1404358_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
AVE76937.1|1404354_1405371_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.0e-42
>prophage 101
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1418404	1422732	5883411		Bacillus_virus(50.0%)	3	NA	NA
AVE76949.1|1418404_1419193_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
AVE80931.1|1419331_1421404_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVE76950.1|1421910_1422732_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.3e-15
>prophage 102
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1443166	1443430	5883411		Rhizobium_phage(100.0%)	1	NA	NA
AVE76965.1|1443166_1443430_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	52.0	4.0e-07
>prophage 103
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1456047	1457118	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE76972.1|1456047_1457118_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 104
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1460544	1461417	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
AVE76976.1|1460544_1461417_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 105
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1465177	1465729	5883411	integrase	Escherichia_phage(100.0%)	1	1458239:1458253	1468473:1468487
1458239:1458253	attL	GATATGCAGGACGTT	NA	NA	NA	NA
AVE76981.1|1465177_1465729_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
AVE76981.1|1465177_1465729_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
1468473:1468487	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 106
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1471751	1477148	5883411		Escherichia_phage(33.33%)	4	NA	NA
AVE76987.1|1471751_1472300_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
AVE76988.1|1472725_1475131_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVE76989.1|1475205_1476171_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
AVE76990.1|1476167_1477148_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	4.2e-09
>prophage 107
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1482213	1486307	5883411		Escherichia_phage(50.0%)	5	NA	NA
AVE76995.1|1482213_1482984_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	5.6e-17
AVE76996.1|1482997_1483627_-	threonine transporter	NA	NA	NA	NA	NA
AVE76997.1|1483851_1484487_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVE76998.1|1484593_1485400_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVE76999.1|1485422_1486307_-	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
>prophage 108
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1500812	1509512	5883411		Orpheovirus(20.0%)	9	NA	NA
AVE77015.1|1500812_1501448_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
AVE77016.1|1501478_1502627_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	5.0e-86
AVE77017.1|1502925_1504110_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVE77018.1|1504222_1505134_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE77019.1|1505152_1506178_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
AVE77020.1|1506474_1506564_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVE77021.1|1506728_1507895_+	MFS transporter	NA	NA	NA	NA	NA
AVE77022.1|1507951_1508533_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	9.0e-44
AVE77023.1|1508657_1509512_-	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
>prophage 109
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1513670	1515148	5883411		Indivirus(50.0%)	2	NA	NA
AVE77029.1|1513670_1514567_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
AVE77030.1|1514626_1515148_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
>prophage 110
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1523788	1525063	5883411	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVE77038.1|1523788_1525063_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	7.2e-86
>prophage 111
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1536244	1537615	5883411		Pandoravirus(100.0%)	1	NA	NA
AVE77050.1|1536244_1537615_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 112
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1542972	1543176	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE77056.1|1542972_1543176_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 113
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1547104	1552926	5883411		Clostridium_phage(33.33%)	6	NA	NA
AVE77059.1|1547104_1547719_-	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	28.1	2.5e-07
AVE77060.1|1548169_1548523_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77061.1|1548828_1549437_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77062.1|1549438_1549789_-	hypothetical protein	NA	E5DSD7	Aeromonas_virus	35.2	9.0e-07
AVE80942.1|1549778_1550612_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVE77063.1|1551156_1552926_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.3	6.4e-32
>prophage 114
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1562592	1565561	5883411		Bacillus_phage(50.0%)	3	NA	NA
AVE77071.1|1562592_1563894_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
AVE77072.1|1564212_1564902_+	VIT family protein	NA	NA	NA	NA	NA
AVE77073.1|1565078_1565561_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.5	3.9e-16
>prophage 115
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1579727	1580243	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE77086.1|1579727_1580243_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 116
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1596766	1599544	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
AVE77101.1|1596766_1599544_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 117
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1610469	1611429	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE77112.1|1610469_1611429_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 118
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1618778	1620935	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77122.1|1618778_1620935_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.4	1.6e-16
>prophage 119
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1631308	1662486	5883411	integrase,holin,terminase	Klebsiella_phage(23.53%)	28	1641347:1641361	1659964:1659978
AVE77131.1|1631308_1631917_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	9.8e-25
AVE77132.1|1631957_1632815_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVE77133.1|1632816_1633434_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
AVE77134.1|1633444_1635868_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	9.7e-217
AVE77135.1|1636016_1636268_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVE77136.1|1636370_1637081_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVE77137.1|1637074_1637635_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AVE77138.1|1637697_1638039_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77139.1|1638175_1638502_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
AVE77140.1|1638708_1639923_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	9.7e-48
AVE77141.1|1639937_1640957_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE77142.1|1641000_1642377_+	MFS transporter	NA	NA	NA	NA	NA
1641347:1641361	attL	TAGCGCCGGTGTTGC	NA	NA	NA	NA
AVE80944.1|1642610_1644074_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
AVE77143.1|1644351_1644783_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
AVE77144.1|1644834_1645521_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVE77145.1|1645611_1646361_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AVE77146.1|1646532_1648575_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	19.8	1.8e-14
AVE77147.1|1648726_1649866_-|integrase	integrase	integrase	Q77Z04	Phage_21	48.2	2.1e-92
AVE77148.1|1649846_1650104_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77149.1|1650163_1650403_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	70.1	9.4e-24
AVE80945.1|1650443_1651553_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.1	2.1e-182
AVE80946.1|1653798_1654110_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.6e-47
AVE77150.1|1654106_1654649_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.2e-77
AVE77151.1|1655257_1655626_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77152.1|1656082_1656328_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	56.8	1.4e-17
AVE77153.1|1656677_1657682_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	1.2e-35
AVE77154.1|1658876_1660883_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	65.8	1.7e-44
1659964:1659978	attR	GCAACACCGGCGCTA	NA	NA	NA	NA
AVE77155.1|1661052_1662486_+	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.7	6.5e-19
>prophage 120
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1665969	1666209	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE77160.1|1665969_1666209_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	57.0	5.4e-19
>prophage 121
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1679119	1686339	5883411		Escherichia_phage(50.0%)	5	NA	NA
AVE77172.1|1679119_1679383_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
AVE77173.1|1679485_1680574_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
AVE77174.1|1680647_1681898_-	MFS transporter	NA	NA	NA	NA	NA
AVE77175.1|1681953_1685061_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.0	0.0e+00
AVE77176.1|1685268_1686339_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
>prophage 122
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1694214	1695318	5883411		uncultured_virus(100.0%)	1	NA	NA
AVE77185.1|1694214_1695318_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	1.1e-101
>prophage 123
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1699498	1701004	5883411		Cedratvirus(50.0%)	2	NA	NA
AVE77189.1|1699498_1700296_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
AVE77190.1|1700305_1701004_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
>prophage 124
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1705027	1705408	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE80950.1|1705027_1705408_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 125
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1715539	1716901	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE77207.1|1715539_1716901_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.4e-17
>prophage 126
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1736596	1737388	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77229.1|1736596_1737388_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 127
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1740890	1741631	5883411		Indivirus(100.0%)	1	NA	NA
AVE80952.1|1740890_1741631_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 128
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1748692	1750150	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
AVE77243.1|1748692_1750150_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.6	2.0e-39
>prophage 129
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1754136	1754946	5883411		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AVE77248.1|1754136_1754946_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	7.4e-12
>prophage 130
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1759372	1762936	5883411		Enterobacteria_phage(50.0%)	3	NA	NA
AVE77253.1|1759372_1760458_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.1	6.0e-142
AVE77254.1|1760588_1761851_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AVE77255.1|1761940_1762936_-	oxidoreductase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
>prophage 131
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1770708	1772241	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE77263.1|1770708_1772241_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 132
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1781503	1782340	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
AVE77275.1|1781503_1782340_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	2.4e-13
>prophage 133
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1802397	1803126	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE77296.1|1802397_1803126_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 134
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1806876	1808874	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
AVE77300.1|1806876_1808874_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 135
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1813481	1814264	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE77306.1|1813481_1814264_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.8e-15
>prophage 136
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1826466	1847029	5883411		Bacillus_phage(50.0%)	5	NA	NA
AVE77318.1|1826466_1835943_-	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
AVE77319.1|1836029_1842128_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.7	6.8e-33
AVE77320.1|1842311_1843271_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE77321.1|1843437_1845240_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
AVE77322.1|1845226_1847029_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	4.4e-20
>prophage 137
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1855211	1858532	5883411		Autographa_californica_nuclear_polyhedrosis_virus(50.0%)	4	NA	NA
AVE77329.1|1855211_1856027_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	96.3	9.4e-156
AVE77330.1|1856394_1857513_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVE77331.1|1857546_1857786_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77332.1|1857785_1858532_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	5.4e-25
>prophage 138
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1880739	1882137	5883411		Erysipelothrix_phage(100.0%)	1	NA	NA
AVE77353.1|1880739_1882137_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	9.1e-42
>prophage 139
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1889372	1890257	5883411		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVE77358.1|1889372_1890257_+	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 140
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1903829	1907948	5883411		Pithovirus(50.0%)	4	NA	NA
AVE77373.1|1903829_1904558_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
AVE77374.1|1904554_1905295_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE77375.1|1905319_1906255_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AVE77376.1|1906562_1907948_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	3.3e-28
>prophage 141
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1921136	1922725	5883411		Dickeya_phage(50.0%)	2	NA	NA
AVE77385.1|1921136_1921913_-	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
AVE77386.1|1921909_1922725_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	5.6e-07
>prophage 142
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1930998	1934582	5883411		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVE77396.1|1930998_1933731_-	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
AVE77397.1|1933886_1934582_-	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
>prophage 143
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1953143	1958095	5883411		Streptococcus_phage(33.33%)	5	NA	NA
AVE77415.1|1953143_1954856_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.6e-32
AVE77416.1|1954893_1955421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVE77417.1|1955541_1955730_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77418.1|1956228_1956828_-	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
AVE77419.1|1957084_1958095_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
>prophage 144
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1962336	1963941	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE77424.1|1962336_1963941_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	2.9e-15
>prophage 145
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1973921	1975412	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
AVE77434.1|1973921_1975412_-	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 146
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1981515	1983060	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE77438.1|1981515_1983060_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 147
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1988531	1989233	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77444.1|1988531_1989233_-	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	5.2e-30
>prophage 148
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2003037	2003817	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77456.1|2003037_2003817_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 149
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2014365	2016462	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE80959.1|2014365_2016462_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.1e-139
>prophage 150
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2033476	2034487	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
AVE77485.1|2033476_2034487_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 151
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2041236	2043201	5883411		Phage_TP(100.0%)	1	NA	NA
AVE77493.1|2041236_2043201_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 152
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2056546	2058055	5883411		Moumouvirus(100.0%)	1	NA	NA
AVE77505.1|2056546_2058055_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	35.1	3.0e-30
>prophage 153
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2065291	2069909	5883411		Prochlorococcus_phage(20.0%)	7	NA	NA
AVE77512.1|2065291_2066410_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
AVE77513.1|2066432_2066708_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AVE77514.1|2066877_2067405_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	47.7	6.3e-20
AVE77515.1|2067630_2067873_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
AVE77516.1|2068179_2068377_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77517.1|2068668_2068872_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
AVE77518.1|2068937_2069909_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
>prophage 154
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2081919	2086530	5883411		Bacillus_phage(50.0%)	2	NA	NA
AVE77529.1|2081919_2082579_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
AVE77530.1|2082627_2086530_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 155
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2096172	2097243	5883411		Synechococcus_phage(100.0%)	1	NA	NA
AVE77540.1|2096172_2097243_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 156
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2140589	2142110	5883411		Indivirus(100.0%)	1	NA	NA
AVE77578.1|2140589_2142110_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	6.9e-11
>prophage 157
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2151398	2224148	5883411	holin,protease,tRNA,plate	Enterobacteria_phage(22.22%)	66	NA	NA
AVE77588.1|2151398_2152388_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
AVE77589.1|2152513_2152954_+	heat-inducible protein	NA	NA	NA	NA	NA
AVE77590.1|2152950_2153223_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVE77591.1|2153550_2153916_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77592.1|2154142_2154685_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	66.9	3.1e-70
AVE77593.1|2154692_2154965_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
AVE77594.1|2154954_2155347_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
AVE77595.1|2155423_2155786_-	antitermination protein	NA	C6ZR44	Salmonella_phage	58.3	7.1e-31
AVE80965.1|2156247_2156784_-	phage repressor protein	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
AVE77596.1|2157418_2160946_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AVE77597.1|2161131_2161371_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77598.1|2161303_2162410_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.4	8.4e-107
AVE77599.1|2162563_2162776_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVE77600.1|2162858_2163293_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
AVE80966.1|2163481_2163772_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
AVE80967.1|2164150_2165089_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AVE77601.1|2165899_2166835_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
AVE77602.1|2166879_2168253_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
AVE77603.1|2168736_2169720_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVE77604.1|2170062_2170683_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVE77605.1|2171300_2172044_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
AVE80968.1|2172060_2173128_+	oxidoreductase	NA	NA	NA	NA	NA
AVE77606.1|2173200_2174466_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
AVE77607.1|2174465_2174888_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	51.2	4.4e-32
AVE77608.1|2175175_2175370_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77609.1|2175526_2175718_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77610.1|2175895_2176210_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
AVE77611.1|2176264_2176828_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AVE77612.1|2177024_2177606_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77613.1|2177731_2178361_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AVE77614.1|2178523_2178742_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77615.1|2178730_2178919_-	cold-shock protein	NA	NA	NA	NA	NA
AVE80969.1|2179757_2180783_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE77616.1|2180977_2181808_+	oxidoreductase	NA	NA	NA	NA	NA
AVE77617.1|2181852_2182833_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AVE77618.1|2182991_2183876_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE77619.1|2183989_2184874_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE77620.1|2185045_2186182_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE77621.1|2186390_2187512_+	MFS transporter	NA	NA	NA	NA	NA
AVE80970.1|2187609_2187954_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AVE77622.1|2188055_2188781_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
AVE77623.1|2189023_2189458_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AVE77624.1|2189454_2190174_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AVE77625.1|2190170_2191430_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE77626.1|2191431_2192154_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AVE77627.1|2192150_2193374_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVE77628.1|2193370_2193904_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AVE77629.1|2193918_2194878_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AVE77630.1|2194941_2196324_-	lactam utilization protein LamB	NA	NA	NA	NA	NA
AVE77631.1|2197205_2198660_+	MFS transporter	NA	NA	NA	NA	NA
AVE77632.1|2198714_2200394_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AVE77633.1|2200556_2201891_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77634.1|2201914_2202370_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVE77635.1|2202371_2202911_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVE77636.1|2202888_2203974_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVE77637.1|2203937_2205698_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVE80971.1|2205932_2209166_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVE77638.1|2209307_2210741_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77639.1|2210740_2211001_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVE77640.1|2211002_2212970_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.2	1.1e-61
AVE80972.1|2213222_2215718_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	1.8e-19
AVE80973.1|2219628_2221164_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVE77641.1|2221204_2221696_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVE77642.1|2222307_2222463_-	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AVE77643.1|2222529_2223093_+|protease	protease	protease	NA	NA	NA	NA
AVE77644.1|2223371_2224148_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.9e-34
>prophage 158
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2230224	2237390	5883411		Bacillus_virus(25.0%)	8	NA	NA
AVE77650.1|2230224_2231067_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	7.2e-34
AVE77651.1|2231038_2231905_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE77652.1|2232094_2233573_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.3	2.1e-89
AVE77653.1|2233559_2234504_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77654.1|2234541_2235717_-	molybdenum cofactor biosynthesis protein MoeB	NA	A0A291ATS8	Pandoravirus	33.6	2.3e-09
AVE77655.1|2235713_2236004_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
AVE77656.1|2236063_2236492_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77657.1|2236484_2237390_-	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	38.0	5.2e-46
>prophage 159
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2243443	2244178	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE77663.1|2243443_2244178_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-33
>prophage 160
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2258937	2259732	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77677.1|2258937_2259732_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-31
>prophage 161
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2268598	2269618	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE77683.1|2268598_2269618_-	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 162
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2294880	2300076	5883411		Staphylococcus_phage(50.0%)	4	NA	NA
AVE77704.1|2294880_2295690_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
AVE77705.1|2295931_2296720_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AVE77706.1|2296902_2298060_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77707.1|2298141_2300076_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
>prophage 163
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2305654	2306245	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE77714.1|2305654_2306245_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 164
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2311089	2313687	5883411		Tupanvirus(100.0%)	1	NA	NA
AVE77718.1|2311089_2313687_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 165
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2326640	2329598	5883411		Acinetobacter_phage(100.0%)	2	NA	NA
AVE77730.1|2326640_2328236_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
AVE77731.1|2328239_2329598_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
>prophage 166
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2337100	2338417	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE77741.1|2337100_2338417_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	1.5e-41
>prophage 167
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2342792	2349165	5883411	transposase	Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
AVE77746.1|2342792_2343554_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	3.0e-15
AVE77747.1|2343645_2344236_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVE77748.1|2344370_2345762_+	L-cystine transporter	NA	NA	NA	NA	NA
AVE77749.1|2345943_2346378_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
AVE80984.1|2346470_2346818_-	cell division activator CedA	NA	NA	NA	NA	NA
AVE77750.1|2346906_2349165_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
>prophage 168
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2355380	2356208	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77758.1|2355380_2356208_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 169
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2365625	2366846	5883411		Klosneuvirus(100.0%)	1	NA	NA
AVE77767.1|2365625_2366846_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.2e-26
>prophage 170
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2372856	2373489	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE77774.1|2372856_2373489_+	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	6.9e-13
>prophage 171
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2377722	2379678	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE77778.1|2377722_2379678_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 172
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2385624	2389679	5883411		Tupanvirus(50.0%)	4	NA	NA
AVE77785.1|2385624_2386266_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.6	5.9e-20
AVE77786.1|2386303_2387662_-	MFS transporter	NA	NA	NA	NA	NA
AVE77787.1|2387803_2388562_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVE77788.1|2388695_2389679_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	5.7e-06
>prophage 173
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2395372	2396626	5883411		Tupanvirus(100.0%)	1	NA	NA
AVE77793.1|2395372_2396626_+	chitinase	NA	A0A2K9L3D4	Tupanvirus	28.3	1.5e-24
>prophage 174
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2400254	2401109	5883411		Indivirus(100.0%)	1	NA	NA
AVE77799.1|2400254_2401109_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 175
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2404441	2408789	5883411		Bacillus_phage(100.0%)	4	NA	NA
AVE77802.1|2404441_2405725_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
AVE77803.1|2405773_2406931_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AVE77804.1|2407018_2407294_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77805.1|2407292_2408789_+	diguanylate cylase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
>prophage 176
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2416939	2417854	5883411		Morganella_phage(100.0%)	1	NA	NA
AVE77818.1|2416939_2417854_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
>prophage 177
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2424303	2436804	5883411		uncultured_Caudovirales_phage(20.0%)	13	NA	NA
AVE77824.1|2424303_2425302_+	iron-dicitrate transporter permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
AVE77825.1|2425298_2426252_+	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AVE77826.1|2426252_2427020_+	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
AVE77827.1|2427056_2428100_-	type II asparaginase	NA	NA	NA	NA	NA
AVE77828.1|2428379_2429570_+	HD domain-containing protein	NA	NA	NA	NA	NA
AVE77829.1|2429646_2431431_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	5.6e-20
AVE77830.1|2431503_2432388_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE77831.1|2432488_2432791_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVE77832.1|2432796_2433186_+	tautomerase family protein	NA	NA	NA	NA	NA
AVE77833.1|2433182_2433365_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77834.1|2433529_2433898_-	serine/threonine protein kinase	NA	I6R9L6	Nonlabens_phage	38.3	2.5e-15
AVE77835.1|2433926_2434484_-	hypothetical protein	NA	NA	NA	NA	NA
AVE77836.1|2435553_2436804_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	88.9	9.7e-19
>prophage 178
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2440038	2441409	5883411		Bodo_saltans_virus(100.0%)	1	NA	NA
AVE77841.1|2440038_2441409_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 179
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2448192	2449329	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE77848.1|2448192_2449329_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 180
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2454682	2455633	5883411		Cyanophage(100.0%)	1	NA	NA
AVE77854.1|2454682_2455633_-	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 181
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2462737	2466488	5883411		Vibrio_phage(50.0%)	4	NA	NA
AVE77862.1|2462737_2463568_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
AVE77863.1|2463582_2464494_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVE77864.1|2464542_2465787_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AVE77865.1|2465786_2466488_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
>prophage 182
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2472778	2473036	5883411		Erwinia_phage(100.0%)	1	NA	NA
AVE77868.1|2472778_2473036_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 183
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2488807	2489449	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
AVE77883.1|2488807_2489449_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 184
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2492749	2493931	5883411		Ralstonia_phage(50.0%)	2	NA	NA
AVE77887.1|2492749_2492986_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVE77888.1|2493196_2493931_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
>prophage 185
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2515170	2515416	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE77907.1|2515170_2515416_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 186
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2518646	2519567	5883411		Morganella_phage(100.0%)	1	NA	NA
AVE77911.1|2518646_2519567_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 187
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2527936	2528491	5883411		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AVE77918.1|2527936_2528491_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 188
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2541774	2544906	5883411		Bacillus_phage(50.0%)	4	NA	NA
AVE77929.1|2541774_2542470_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.8	1.6e-26
AVE77930.1|2542592_2543381_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AVE77931.1|2543496_2543790_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77932.1|2543841_2544906_-	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	77.6	2.5e-92
>prophage 189
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2561529	2563777	5883411		Enterobacteria_phage(100.0%)	4	NA	NA
AVE77946.1|2561529_2562024_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
AVE77947.1|2562045_2563368_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	2.0e-200
AVE77948.1|2563364_2563607_+	hypothetical protein	NA	NA	NA	NA	NA
AVE77949.1|2563603_2563777_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
>prophage 190
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2578442	2585020	5883411		Hokovirus(50.0%)	4	NA	NA
AVE77964.1|2578442_2580944_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
AVE77965.1|2581253_2582330_+	PTS fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AVE77966.1|2582350_2582671_+	PTS system fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AVE77967.1|2582722_2585020_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
>prophage 191
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2588665	2589568	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE77972.1|2588665_2589568_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 192
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2600939	2601680	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE77982.1|2600939_2601680_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	8.8e-36
>prophage 193
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2615170	2616553	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE77997.1|2615170_2616553_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.5	4.8e-19
>prophage 194
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2621828	2622857	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78002.1|2621828_2622857_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 195
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2636876	2643497	5883411		Morganella_phage(50.0%)	6	NA	NA
AVE78017.1|2636876_2637581_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
AVE81000.1|2637939_2638326_+	transporter	NA	NA	NA	NA	NA
AVE78018.1|2638644_2641764_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	S5VTK5	Leptospira_phage	20.6	8.0e-46
AVE78019.1|2641906_2642167_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78020.1|2642401_2642623_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
AVE78021.1|2643284_2643497_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
>prophage 196
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2647764	2648544	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVE81001.1|2647764_2648544_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.9e-17
>prophage 197
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2672610	2673351	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE78046.1|2672610_2673351_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-29
>prophage 198
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2691789	2692449	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVE78064.1|2691789_2692449_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 199
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2703024	2705172	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78074.1|2703024_2705172_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	2.7e-24
>prophage 200
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2719877	2721932	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78078.1|2719877_2721932_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 201
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2734707	2736615	5883411		Tupanvirus(100.0%)	1	NA	NA
AVE78091.1|2734707_2736615_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 202
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2743327	2751693	5883411	tRNA	Bacillus_virus(20.0%)	5	NA	NA
AVE78098.1|2743327_2744101_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
AVE78099.1|2744166_2746782_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AVE81007.1|2747109_2748312_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
AVE78100.1|2748615_2750016_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
AVE78101.1|2750607_2751693_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
>prophage 203
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2769001	2773554	5883411		Bacillus_phage(100.0%)	3	NA	NA
AVE78115.1|2769001_2770750_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
AVE78116.1|2770795_2773051_-	ComEC family protein	NA	NA	NA	NA	NA
AVE78117.1|2773266_2773554_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 204
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2777847	2778936	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE78121.1|2777847_2778936_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 205
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2782984	2786211	5883411		Tetraselmis_virus(100.0%)	2	NA	NA
AVE78125.1|2782984_2785267_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
AVE78126.1|2785470_2786211_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
>prophage 206
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2793343	2816450	5883411	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
AVE78135.1|2793343_2793961_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.6	3.4e-73
AVE78136.1|2793971_2796410_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.0e-218
AVE78137.1|2796610_2797903_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
AVE78138.1|2797994_2799338_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
AVE78139.1|2799346_2799958_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVE78140.1|2800079_2804138_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	4.9e-88
AVE78141.1|2804273_2804768_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVE78142.1|2805299_2806268_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
AVE78143.1|2806382_2808149_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
AVE78144.1|2808149_2809871_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	1.1e-15
AVE78145.1|2809909_2810614_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVE78146.1|2810893_2811112_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVE78147.1|2811249_2813532_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
AVE78148.1|2813562_2813880_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
AVE78149.1|2814204_2814435_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
AVE78150.1|2814503_2816450_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
>prophage 207
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2830336	2833076	5883411		Roseobacter_phage(50.0%)	4	NA	NA
AVE78161.1|2830336_2831167_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.5	1.6e-06
AVE78162.1|2831163_2831487_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78163.1|2831604_2832120_+	lipoprotein	NA	NA	NA	NA	NA
AVE81010.1|2832347_2833076_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
>prophage 208
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2836836	2848362	5883411		Bacillus_phage(33.33%)	13	NA	NA
AVE78170.1|2836836_2838309_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	2.5e-26
AVE81011.1|2838305_2839022_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
AVE78171.1|2839100_2840231_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	1.7e-25
AVE78172.1|2840273_2840762_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVE78173.1|2840819_2841665_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVE78174.1|2841661_2842615_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVE81012.1|2842625_2843759_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
AVE78175.1|2843861_2844974_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVE78176.1|2845322_2845802_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVE78177.1|2845891_2846794_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
AVE78178.1|2846897_2847620_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVE78179.1|2847603_2847894_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AVE78180.1|2848098_2848362_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
>prophage 209
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2855926	2898337	5883411	integrase,portal,tail,protease,lysis	Enterobacteria_phage(26.83%)	57	2858103:2858117	2898365:2898379
AVE78187.1|2855926_2856685_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	7.0e-12
AVE78188.1|2856713_2857916_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
2858103:2858117	attL	AATATTAACTTTATT	NA	NA	NA	NA
AVE78189.1|2858115_2858298_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78190.1|2858281_2858608_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	6.0e-21
AVE78191.1|2858607_2858847_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	58.2	1.1e-19
AVE78192.1|2859020_2860274_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	44.2	1.0e-84
AVE78193.1|2860274_2861489_-	polymerase	NA	NA	NA	NA	NA
AVE78194.1|2861853_2863287_-	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.1	1.2e-17
AVE78195.1|2863286_2865281_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	71.6	3.7e-52
AVE78196.1|2865358_2868418_-	kinase	NA	A0A286S259	Klebsiella_phage	86.2	0.0e+00
AVE78197.1|2868414_2868795_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.9	1.0e-67
AVE78198.1|2868804_2869287_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	91.2	9.3e-79
AVE78199.1|2869273_2869747_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.4	6.2e-51
AVE78200.1|2869746_2872443_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	56.7	2.6e-202
AVE78201.1|2872423_2872741_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	49.5	7.9e-18
AVE78202.1|2872761_2873157_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVE78203.1|2873199_2873682_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	66.9	1.4e-58
AVE78204.1|2873689_2874088_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	58.6	1.6e-39
AVE78205.1|2874084_2874636_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.9	4.1e-54
AVE78206.1|2874625_2874919_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	2.5e-18
AVE78207.1|2874911_2875238_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	64.5	2.6e-32
AVE78208.1|2875319_2877335_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.1	0.0e+00
AVE78209.1|2877279_2878779_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AVE78210.1|2878775_2878991_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	4.5e-25
AVE78211.1|2878987_2881096_-	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	82.8	0.0e+00
AVE78212.1|2881095_2881587_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	85.3	7.6e-68
AVE78213.1|2881907_2882093_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	5.4e-11
AVE81014.1|2882159_2882369_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78214.1|2882645_2882891_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	60.5	4.7e-18
AVE78215.1|2882956_2883202_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78216.1|2883207_2883597_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	48.4	1.9e-26
AVE78217.1|2883774_2884164_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	5.0e-22
AVE78218.1|2884160_2884655_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	94.5	6.6e-88
AVE78219.1|2884632_2884857_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
AVE78220.1|2885483_2886062_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	2.4e-52
AVE78221.1|2886058_2886703_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	72.3	2.3e-88
AVE78222.1|2886699_2887782_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.8	8.6e-149
AVE78223.1|2887795_2888209_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78224.1|2888205_2888415_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78225.1|2888411_2888615_-	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	50.0	3.6e-08
AVE78226.1|2888608_2889070_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78227.1|2889066_2889852_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	7.6e-62
AVE78228.1|2889844_2890057_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78229.1|2890053_2890347_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78230.1|2890359_2891436_-	hypothetical protein	NA	U5P0A0	Shigella_phage	36.2	9.5e-23
AVE78231.1|2891432_2891687_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78232.1|2891701_2892115_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	3.2e-43
AVE78233.1|2892173_2892386_-	transcriptional regulator	NA	NA	NA	NA	NA
AVE78234.1|2892494_2893091_+	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	3.7e-08
AVE78235.1|2893429_2893753_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78236.1|2893723_2894017_-	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AVE78237.1|2894490_2894784_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78238.1|2895125_2895350_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.4e-16
AVE78239.1|2895346_2896042_+	hypothetical protein	NA	R9VWB9	Serratia_phage	59.5	4.2e-72
AVE78240.1|2896038_2896743_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.6	3.0e-25
AVE78241.1|2896835_2897051_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78242.1|2897050_2898337_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	54.5	1.7e-122
2898365:2898379	attR	AATATTAACTTTATT	NA	NA	NA	NA
>prophage 210
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2908011	2909865	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE78251.1|2908011_2909865_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G3M9Y6	Bacillus_virus	28.8	2.7e-09
>prophage 211
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2914043	2916476	5883411		Citrobacter_phage(100.0%)	1	NA	NA
AVE78256.1|2914043_2916476_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 212
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2924716	2927831	5883411		Tupanvirus(50.0%)	2	NA	NA
AVE78261.1|2924716_2926309_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.8	5.0e-60
AVE78262.1|2926343_2927831_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	24.7	1.6e-15
>prophage 213
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2933513	2934137	5883411		Clostridium_phage(100.0%)	1	NA	NA
AVE78267.1|2933513_2934137_+	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	28.1	1.1e-07
>prophage 214
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2939538	2942107	5883411		Pandoravirus(50.0%)	2	NA	NA
AVE78273.1|2939538_2940915_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
AVE78274.1|2941066_2942107_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
>prophage 215
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2946019	2951123	5883411		Escherichia_phage(33.33%)	6	NA	NA
AVE78279.1|2946019_2946532_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
AVE78280.1|2946883_2947771_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVE78281.1|2947989_2948493_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
AVE78282.1|2948864_2949611_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVE78283.1|2949744_2950404_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVE78284.1|2950400_2951123_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
>prophage 216
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2962420	2970956	5883411		Synechococcus_phage(20.0%)	8	NA	NA
AVE78290.1|2962420_2963098_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
AVE78291.1|2963166_2963433_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
AVE78292.1|2963717_2963978_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78293.1|2964113_2965082_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVE78294.1|2965124_2967269_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
AVE78295.1|2967468_2968818_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
AVE78296.1|2969118_2970111_-	transketolase	NA	NA	NA	NA	NA
AVE78297.1|2970110_2970956_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
>prophage 217
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2976098	2977838	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVE78301.1|2976098_2977838_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 218
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2987621	2988527	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE78315.1|2987621_2988527_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.2	3.1e-27
>prophage 219
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2995092	2995815	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE78322.1|2995092_2995815_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	6.2e-10
>prophage 220
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2999490	3004444	5883411		Klosneuvirus(50.0%)	4	NA	NA
AVE81020.1|2999490_3000780_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
AVE78327.1|3000849_3001326_+	kinase inhibitor	NA	NA	NA	NA	NA
AVE78328.1|3001425_3002808_-	amino acid permease	NA	NA	NA	NA	NA
AVE78329.1|3002920_3004444_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.5	1.9e-80
>prophage 221
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3011209	3011941	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
AVE78336.1|3011209_3011941_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 222
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3019114	3025641	5883411		Planktothrix_phage(33.33%)	7	NA	NA
AVE78345.1|3019114_3020173_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
AVE78346.1|3020175_3020865_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVE78347.1|3020864_3021638_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE78348.1|3021784_3021934_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVE81021.1|3022087_3022876_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVE78349.1|3022943_3024413_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.6	4.3e-10
AVE78350.1|3024624_3025641_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	7.5e-78
>prophage 223
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3029961	3033478	5883411		Edwardsiella_phage(33.33%)	4	NA	NA
AVE78355.1|3029961_3031014_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
AVE78356.1|3031328_3031700_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78357.1|3031817_3032762_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
AVE78358.1|3032758_3033478_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	25.1	2.1e-13
>prophage 224
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3072384	3073176	5883411		Kaumoebavirus(100.0%)	1	NA	NA
AVE78396.1|3072384_3073176_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.4	9.8e-09
>prophage 225
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3078973	3086465	5883411		Acinetobacter_phage(33.33%)	6	NA	NA
AVE78404.1|3078973_3080455_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
AVE78405.1|3080417_3081866_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.8	1.6e-57
AVE78406.1|3082110_3082317_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVE78407.1|3082626_3082716_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVE78408.1|3082715_3084395_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVE78409.1|3084416_3086465_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
>prophage 226
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3094732	3096217	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE81023.1|3094732_3096217_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 227
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3102661	3103435	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
AVE78423.1|3102661_3103435_+	alpha/beta hydrolase	NA	W0LK50	Mycobacterium_phage	37.0	2.6e-06
>prophage 228
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3106440	3116392	5883411	tRNA	Lactobacillus_phage(25.0%)	7	NA	NA
AVE78428.1|3106440_3107844_+	tricarballylate dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	2.3e-08
AVE78429.1|3107830_3108970_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AVE78430.1|3109024_3110320_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.8e-60
AVE78431.1|3110372_3110705_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78432.1|3110751_3112155_-	chitoporin	NA	NA	NA	NA	NA
AVE78433.1|3112593_3114261_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
AVE78434.1|3114439_3116392_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
>prophage 229
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3121019	3122681	5883411		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
AVE78439.1|3121019_3122681_+	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 230
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3127336	3128401	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
AVE78443.1|3127336_3128401_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 231
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3135611	3143710	5883411	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
AVE78450.1|3135611_3136337_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
AVE78451.1|3136708_3138376_+	hemin-binding protein	NA	NA	NA	NA	NA
AVE78452.1|3138431_3140219_+	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
AVE78453.1|3140418_3140901_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78454.1|3141127_3143710_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	1.2e-188
>prophage 232
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3150726	3153170	5883411		Synechococcus_phage(50.0%)	2	NA	NA
AVE78462.1|3150726_3151827_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
AVE78463.1|3151970_3153170_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
>prophage 233
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3157086	3158624	5883411		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
AVE78469.1|3157086_3157875_-	hydrolase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
AVE81025.1|3157966_3158350_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
AVE78470.1|3158414_3158624_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
>prophage 234
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3162711	3181373	5883411	tRNA	Morganella_phage(14.29%)	17	NA	NA
AVE78475.1|3162711_3163140_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
AVE78476.1|3163216_3164782_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
AVE78477.1|3164951_3165515_-	peroxiredoxin	NA	NA	NA	NA	NA
AVE78478.1|3166381_3167293_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE81026.1|3167397_3168621_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
AVE78479.1|3168605_3169235_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
AVE78480.1|3169235_3170396_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVE78481.1|3170575_3171265_+	acireductone synthase	NA	NA	NA	NA	NA
AVE78482.1|3171261_3171804_+	acireductone dioxygenase	NA	NA	NA	NA	NA
AVE78483.1|3171751_3171991_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78484.1|3171987_3174297_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	32.8	9.7e-81
AVE78485.1|3174835_3175816_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE81027.1|3175860_3177366_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
AVE78486.1|3177362_3178349_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE78487.1|3178348_3179350_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE78488.1|3179361_3180306_+	sugar kinase	NA	NA	NA	NA	NA
AVE78489.1|3180344_3181373_-	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
>prophage 235
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3198873	3202490	5883411		Staphylococcus_phage(50.0%)	4	NA	NA
AVE78502.1|3198873_3200376_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	6.0e-15
AVE78503.1|3200536_3201625_+	oxidoreductase	NA	NA	NA	NA	NA
AVE78504.1|3201811_3202105_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AVE78505.1|3202085_3202490_+	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	3.6e-07
>prophage 236
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3211555	3213673	5883411		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
AVE78514.1|3211555_3213673_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	1.8e-33
>prophage 237
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3217644	3222419	5883411		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AVE78518.1|3217644_3218439_+	iron-enterobactin transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	5.8e-09
AVE78519.1|3218537_3222419_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	27.2	1.6e-56
>prophage 238
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3233966	3235511	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVE78530.1|3233966_3235511_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	6.8e-14
>prophage 239
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3238976	3244894	5883411	holin	Vibrio_phage(50.0%)	5	NA	NA
AVE78534.1|3238976_3241010_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
AVE81031.1|3241006_3241222_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78535.1|3241138_3241732_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVE78536.1|3241742_3243215_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVE78537.1|3243229_3244894_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.5e-59
>prophage 240
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3250281	3258599	5883411		Planktothrix_phage(33.33%)	8	NA	NA
AVE78542.1|3250281_3250986_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
AVE78543.1|3251094_3252432_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVE78544.1|3252614_3253379_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE78545.1|3253922_3254684_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
AVE78546.1|3254676_3255342_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVE78547.1|3255356_3255998_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVE78548.1|3256046_3256898_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE78549.1|3257132_3258599_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	8.2e-17
>prophage 241
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3263949	3265993	5883411		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVE78553.1|3263949_3264960_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	1.6e-11
AVE78554.1|3264949_3265993_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
>prophage 242
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3276621	3279333	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVE81033.1|3276621_3279333_-	carbonate dehydratase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	1.2e-66
>prophage 243
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3299634	3302322	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78582.1|3299634_3302322_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	36.0	4.3e-40
>prophage 244
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3324290	3325040	5883411		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVE78600.1|3324290_3325040_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 245
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3340593	3341385	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE78615.1|3340593_3341385_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 246
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3345779	3347180	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78619.1|3345779_3347180_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 247
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3359900	3364975	5883411	tRNA	Salmonella_phage(33.33%)	4	NA	NA
AVE78630.1|3359900_3360776_+	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
AVE78631.1|3361043_3361457_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
AVE78632.1|3361609_3363127_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
AVE78633.1|3363499_3364975_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	4.2e-45
>prophage 248
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3371754	3372630	5883411		Burkholderia_virus(100.0%)	1	NA	NA
AVE78638.1|3371754_3372630_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.5	5.2e-19
>prophage 249
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3384209	3385211	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE78648.1|3384209_3385211_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.1e-28
>prophage 250
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3391177	3391426	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE78655.1|3391177_3391426_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	71.8	4.7e-26
>prophage 251
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3394608	3397369	5883411	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
AVE78659.1|3394608_3395475_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
AVE78660.1|3395476_3395689_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVE78661.1|3395983_3397369_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
>prophage 252
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3406220	3406907	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE81036.1|3406220_3406907_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 253
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3410093	3410774	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVE78673.1|3410093_3410774_-	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 254
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3415672	3419499	5883411		uncultured_virus(50.0%)	2	NA	NA
AVE78679.1|3415672_3418174_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
AVE78680.1|3418248_3419499_-	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
>prophage 255
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3433917	3441764	5883411	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AVE78693.1|3433917_3435792_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
AVE78694.1|3435903_3436509_-	recombination protein RecR	NA	NA	NA	NA	NA
AVE78695.1|3436508_3436841_-	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AVE78696.1|3436898_3438806_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
AVE78697.1|3438897_3439449_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
AVE81038.1|3439599_3439977_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78698.1|3440046_3440574_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AVE78699.1|3440588_3440762_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AVE78700.1|3440828_3441764_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
>prophage 256
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3447280	3456668	5883411		Leptospira_phage(33.33%)	10	NA	NA
AVE78704.1|3447280_3450427_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
AVE78705.1|3450907_3451282_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AVE78706.1|3451308_3451527_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVE78707.1|3451689_3452256_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AVE78708.1|3452382_3452853_+	hypothetical protein	NA	NA	NA	NA	NA
AVE78709.1|3452827_3454282_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	4.0e-16
AVE78710.1|3454383_3455082_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVE78711.1|3455078_3455219_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVE81039.1|3455218_3455482_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AVE78712.1|3455594_3456668_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	41.1	4.1e-66
>prophage 257
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3465820	3466930	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE78720.1|3465820_3466930_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.2e-13
>prophage 258
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3478348	3481892	5883411		Bacillus_phage(100.0%)	2	NA	NA
AVE78736.1|3478348_3480127_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
AVE78737.1|3480119_3481892_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.3e-48
>prophage 259
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3486319	3487015	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVE78742.1|3486319_3487015_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 260
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3490392	3495442	5883411	protease	Sodalis_phage(25.0%)	4	NA	NA
AVE78747.1|3490392_3490665_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AVE78748.1|3490873_3493228_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
AVE78749.1|3493411_3494686_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
AVE78750.1|3494818_3495442_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 261
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3510601	3512305	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
AVE78765.1|3510601_3512305_+	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	6.3e-21
>prophage 262
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3529320	3530988	5883411		Staphylococcus_phage(50.0%)	2	NA	NA
AVE78783.1|3529320_3529791_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
AVE78784.1|3529884_3530988_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	3.2e-50
>prophage 263
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3535968	3540308	5883411	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVE78791.1|3535968_3536940_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
AVE78792.1|3536950_3538798_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVE78793.1|3538825_3539158_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVE78794.1|3539180_3540308_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
>prophage 264
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3557262	3566483	5883411		Bacillus_phage(60.0%)	7	NA	NA
AVE78807.1|3557262_3558552_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
AVE78808.1|3558573_3559263_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AVE78809.1|3559541_3560744_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
AVE78810.1|3560740_3563875_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	6.4e-11
AVE78811.1|3564164_3564527_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVE78812.1|3564575_3565481_-	fructokinase	NA	NA	NA	NA	NA
AVE78813.1|3565571_3566483_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
>prophage 265
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3590862	3591630	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE78840.1|3590862_3591630_-	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 266
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3599686	3600733	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE78847.1|3599686_3600733_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 267
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3612125	3616250	5883411		Brazilian_cedratvirus(66.67%)	6	NA	NA
AVE78858.1|3612125_3612908_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
AVE78859.1|3612900_3613596_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
AVE78860.1|3613703_3613886_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78861.1|3614421_3614616_-	hypothetical protein	NA	NA	NA	NA	NA
AVE78862.1|3614608_3615418_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE81041.1|3615431_3616250_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
>prophage 268
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3625495	3626338	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVE78870.1|3625495_3626338_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.2e-12
>prophage 269
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3633522	3634266	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE78878.1|3633522_3634266_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.8e-32
>prophage 270
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3639017	3644306	5883411	integrase	Enterobacteria_phage(50.0%)	4	3637147:3637160	3644309:3644322
3637147:3637160	attL	GAAGCTGATGCTGA	NA	NA	NA	NA
AVE78883.1|3639017_3640070_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
AVE78884.1|3640360_3641464_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
AVE78885.1|3641474_3642728_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	4.9e-95
AVE78886.1|3643091_3644306_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	54.1	2.5e-128
3644309:3644322	attR	GAAGCTGATGCTGA	NA	NA	NA	NA
>prophage 271
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3657851	3659240	5883411		Leptospira_phage(100.0%)	1	NA	NA
AVE78900.1|3657851_3659240_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.4	2.4e-50
>prophage 272
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3676142	3681013	5883411		Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
AVE78915.1|3676142_3677240_+	glycine/betaine ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
AVE78916.1|3677236_3677881_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE78917.1|3677883_3678564_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE78918.1|3678594_3679470_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE78919.1|3679480_3681013_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.8e-67
>prophage 273
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3698479	3699955	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVE78933.1|3698479_3699955_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 274
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3734970	3735552	5883411		Caulobacter_phage(100.0%)	1	NA	NA
AVE78964.1|3734970_3735552_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 275
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3739653	3743864	5883411		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVE81048.1|3739653_3740385_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
AVE78968.1|3740450_3740918_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
AVE78969.1|3740914_3741637_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVE78970.1|3741669_3742425_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVE78971.1|3742496_3743864_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
>prophage 276
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3747908	3748712	5883411		Indivirus(100.0%)	1	NA	NA
AVE78975.1|3747908_3748712_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
>prophage 277
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3755400	3756432	5883411		Planktothrix_phage(100.0%)	1	NA	NA
AVE78977.1|3755400_3756432_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	7.2e-36
>prophage 278
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3771203	3775321	5883411		Saccharomonospora_phage(50.0%)	2	NA	NA
AVE78993.1|3771203_3774686_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	2.5e-205
AVE78994.1|3774724_3775321_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
>prophage 279
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3784155	3784914	5883411		Flavobacterium_phage(100.0%)	1	NA	NA
AVE79003.1|3784155_3784914_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 280
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3795438	3801242	5883411	protease	Helicoverpa_armigera_granulovirus(50.0%)	3	NA	NA
AVE79014.1|3795438_3798417_+	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.8	2.5e-41
AVE79015.1|3798453_3799611_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AVE79016.1|3799802_3801242_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
>prophage 281
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3805373	3805718	5883411		Lake_Baikal_phage(100.0%)	1	NA	NA
AVE79021.1|3805373_3805718_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 282
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3808884	3813540	5883411	transposase	Sodalis_phage(50.0%)	4	NA	NA
AVE79023.1|3808884_3809814_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	40.7	4.2e-59
AVE79024.1|3809873_3811856_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AVE79025.1|3811852_3812743_-	iron-hydroxamate transporter substrate-binding subunit	NA	NA	NA	NA	NA
AVE79026.1|3812742_3813540_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
>prophage 283
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3835535	3842301	5883411	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
AVE79045.1|3835535_3837965_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	31.9	5.6e-39
AVE79046.1|3838037_3838574_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVE79047.1|3838573_3839290_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVE79048.1|3839454_3839910_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVE79049.1|3839970_3840852_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVE79050.1|3840903_3842301_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
>prophage 284
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3854906	3861487	5883411		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AVE79064.1|3854906_3855833_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
AVE79065.1|3855940_3856603_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVE81054.1|3856654_3857191_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
AVE79066.1|3857394_3859785_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVE79067.1|3859885_3861487_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.3	1.1e-19
>prophage 285
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3866365	3867136	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE79073.1|3866365_3867136_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	7.5e-30
>prophage 286
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3876914	3878339	5883411		Erysipelothrix_phage(100.0%)	1	NA	NA
AVE79082.1|3876914_3878339_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 287
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3889587	3890139	5883411		Thiobacimonas_phage(100.0%)	1	NA	NA
AVE79090.1|3889587_3890139_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.8	1.9e-14
>prophage 288
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3894468	3895512	5883411		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVE79095.1|3894468_3895512_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 289
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3921629	3923354	5883411		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVE79121.1|3921629_3923354_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.2	3.9e-34
>prophage 290
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3944123	3944825	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE79139.1|3944123_3944825_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 291
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3951038	3956490	5883411		Heterocapsa_circularisquama_DNA_virus(50.0%)	2	NA	NA
AVE79145.1|3951038_3953396_+	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
AVE79146.1|3953583_3956490_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
>prophage 292
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3969031	3970400	5883411		Salmonella_phage(50.0%)	2	NA	NA
AVE79158.1|3969031_3969880_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
AVE79159.1|3969920_3970400_-	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
>prophage 293
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3977003	3978152	5883411		Halovirus(100.0%)	1	NA	NA
AVE79164.1|3977003_3978152_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.8e-48
>prophage 294
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4004448	4011136	5883411	tRNA	Tupanvirus(50.0%)	5	NA	NA
AVE81056.1|4004448_4007265_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
AVE79188.1|4007309_4008248_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AVE79189.1|4008578_4008842_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVE79190.1|4009008_4009908_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AVE79191.1|4009960_4011136_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
>prophage 295
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4015773	4024057	5883411		Plodia_interpunctella_granulovirus(25.0%)	7	NA	NA
AVE79194.1|4015773_4017873_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	3.1e-33
AVE79195.1|4018258_4018702_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE79196.1|4018718_4019252_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	3.3e-53
AVE79197.1|4019329_4019677_-	hypothetical protein	NA	NA	NA	NA	NA
AVE79198.1|4019801_4020749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE79199.1|4020916_4022053_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
AVE79200.1|4022140_4024057_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 296
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4028444	4029398	5883411		Cyanophage(100.0%)	1	NA	NA
AVE79206.1|4028444_4029398_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 297
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4040482	4041907	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE79216.1|4040482_4041907_-	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 298
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4045871	4051091	5883411		Bacillus_phage(33.33%)	3	NA	NA
AVE79223.1|4045871_4047809_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
AVE81058.1|4048082_4049750_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
AVE79224.1|4049858_4051091_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
>prophage 299
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4057390	4058713	5883411		Geobacillus_virus(100.0%)	1	NA	NA
AVE79230.1|4057390_4058713_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 300
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4063381	4066086	5883411		Salmonella_phage(50.0%)	3	NA	NA
AVE79235.1|4063381_4063543_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
AVE79236.1|4063667_4064279_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVE79237.1|4064496_4066086_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
>prophage 301
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4079394	4080674	5883411		Salmonella_phage(50.0%)	2	NA	NA
AVE79253.1|4079394_4079934_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
AVE81060.1|4079936_4080674_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
>prophage 302
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4083827	4086995	5883411	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVE79256.1|4083827_4084766_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
AVE79257.1|4084905_4085937_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AVE79258.1|4085933_4086995_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
>prophage 303
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4094207	4095230	5883411		Tupanvirus(100.0%)	1	NA	NA
AVE79263.1|4094207_4095230_-	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 304
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4129176	4131014	5883411		uncultured_marine_virus(50.0%)	2	NA	NA
AVE79295.1|4129176_4129803_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
AVE79296.1|4129802_4131014_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	1.3e-57
>prophage 305
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4143532	4147506	5883411		Rhodobacter_phage(50.0%)	2	NA	NA
AVE79311.1|4143532_4145962_+	DEAD/DEAH box helicase	NA	A0A0K1LLU7	Rhodobacter_phage	23.7	6.7e-08
AVE79312.1|4146036_4147506_+	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	27.6	8.7e-35
>prophage 306
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4155780	4156365	5883411		Moraxella_phage(100.0%)	1	NA	NA
AVE79322.1|4155780_4156365_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 307
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4162242	4165629	5883411	holin	Serratia_phage(100.0%)	1	NA	NA
AVE79331.1|4162242_4165629_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 308
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4174177	4179892	5883411		Bacillus_phage(50.0%)	3	NA	NA
AVE79342.1|4174177_4175575_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
AVE81065.1|4176098_4177166_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79343.1|4177162_4179892_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
>prophage 309
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4192590	4193955	5883411		Burkholderia_virus(100.0%)	1	NA	NA
AVE79350.1|4192590_4193955_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 310
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4207776	4208949	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE81066.1|4207776_4208949_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	32.9	1.6e-44
>prophage 311
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4217798	4222673	5883411		Tupanvirus(50.0%)	5	NA	NA
AVE79368.1|4217798_4218818_+	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	9.9e-46
AVE79369.1|4219009_4219882_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AVE79370.1|4219871_4220759_+	ABC transporter permease	NA	NA	NA	NA	NA
AVE79371.1|4220769_4221594_+	phosphodiesterase	NA	NA	NA	NA	NA
AVE79372.1|4221599_4222673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
>prophage 312
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4238391	4247441	5883411	tRNA	Klebsiella_phage(33.33%)	8	NA	NA
AVE81067.1|4238391_4239894_+	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
AVE79384.1|4239935_4241018_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVE79385.1|4241017_4242115_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVE79386.1|4242104_4242224_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVE81068.1|4242345_4242471_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79387.1|4242508_4244020_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AVE79388.1|4244142_4244586_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVE79389.1|4244585_4247441_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
>prophage 313
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4252585	4260368	5883411		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
AVE79397.1|4252585_4253521_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	7.7e-53
AVE79398.1|4253533_4253995_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVE79399.1|4254255_4255725_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.9e-21
AVE79400.1|4255879_4256266_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AVE79401.1|4256333_4259042_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	2.8e-47
AVE79402.1|4259420_4260368_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
>prophage 314
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4268201	4272989	5883411		Vibrio_phage(33.33%)	3	NA	NA
AVE79408.1|4268201_4270340_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
AVE81070.1|4270674_4271139_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
AVE81071.1|4271156_4272989_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	34.1	1.2e-20
>prophage 315
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4293530	4300083	5883411		Klosneuvirus(33.33%)	6	NA	NA
AVE79429.1|4293530_4294529_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AVE79430.1|4294573_4295560_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVE79431.1|4295546_4296572_-	ABC transporter permease	NA	NA	NA	NA	NA
AVE79432.1|4296582_4298085_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
AVE79433.1|4298195_4299152_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE79434.1|4299555_4300083_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
>prophage 316
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4340145	4344507	5883411		Lactococcus_phage(50.0%)	3	NA	NA
AVE79476.1|4340145_4342596_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
AVE79477.1|4342633_4343059_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVE79478.1|4343208_4344507_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 317
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4350033	4353271	5883411		Wolbachia_phage(50.0%)	2	NA	NA
AVE79485.1|4350033_4351923_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.5e-58
AVE79486.1|4351933_4353271_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.4e-17
>prophage 318
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4358009	4358555	5883411		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVE79491.1|4358009_4358555_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 319
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4365806	4371024	5883411		Tupanvirus(33.33%)	6	NA	NA
AVE79496.1|4365806_4366784_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
AVE81073.1|4367059_4368850_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
AVE79497.1|4368842_4369577_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AVE79498.1|4369587_4369983_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AVE79499.1|4369993_4370353_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
AVE79500.1|4370493_4371024_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.7e-46
>prophage 320
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4381919	4387449	5883411		Bacillus_phage(33.33%)	5	NA	NA
AVE79513.1|4381919_4384043_+	colicin V synthesis protein	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
AVE79514.1|4384065_4384932_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79515.1|4384978_4385332_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AVE79516.1|4385465_4387112_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
AVE79517.1|4387155_4387449_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 321
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4400466	4404171	5883411		Pseudomonas_phage(33.33%)	4	NA	NA
AVE79529.1|4400466_4401147_+	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.3	2.7e-31
AVE79530.1|4401297_4402218_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
AVE81077.1|4402217_4402523_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
AVE79531.1|4402668_4404171_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
>prophage 322
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4409496	4411139	5883411		Bacillus_virus(50.0%)	2	NA	NA
AVE79538.1|4409496_4410255_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
AVE79539.1|4410452_4411139_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
>prophage 323
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4416806	4427918	5883411		Bacillus_virus(33.33%)	9	NA	NA
AVE79547.1|4416806_4418339_+	allose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
AVE79548.1|4418317_4419298_+	allose ABC transporter	NA	NA	NA	NA	NA
AVE79549.1|4419308_4420004_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVE79550.1|4419987_4420899_+	allose kinase	NA	NA	NA	NA	NA
AVE79551.1|4421160_4423308_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	4.1e-33
AVE79552.1|4423514_4424198_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AVE79553.1|4424234_4425548_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AVE79554.1|4425615_4425867_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79555.1|4425959_4427918_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	2.7e-92
>prophage 324
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4440182	4441532	5883411		Moraxella_phage(100.0%)	1	NA	NA
AVE79567.1|4440182_4441532_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 325
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4453344	4458635	5883411		Vibrio_phage(33.33%)	3	NA	NA
AVE79578.1|4453344_4454949_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
AVE79579.1|4455035_4455563_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
AVE79580.1|4455809_4458635_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 326
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4462755	4465402	5883411		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVE79587.1|4462755_4463835_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
AVE79588.1|4463986_4465402_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	2.8e-200
>prophage 327
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4471242	4471851	5883411		Lactococcus_phage(100.0%)	1	NA	NA
AVE79596.1|4471242_4471851_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 328
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4479051	4480161	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
AVE79603.1|4479051_4480161_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 329
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4493070	4493859	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
AVE81080.1|4493070_4493859_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	1.1e-47
>prophage 330
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4510178	4513862	5883411		Dickeya_phage(100.0%)	1	NA	NA
AVE79638.1|4510178_4513862_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 331
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4527669	4536442	5883411		Prochlorococcus_phage(25.0%)	9	NA	NA
AVE79645.1|4527669_4529259_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
AVE79646.1|4529274_4530567_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVE79647.1|4530563_4531898_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
AVE79648.1|4531894_4533283_-	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
AVE79649.1|4533535_4533970_+	zinc resistance-associated protein ZraP	NA	NA	NA	NA	NA
AVE79650.1|4533973_4534666_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AVE79651.1|4534678_4534951_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
AVE79652.1|4535137_4535728_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVE79653.1|4535770_4536442_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	1.9e-21
>prophage 332
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4544987	4564705	5883411		Bacillus_phage(16.67%)	16	NA	NA
AVE79663.1|4544987_4546520_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	2.9e-09
AVE79664.1|4546692_4546998_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVE79665.1|4547001_4547319_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AVE79666.1|4547362_4548703_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AVE79667.1|4549112_4553336_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
AVE79668.1|4553412_4557441_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
AVE79669.1|4557766_4558132_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVE79670.1|4558198_4558696_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVE79671.1|4559115_4559820_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AVE79672.1|4559823_4560252_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AVE79673.1|4560405_4560951_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
AVE79674.1|4560952_4561336_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AVE79675.1|4561357_4561555_-	hypothetical protein	NA	NA	NA	NA	NA
AVE79676.1|4561568_4562753_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
AVE79677.1|4563352_4563535_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79678.1|4563754_4564705_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	2.3e-28
>prophage 333
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4574585	4575200	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE79682.1|4574585_4575200_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 334
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4584405	4590584	5883411		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
AVE79692.1|4584405_4585179_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
AVE79693.1|4585181_4585721_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVE79694.1|4585724_4585976_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVE79695.1|4586053_4587694_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
AVE79696.1|4587690_4588296_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AVE79697.1|4588309_4589065_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AVE79698.1|4589135_4590584_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
>prophage 335
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4601388	4603215	5883411		Catovirus(100.0%)	1	NA	NA
AVE79709.1|4601388_4603215_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 336
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4607064	4610923	5883411		Bacillus_phage(50.0%)	3	NA	NA
AVE79714.1|4607064_4609227_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	7.8e-117
AVE79715.1|4609304_4610021_-	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AVE79716.1|4610020_4610923_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
>prophage 337
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4634285	4640425	5883411		uncultured_marine_virus(20.0%)	6	NA	NA
AVE81085.1|4634285_4635416_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
AVE79735.1|4635420_4636095_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVE79736.1|4636072_4636954_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	66.0	1.5e-106
AVE79737.1|4636971_4638039_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	5.1e-101
AVE79738.1|4638035_4639298_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.2e-26
AVE79739.1|4639294_4640425_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
>prophage 338
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4644475	4655310	5883411		Indivirus(20.0%)	9	NA	NA
AVE79743.1|4644475_4644805_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
AVE79744.1|4645146_4646412_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
AVE79745.1|4646546_4648034_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVE79746.1|4648098_4648839_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVE79747.1|4649060_4650077_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
AVE79748.1|4650095_4651511_+	allantoin permease	NA	NA	NA	NA	NA
AVE79749.1|4651494_4652457_+	ribokinase	NA	NA	NA	NA	NA
AVE79750.1|4652460_4654479_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	3.2e-112
AVE79751.1|4654581_4655310_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
>prophage 339
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4665001	4666648	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVE79760.1|4665001_4666648_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.8	4.8e-66
>prophage 340
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4676849	4678718	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
AVE81088.1|4676849_4678718_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 341
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4693448	4696148	5883411		Cyanophage(50.0%)	3	NA	NA
AVE79779.1|4693448_4694111_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
AVE79780.1|4694166_4695270_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AVE79781.1|4695398_4696148_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.0e-23
>prophage 342
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4708522	4709857	5883411	protease	Erwinia_phage(100.0%)	1	NA	NA
AVE79793.1|4708522_4709857_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 343
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4714475	4718002	5883411		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
AVE79799.1|4714475_4715174_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AVE79800.1|4715170_4716544_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
AVE79801.1|4716635_4717310_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVE79802.1|4717381_4718002_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 344
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4726306	4727818	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE79810.1|4726306_4727818_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	5.1e-14
>prophage 345
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4788728	4789646	5883411		Pandoravirus(100.0%)	1	NA	NA
AVE79866.1|4788728_4789646_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	3.2e-19
>prophage 346
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4796470	4798938	5883411		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVE79873.1|4796470_4797520_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
AVE79874.1|4797528_4798938_+	nitrogen assimilation regulatory protein	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 347
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4802829	4805619	5883411		uncultured_virus(100.0%)	1	NA	NA
AVE79880.1|4802829_4805619_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	2.5e-75
>prophage 348
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4819812	4825691	5883411		Enterobacteria_phage(33.33%)	5	NA	NA
AVE79890.1|4819812_4820703_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
AVE79891.1|4820730_4821696_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVE79892.1|4821701_4823207_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	6.9e-19
AVE79893.1|4823217_4823637_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVE79894.1|4823822_4825691_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
>prophage 349
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4828860	4829853	5883411		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVE79897.1|4828860_4829853_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	4.2e-49
>prophage 350
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4844434	4852037	5883411		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
AVE79912.1|4844434_4845805_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
AVE79913.1|4845987_4847817_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
AVE79914.1|4848133_4849174_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
AVE79915.1|4849173_4849356_+	hypothetical protein	NA	NA	NA	NA	NA
AVE79916.1|4849366_4850326_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVE79917.1|4850325_4851216_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AVE79918.1|4851263_4852037_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
>prophage 351
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4857916	4859254	5883411		Moraxella_phage(100.0%)	1	NA	NA
AVE79924.1|4857916_4859254_+	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	36.2	9.9e-62
>prophage 352
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4866730	4874249	5883411		Staphylococcus_phage(33.33%)	7	NA	NA
AVE79932.1|4866730_4866988_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
AVE79933.1|4866951_4867311_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVE79934.1|4867326_4867467_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVE79935.1|4868088_4869489_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVE79936.1|4869493_4870594_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
AVE79937.1|4870732_4871806_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVE79938.1|4871834_4874249_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
>prophage 353
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4879681	4880830	5883411		Oenococcus_phage(100.0%)	1	NA	NA
AVE79944.1|4879681_4880830_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.5	1.8e-51
>prophage 354
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4884373	4885334	5883411		Cyanophage(50.0%)	2	NA	NA
AVE79947.1|4884373_4884787_+	heat shock protein IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
AVE79948.1|4884905_4885334_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	3.2e-14
>prophage 355
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4896730	4902072	5883411		Salmonella_phage(50.0%)	6	NA	NA
AVE79959.1|4896730_4897915_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
AVE79960.1|4898092_4898926_-	EamA family transporter	NA	NA	NA	NA	NA
AVE79961.1|4898996_4899443_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVE79962.1|4899514_4899604_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVE79963.1|4900185_4900281_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVE79964.1|4900383_4902072_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	9.0e-60
>prophage 356
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4914504	4915617	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE79978.1|4914504_4915617_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 357
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4923838	4924432	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE79986.1|4923838_4924432_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	48.6	1.5e-46
>prophage 358
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4931380	4932346	5883411	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVE79994.1|4931380_4932346_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.0e-68
>prophage 359
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4936833	4938000	5883411		Salmonella_phage(100.0%)	1	NA	NA
AVE79999.1|4936833_4938000_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 360
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4953590	4966128	5883411	integrase	Enterobacteria_phage(40.0%)	13	4949220:4949235	4970429:4970444
4949220:4949235	attL	TCCCCGGAGGCGGCGC	NA	NA	NA	NA
AVE80014.1|4953590_4954640_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
AVE80015.1|4954798_4955101_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVE80016.1|4955102_4956110_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AVE80017.1|4956222_4956690_-	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
AVE80018.1|4956877_4957483_+	shikimate kinase	NA	NA	NA	NA	NA
AVE80019.1|4957479_4958103_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	46.3	1.4e-37
AVE80020.1|4958227_4958515_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
AVE80021.1|4958641_4958833_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVE80022.1|4959216_4960065_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80023.1|4960532_4961357_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	77.4	2.0e-97
AVE80024.1|4962657_4963080_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80025.1|4963076_4964936_-	helicase	NA	A0A097BY72	Enterococcus_phage	20.7	2.5e-10
AVE80026.1|4964955_4966128_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	83.7	7.3e-186
4970429:4970444	attR	GCGCCGCCTCCGGGGA	NA	NA	NA	NA
>prophage 361
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4984277	4985669	5883411		environmental_Halophage(100.0%)	1	NA	NA
AVE80041.1|4984277_4985669_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 362
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4989275	4990127	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVE80044.1|4989275_4990127_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 363
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5001243	5006270	5883411		Bordetella_phage(33.33%)	5	NA	NA
AVE80056.1|5001243_5003364_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
AVE80057.1|5003382_5003658_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVE80058.1|5003712_5004336_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
AVE80059.1|5004419_5004599_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80060.1|5004593_5006270_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.9	2.1e-21
>prophage 364
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5011837	5016576	5883411		Xanthomonas_phage(25.0%)	7	NA	NA
AVE81099.1|5011837_5012293_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	1.8e-47
AVE81101.1|5012273_5013485_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.5	3.8e-44
AVE81100.1|5013660_5014326_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVE80066.1|5014542_5014779_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVE80067.1|5014799_5014967_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVE80068.1|5015166_5015976_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
AVE80069.1|5016099_5016576_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
>prophage 365
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5029438	5038586	5883411		Prochlorococcus_phage(20.0%)	9	NA	NA
AVE80082.1|5029438_5030383_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
AVE80083.1|5030597_5031791_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
AVE80084.1|5031800_5032826_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
AVE80085.1|5032987_5033785_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVE80086.1|5033781_5034669_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVE80087.1|5034720_5035992_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
AVE80088.1|5036001_5037546_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVE80089.1|5037791_5038223_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVE80090.1|5038334_5038586_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
>prophage 366
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5054838	5056680	5883411	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVE80107.1|5054838_5056680_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 367
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5078520	5080062	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE80126.1|5078520_5080062_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.3e-17
>prophage 368
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5085003	5085999	5883411		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVE80131.1|5085003_5085999_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	8.6e-10
>prophage 369
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5090386	5092318	5883411		Erysipelothrix_phage(50.0%)	2	NA	NA
AVE80136.1|5090386_5092006_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	4.8e-26
AVE80137.1|5092105_5092318_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
>prophage 370
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5095676	5096648	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVE80141.1|5095676_5096648_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.1e-17
>prophage 371
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5114774	5120986	5883411		Bacillus_virus(66.67%)	5	NA	NA
AVE80156.1|5114774_5115758_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	2.4e-12
AVE80157.1|5115754_5116768_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
AVE80158.1|5117481_5118060_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AVE80159.1|5118050_5118854_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AVE80160.1|5118874_5120986_+	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
>prophage 372
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5137087	5138200	5883411	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
AVE80173.1|5137087_5138200_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	88.4	7.2e-191
>prophage 373
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5169006	5171084	5883411		Bacillus_phage(100.0%)	2	NA	NA
AVE80193.1|5169006_5170368_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
AVE80194.1|5170364_5171084_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 374
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5182063	5184106	5883411		Indivirus(100.0%)	1	NA	NA
AVE80204.1|5182063_5184106_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.2e-44
>prophage 375
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5196290	5197244	5883411		Cedratvirus(100.0%)	1	NA	NA
AVE80215.1|5196290_5197244_-	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 376
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5200410	5201181	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE80219.1|5200410_5201181_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.5	2.5e-17
>prophage 377
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5207734	5211841	5883411		Tupanvirus(66.67%)	3	NA	NA
AVE80227.1|5207734_5208874_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
AVE80228.1|5208875_5209859_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
AVE80229.1|5209855_5211841_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
>prophage 378
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5218143	5222209	5883411		Dickeya_phage(50.0%)	4	NA	NA
AVE80237.1|5218143_5218809_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	56.3	2.8e-57
AVE81108.1|5218975_5219221_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AVE80238.1|5219299_5221504_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	7.2e-118
AVE80239.1|5221582_5222209_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
>prophage 379
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5225302	5231063	5883411		Staphylococcus_phage(25.0%)	5	NA	NA
AVE80243.1|5225302_5225971_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
AVE81110.1|5225963_5227022_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVE80244.1|5227278_5228133_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AVE80245.1|5228165_5229680_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.1	3.3e-13
AVE80246.1|5229797_5231063_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	6.4e-26
>prophage 380
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5240448	5241947	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AVE80255.1|5240448_5241216_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
AVE81111.1|5241233_5241947_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
>prophage 381
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5250286	5252094	5883411		Planktothrix_phage(50.0%)	2	NA	NA
AVE80263.1|5250286_5251357_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
AVE80264.1|5251353_5252094_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
>prophage 382
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5269967	5272415	5883411		Dickeya_phage(100.0%)	1	NA	NA
AVE80280.1|5269967_5272415_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 383
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5275426	5276185	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE80284.1|5275426_5276185_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.9e-23
>prophage 384
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5279675	5285853	5883411		Iris_mild_mosaic_virus(50.0%)	3	NA	NA
AVE80287.1|5279675_5282066_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
AVE80288.1|5282076_5284170_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AVE80289.1|5284230_5285853_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.1	6.9e-142
>prophage 385
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5300780	5301608	5883411		Vibrio_phage(100.0%)	1	NA	NA
AVE80302.1|5300780_5301608_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 386
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5313924	5326776	5883411		Acinetobacter_phage(14.29%)	12	NA	NA
AVE80315.1|5313924_5314488_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
AVE80316.1|5314577_5315798_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVE80317.1|5315787_5317866_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
AVE80318.1|5317917_5318550_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVE80319.1|5318854_5319259_+	OsmC family protein	NA	NA	NA	NA	NA
AVE80320.1|5319302_5320175_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVE80321.1|5320210_5320429_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
AVE80322.1|5320425_5321448_-	hydrolase	NA	NA	NA	NA	NA
AVE80323.1|5321529_5322249_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	27.3	3.3e-19
AVE80324.1|5322445_5323315_+	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	4.1e-48
AVE81114.1|5323319_5324810_+	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	50.5	1.4e-141
AVE80325.1|5324871_5326776_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
>prophage 387
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5332405	5337977	5883411		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AVE80334.1|5332405_5332792_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
AVE80335.1|5332791_5333151_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AVE80336.1|5333158_5333446_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AVE80337.1|5333570_5333945_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVE80338.1|5334040_5334511_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVE80339.1|5334607_5336722_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
AVE80340.1|5336792_5337977_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
>prophage 388
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5357858	5359330	5883411	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVE80380.1|5357858_5358806_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	2.2e-07
AVE80381.1|5358820_5359330_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
>prophage 389
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5388219	5389263	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVE80406.1|5388219_5389263_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 390
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5408156	5409425	5883411		Oenococcus_phage(100.0%)	1	NA	NA
AVE80424.1|5408156_5409425_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 391
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5416574	5417942	5883411	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVE80430.1|5416574_5417942_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 392
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5421846	5425842	5883411	protease	Pseudomonas_phage(50.0%)	4	NA	NA
AVE81119.1|5421846_5422335_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
AVE80436.1|5422428_5423235_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVE80437.1|5423354_5424248_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVE80438.1|5424354_5425842_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
>prophage 393
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5434550	5448533	5883411		Staphylococcus_phage(28.57%)	16	NA	NA
AVE80445.1|5434550_5435486_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
AVE80446.1|5435617_5437957_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
AVE80447.1|5438191_5438845_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVE80448.1|5438841_5439567_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVE80449.1|5439619_5439892_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVE80450.1|5439888_5440743_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVE80451.1|5440788_5441277_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVE80452.1|5441342_5441630_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVE80453.1|5441652_5443086_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AVE80454.1|5443133_5443859_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AVE80455.1|5443865_5444411_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVE80456.1|5444379_5444955_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVE80457.1|5444951_5445518_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
AVE81120.1|5445532_5446519_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
AVE80458.1|5446533_5447511_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVE80459.1|5447720_5448533_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
>prophage 394
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5452592	5454034	5883411		Vibrio_phage(50.0%)	2	NA	NA
AVE80466.1|5452592_5452865_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
AVE80467.1|5453062_5454034_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
>prophage 395
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5460620	5472264	5883411	protease	Micromonas_pusilla_virus(25.0%)	8	NA	NA
AVE80476.1|5460620_5462555_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
AVE80477.1|5462653_5463502_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
AVE80478.1|5463494_5464832_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVE80479.1|5465061_5465391_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVE80480.1|5465646_5466990_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
AVE80481.1|5467581_5468034_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AVE80482.1|5468061_5469549_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVE80483.1|5469573_5472264_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
>prophage 396
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5477663	5479625	5883411		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVE80490.1|5477663_5479625_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 397
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5484819	5493135	5883411		Bacillus_phage(20.0%)	11	NA	NA
AVE80495.1|5484819_5485323_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
AVE80496.1|5485309_5485594_-	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
AVE80497.1|5485649_5486093_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80498.1|5486072_5486591_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
AVE80499.1|5486719_5487370_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80500.1|5487439_5488480_+	permease	NA	NA	NA	NA	NA
AVE80501.1|5488587_5489163_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVE80502.1|5489172_5489763_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AVE80503.1|5489785_5490172_-	YraN family protein	NA	NA	NA	NA	NA
AVE80504.1|5490129_5492211_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVE80505.1|5492274_5493135_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	9.5e-50
>prophage 398
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5502772	5503582	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE80515.1|5502772_5503582_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	2.5e-28
>prophage 399
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5508850	5509996	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE80520.1|5508850_5509996_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 400
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5526231	5527200	5883411		Escherichia_phage(100.0%)	1	NA	NA
AVE80541.1|5526231_5527200_-	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	34.9	1.0e-39
>prophage 401
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5539628	5541116	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE81123.1|5539628_5541116_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 402
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5552480	5559163	5883411	tRNA	Herpes_simplex_virus(50.0%)	4	NA	NA
AVE80561.1|5552480_5555573_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	2.4e-159
AVE80562.1|5556210_5557194_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVE80563.1|5557413_5557746_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVE80564.1|5557783_5559163_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.5e-33
>prophage 403
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5577004	5582695	5883411	tRNA	Vibrio_phage(33.33%)	4	NA	NA
AVE80579.1|5577004_5578849_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AVE80580.1|5579122_5580868_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
AVE80581.1|5581102_5581318_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVE80582.1|5581681_5582695_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
>prophage 404
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5591879	5593121	5883411		Sinorhizobium_phage(100.0%)	1	NA	NA
AVE80593.1|5591879_5593121_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 405
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5598231	5601516	5883411		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVE80597.1|5598231_5599665_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	1.5e-39
AVE80598.1|5599938_5600148_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AVE80599.1|5600202_5600484_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80600.1|5600862_5601516_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
>prophage 406
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5608848	5610683	5883411		Ralstonia_phage(50.0%)	2	NA	NA
AVE80606.1|5608848_5610009_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	4.8e-89
AVE80607.1|5610014_5610683_-	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
>prophage 407
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5615005	5616901	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE80613.1|5615005_5616901_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 408
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5620192	5630134	5883411		Stx_converting_phage(20.0%)	8	NA	NA
AVE80618.1|5620192_5620600_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
AVE80619.1|5620677_5621547_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE80620.1|5621669_5623928_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
AVE80621.1|5624120_5624858_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVE80622.1|5624942_5626355_+	cell division protein FtsP	NA	NA	NA	NA	NA
AVE80623.1|5626475_5628659_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
AVE80624.1|5628752_5629208_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
AVE80625.1|5629306_5630134_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
>prophage 409
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5649295	5650666	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE80645.1|5649295_5650666_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	35.4	3.3e-44
>prophage 410
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5661723	5662809	5883411		Geobacillus_virus(100.0%)	1	NA	NA
AVE80655.1|5661723_5662809_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 411
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5680823	5681978	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
AVE80677.1|5680823_5681978_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 412
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5689254	5689911	5883411		Bacillus_virus(100.0%)	1	NA	NA
AVE80683.1|5689254_5689911_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 413
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5707404	5708637	5883411		Catovirus(100.0%)	1	NA	NA
AVE80702.1|5707404_5708637_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 414
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5716815	5722718	5883411		Prochlorococcus_phage(50.0%)	4	NA	NA
AVE80711.1|5716815_5719689_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.3	1.3e-263
AVE80712.1|5719749_5720493_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE80713.1|5720602_5721094_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AVE80714.1|5721284_5722718_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.5e-31
>prophage 415
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5734958	5741041	5883411	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
AVE80727.1|5734958_5735855_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
AVE80728.1|5735877_5736591_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVE80729.1|5736596_5738330_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	6.0e-59
AVE80730.1|5738415_5739513_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AVE80731.1|5739523_5741041_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
>prophage 416
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5745698	5751086	5883411	integrase	Clostridium_phage(25.0%)	6	5744882:5744896	5752329:5752343
5744882:5744896	attL	CCTACGGAAGCCGGT	NA	NA	NA	NA
AVE80737.1|5745698_5746424_+	hypothetical protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
AVE80738.1|5746742_5747912_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.1	1.4e-139
AVE80739.1|5748023_5749154_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80740.1|5749143_5750064_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80741.1|5750410_5750779_-	DNA-binding transcriptional regulator RamA	NA	D0R0F8	Streptococcus_phage	27.2	1.8e-05
AVE80742.1|5750834_5751086_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	3.4e-08
5752329:5752343	attR	CCTACGGAAGCCGGT	NA	NA	NA	NA
>prophage 417
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5773219	5774395	5883411		Streptococcus_phage(100.0%)	1	NA	NA
AVE80764.1|5773219_5774395_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	2.0e-42
>prophage 418
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5781757	5783314	5883411		Catovirus(100.0%)	1	NA	NA
AVE80771.1|5781757_5783314_-	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 419
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5790610	5794459	5883411		Escherichia_phage(50.0%)	4	NA	NA
AVE80779.1|5790610_5791384_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
AVE80780.1|5791364_5791718_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80781.1|5791985_5792408_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80782.1|5792905_5794459_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
>prophage 420
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5825509	5828001	5883411		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVE80814.1|5825509_5826271_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
AVE80815.1|5826582_5828001_+	arabinose-proton symporter	NA	O13311	Aichi_virus	28.2	1.6e-25
>prophage 421
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5836087	5837215	5883411		Bacillus_phage(100.0%)	1	NA	NA
AVE80823.1|5836087_5837215_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 422
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5848850	5867885	5883411		Enterobacteria_phage(16.67%)	19	NA	NA
AVE80835.1|5848850_5849861_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.2	1.5e-30
AVE80836.1|5850155_5851493_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AVE80837.1|5851500_5852928_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.5	4.5e-36
AVE80838.1|5852996_5853770_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE80839.1|5853766_5854246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVE80840.1|5854206_5855223_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
AVE80841.1|5855630_5855822_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80842.1|5855845_5858005_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
AVE80843.1|5857997_5859191_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AVE80844.1|5859329_5860370_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AVE80845.1|5860607_5860826_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AVE80846.1|5860950_5861664_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
AVE80847.1|5861745_5862441_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AVE80848.1|5862457_5862682_-	hypothetical protein	NA	NA	NA	NA	NA
AVE80849.1|5862901_5863084_+	hypothetical protein	NA	NA	NA	NA	NA
AVE80850.1|5863123_5863654_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVE80851.1|5863666_5865913_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
AVE80852.1|5866208_5867084_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVE80853.1|5867090_5867885_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
>prophage 423
CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5873359	5881619	5883411		Klosneuvirus(33.33%)	3	NA	NA
AVE80860.1|5873359_5876245_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	2.6e-59
AVE80861.1|5876241_5879787_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
AVE80862.1|5879783_5881619_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
>prophage 1
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	0	46645	189585	integrase,transposase	uncultured_Caudovirales_phage(46.67%)	41	38281:38340	42249:43517
AVE81135.1|1810_3244_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AVE81136.1|3332_4616_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AVE81137.1|4745_6938_-	1,4-alpha-glucan-branching protein	NA	NA	NA	NA	NA
AVE81138.1|7310_8279_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AVE81139.1|8579_8780_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AVE81278.1|13037_13589_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
AVE81140.1|13604_15701_+|transposase	transposase	transposase	NA	NA	NA	NA
AVE81141.1|16092_17097_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81142.1|17307_20316_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
AVE81143.1|20476_21034_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
AVE81144.1|21165_21498_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVE81145.1|21851_23000_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
AVE81146.1|23274_23649_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AVE81147.1|24177_25374_+	MFS transporter	NA	NA	NA	NA	NA
AVE81148.1|25445_26273_-	universal stress protein	NA	NA	NA	NA	NA
AVE81149.1|26291_27770_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AVE81150.1|28253_28607_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AVE81151.1|28702_29986_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AVE81152.1|30035_30464_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AVE81153.1|31127_32132_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE81154.1|32210_32768_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AVE81155.1|32761_33133_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81156.1|33129_33630_-|transposase	transposase	transposase	NA	NA	NA	NA
AVE81157.1|33626_33953_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81158.1|34207_34564_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVE81159.1|34553_34955_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVE81160.1|34951_35242_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVE81161.1|35400_38205_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	72.7	0.0e+00
38281:38340	attL	CTTAGCGTGCTTTATTTAATGAGATGGTCACTCCCTCCTTCCCGGTACTATGCTGAGGAC	NA	NA	NA	NA
AVE81162.1|38363_39368_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE81163.1|39549_40044_-	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.1	2.2e-43
AVE81164.1|40040_40373_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVE81279.1|40862_41039_+|integrase	integrase	integrase	NA	NA	NA	NA
AVE81165.1|41220_42225_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE81166.1|42324_42759_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVE81167.1|42830_43181_+	mercuric transport protein	NA	NA	NA	NA	NA
AVE81168.1|43196_43472_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVE81169.1|43474_43720_+	hypothetical protein	NA	NA	NA	NA	NA
42249:43517	attR	GTCCTCAGCATAGTACCGGGAAGGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAGGCGTAGTTCCCTCGGGCTACACCGCGTCCGCACTGCGCGGTTCTTTCTTCCCTTGCAGTGACGCAATCAGCGGACAGGAAACGTTCCCCTTCCGCGCATGGCAGGCGCACACCAAATCAGACAGCACGGCCTCCATGCGCGCCAGGTCAGCCATCCTCTCGCGCACGTCCTTGAGCTTGTGCTCGGCCAGGCTGCTGGCTTCCTCGCAATGGGTGCCATCCTCCAGCCGCAGCAGCTCGGCGATCTCATCCAGGCTGAAGCCCAACCGCTGGGCTGATTTCACGAAGCGCACCCGCGTTACATCCGTCTCGCCATAGCGGCGAATGCTGCCGTAAGGCTTGTCCGGTTCCGGGAGCAAGCCCTTGCGCTGATAGAACCGGATGGTCTCCACATTGACCCCGGCCGTCCTGGCGAAAACGCCAATGGTCAGGTTCTCCAAATTGTTTTCCATATCGCTTGACTCCGTACATAACTACGGAAGTAAGCTTAAGCTATCCAATTCAGATTCGAAAGGACAAACGTATGTCTGAACCTCAAAACGGGCGCGGCGCGCTCTTCACTGGCGGGCTGGCCGCCATCCTCGCCTCGGCTTGCTGCCTCGGGCCGCTGGTTCTGATCGCCTTGGGGTTCAGCGGCGCTTGGATCGGCAACTTGACGGTGTTGGAACCCTATCGCCCCATCTTTATCGGCGTGGCGCTGGTGGCGTTGTTCTTCGCCTGGCGGCGCATCTACCGGCCGTCAGCCGCCTGCAAACCGGGTGAGGTTTGCGCGATTCCCCAAGTGCGAGCTACTTACAAGCTCATTTTCTGGGGCGTGGCCGTGCTGGTTTTGGTCGCGCTCGGATTTCCCTACGTCGTGCCATTTTTCTATTGATCACAGGAGTTCACCATGAAAAAGCTGCTTTCCGCCCTTGCCCTCGCTGCCGTTGTTGCCCCCGTGTGGGCCGCCACCCAGACCGTTACGCTGTCCGTACCGGGCATGACCTGCTCGGCCTGTCCGATCACTGTCAAGAAGGCGATTTCCAAGGTCGATGGCGTCAGTAAAGTTGACGTGACCTTCGAGACGCGCGAAGCGGTGGTCACCTTCGATGATGCCAAGACCAGCGTGCAGAAACTGACCAAGGCTACCGAGGATGCGGGCTACCCATCATCAGTCAAGAACTGATCATGAAAGACCCGAAGACACTGCTGCGGGTCAGCATCATTGGCA	NA	NA	NA	NA
AVE81170.1|43716_45363_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
AVE81171.1|45379_45745_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AVE81172.1|45741_45978_+	mercury resistance protein	NA	NA	NA	NA	NA
AVE81173.1|46030_46645_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
>prophage 2
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	57015	57567	189585		Wolbachia_phage(100.0%)	1	NA	NA
AVE81281.1|57015_57567_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
>prophage 3
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	65607	65862	189585		Pectobacterium_phage(100.0%)	1	NA	NA
AVE81282.1|65607_65862_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
>prophage 4
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	72553	145988	189585	protease,holin,transposase	uncultured_Caudovirales_phage(21.74%)	65	NA	NA
AVE81192.1|72553_73525_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AVE81193.1|73524_74691_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
AVE81194.1|75442_76453_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AVE81195.1|77170_77911_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AVE81284.1|79054_80002_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
AVE81196.1|80028_80340_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVE81197.1|80359_81328_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
AVE81198.1|82000_82258_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81199.1|82877_84314_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVE81200.1|85296_86574_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AVE81201.1|86636_88640_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AVE81285.1|89673_90881_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AVE81202.1|92309_92741_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVE81203.1|92991_94467_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVE81204.1|94459_95140_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AVE81205.1|95329_96715_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81206.1|96743_97097_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE81207.1|97210_98503_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVE81208.1|98513_101660_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AVE81209.1|101746_102187_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81210.1|102313_104767_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
AVE81211.1|104807_105005_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVE81212.1|105038_105776_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AVE81213.1|106747_108565_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVE81214.1|108564_109461_+	copper resistance protein B	NA	NA	NA	NA	NA
AVE81215.1|109500_109881_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVE81216.1|109885_110815_+	copper resistance protein D	NA	NA	NA	NA	NA
AVE81217.1|110869_111550_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVE81218.1|111546_112947_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AVE81219.1|113163_113598_+	copper-binding protein	NA	NA	NA	NA	NA
AVE81286.1|113829_114009_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVE81220.1|115751_116261_+	porin	NA	NA	NA	NA	NA
AVE81221.1|116310_116808_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVE81222.1|117139_117466_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE81287.1|117465_118176_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AVE81223.1|118184_118730_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AVE81224.1|118805_119168_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVE81225.1|121064_121601_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVE81226.1|121633_122059_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AVE81227.1|122071_123361_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AVE81228.1|123408_125160_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVE81229.1|125177_125540_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVE81230.1|125589_125940_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AVE81231.1|126297_126567_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81232.1|126554_127130_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81233.1|127160_127655_+	DNA-binding protein	NA	NA	NA	NA	NA
AVE81234.1|127698_128067_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81235.1|128100_128304_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVE81236.1|128352_128610_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81237.1|128685_128940_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81238.1|129115_129382_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVE81239.1|129369_129852_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVE81240.1|130052_131456_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AVE81241.1|131484_132117_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81288.1|132342_133689_+|transposase	transposase	transposase	NA	NA	NA	NA
AVE81242.1|133737_134133_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVE81243.1|135622_136585_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVE81244.1|136571_137321_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVE81245.1|137558_137756_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81246.1|137755_140551_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AVE81247.1|140674_141244_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVE81289.1|141278_141560_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AVE81248.1|143495_144503_-	formamidase	NA	NA	NA	NA	NA
AVE81249.1|144538_145228_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
AVE81250.1|145238_145988_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
>prophage 5
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	149587	159811	189585	transposase	Hokovirus(25.0%)	5	NA	NA
AVE81253.1|149587_152968_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
AVE81254.1|152930_153851_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
AVE81255.1|154847_155816_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
AVE81256.1|156095_157118_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AVE81257.1|158675_159811_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.1	2.3e-75
>prophage 6
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	163550	164861	189585		Enterobacteria_phage(100.0%)	1	NA	NA
AVE81260.1|163550_164861_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
>prophage 7
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	171907	172612	189585	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVE81265.1|171907_172612_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	176847	177615	189585		Bacillus_virus(100.0%)	1	NA	NA
AVE81292.1|176847_177615_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.8e-28
>prophage 9
CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	187172	188816	189585		Streptococcus_phage(100.0%)	1	NA	NA
AVE81276.1|187172_188816_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
>prophage 1
CP026717	Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence	80970	59860	67059	80970	transposase	Aeromonas_phage(28.57%)	10	NA	NA
AVE81353.1|59860_60562_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
AVE81354.1|60996_61227_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81355.1|61430_61676_+	DinI family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
AVE81386.1|61672_62122_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
AVE81356.1|62133_63408_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
AVE81357.1|63582_63810_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81358.1|63854_64481_-	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
AVE81359.1|65078_65699_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
AVE81360.1|65718_65985_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81361.1|66105_67059_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
>prophage 1
CP026718	Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence	91175	25516	63913	91175	transposase	Stx2-converting_phage(20.0%)	34	NA	NA
AVE81408.1|25516_26494_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	59.9	4.4e-75
AVE81467.1|26451_26640_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81409.1|26957_28385_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
AVE81410.1|28401_29001_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AVE81411.1|29036_30626_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.6	9.7e-173
AVE81412.1|30656_31007_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	9.6e-41
AVE81413.1|31003_31408_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	67.5	1.6e-23
AVE81414.1|31540_32611_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AVE81415.1|33207_34308_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AVE81416.1|34447_36373_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVE81417.1|36350_36899_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AVE81418.1|36900_37266_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81419.1|37335_38499_-	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AVE81420.1|38536_38965_-	heme-binding protein	NA	NA	NA	NA	NA
AVE81468.1|39358_41026_+	propanediol dehydratase	NA	NA	NA	NA	NA
AVE81421.1|41039_41630_+	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
AVE81422.1|41626_42058_+	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AVE81423.1|42070_43918_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AVE81424.1|43961_44978_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	3.2e-185
AVE81425.1|45015_45201_-	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	7.6e-13
AVE81426.1|45187_46441_-	MFS transporter	NA	NA	NA	NA	NA
AVE81427.1|46492_49567_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.9	0.0e+00
AVE81428.1|49688_50771_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AVE81429.1|50975_51670_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
AVE81430.1|51709_51955_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81431.1|51955_52927_-	lysophospholipase	NA	NA	NA	NA	NA
AVE81432.1|54157_54790_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81433.1|56552_57359_-	SecC motif-containing protein	NA	NA	NA	NA	NA
AVE81434.1|57367_57808_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81435.1|58039_59401_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.0	1.8e-05
AVE81436.1|59414_60218_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVE81469.1|60275_61622_-|transposase	transposase	transposase	NA	NA	NA	NA
AVE81437.1|61848_62481_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81438.1|62509_63913_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
