The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	1089526	1101480	4012640		Mycobacterium_phage(25.0%)	12	NA	NA
AVB29551.1|1089526_1090726_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
AVB29552.1|1091334_1092303_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
AVB29553.1|1092328_1094455_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	3.4e-205
AVB29554.1|1094483_1094888_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
AVB29555.1|1094899_1095124_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AVB29556.1|1095405_1095879_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AVB29557.1|1096043_1096286_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	6.9e-22
AVB29558.1|1097353_1097728_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AVB29559.1|1097743_1098709_-	lipoyl synthase	NA	NA	NA	NA	NA
AVB29560.1|1098810_1099455_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AVB32108.1|1099806_1100070_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29561.1|1100268_1101480_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	1137378	1185715	4012640	terminase,tail,lysis,integrase	Cronobacter_phage(19.15%)	73	1137292:1137310	1196458:1196476
1137292:1137310	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
AVB29593.1|1137378_1138380_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	9.7e-70
AVB29594.1|1138336_1138582_-	excisionase	NA	NA	NA	NA	NA
AVB29595.1|1138578_1138899_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
AVB29596.1|1139225_1139501_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29597.1|1139493_1139721_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
AVB29598.1|1139773_1140358_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29599.1|1140429_1140726_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29600.1|1140790_1141471_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.8	9.8e-66
AVB32110.1|1141473_1141653_-	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	93.0	2.2e-25
AVB29601.1|1141690_1141891_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29602.1|1141906_1142488_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	82.9	1.5e-46
AVB29603.1|1142477_1143176_-	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	61.6	6.3e-76
AVB29604.1|1143172_1144057_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.5	7.7e-95
AVB29605.1|1144053_1144305_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	4.1e-38
AVB29606.1|1144301_1144565_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29607.1|1144816_1145044_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29608.1|1145166_1145442_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29609.1|1145606_1145792_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29610.1|1146126_1146339_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29611.1|1146445_1146766_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	5.0e-20
AVB29612.1|1147141_1147897_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVB29613.1|1147893_1148454_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29614.1|1148504_1148846_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
AVB29615.1|1148854_1149499_-	LexA family transcriptional repressor	NA	A0A077KGZ5	Edwardsiella_phage	64.5	9.6e-79
AVB29616.1|1149604_1149814_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
AVB29617.1|1149959_1150307_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
AVB29618.1|1150572_1151319_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	35.0	4.3e-22
AVB29619.1|1151318_1152704_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
AVB29620.1|1152729_1153179_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
AVB29621.1|1153257_1153548_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
AVB29622.1|1153544_1153901_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
AVB29623.1|1153900_1154533_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
AVB29624.1|1154842_1155364_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AVB29625.1|1155522_1155945_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29626.1|1155998_1156268_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
AVB29627.1|1156267_1156738_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	5.2e-50
AVB29628.1|1156880_1157342_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	1.7e-24
AVB29629.1|1157689_1158274_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
AVB29630.1|1158270_1158477_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29631.1|1158659_1159268_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
AVB29632.1|1159270_1160758_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.8	1.3e-264
AVB29633.1|1160757_1162128_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	5.3e-119
AVB29634.1|1162124_1163246_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	6.1e-105
AVB29635.1|1163357_1164119_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
AVB29636.1|1164132_1165086_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	2.4e-126
AVB29637.1|1165413_1165893_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
AVB29638.1|1165895_1166246_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	41.6	5.1e-18
AVB29639.1|1166247_1166829_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.8e-47
AVB29640.1|1166825_1167227_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29641.1|1167272_1167929_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
AVB29642.1|1167980_1168286_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	54.5	1.1e-21
AVB29643.1|1168312_1168591_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	3.9e-13
AVB29644.1|1168682_1169054_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	64.7	1.3e-35
AVB29645.1|1169067_1169250_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
AVB29646.1|1169640_1169844_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29647.1|1169818_1170316_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AVB29648.1|1170575_1171412_-	hypothetical protein	NA	I6S627	Salmonella_phage	59.6	1.3e-72
AVB29649.1|1171576_1171966_+	transcriptional regulator	NA	NA	NA	NA	NA
AVB29650.1|1172118_1172520_+	hypothetical protein	NA	NA	NA	NA	NA
AVB32111.1|1172632_1172905_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29651.1|1172972_1173206_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29652.1|1173331_1174153_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
AVB29653.1|1174213_1177144_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.6	3.6e-133
AVB29654.1|1177155_1177446_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29655.1|1177465_1177666_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29656.1|1177809_1178151_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
AVB29657.1|1178147_1178891_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.8	2.6e-88
AVB29658.1|1178887_1179598_+	peptidase P60	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
AVB29659.1|1179594_1180182_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.9	7.2e-57
AVB29660.1|1180233_1184427_+	host specificity protein	NA	F1C571	Cronobacter_phage	54.5	1.0e-301
AVB29661.1|1184420_1184789_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29662.1|1184790_1185405_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29663.1|1185454_1185715_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
1196458:1196476	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 3
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	1362503	1441419	4012640	protease,plate,tRNA	Bacillus_phage(23.53%)	57	NA	NA
AVB29811.1|1362503_1362818_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
AVB29812.1|1362848_1365143_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
AVB29813.1|1365262_1365481_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVB29814.1|1365800_1366493_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVB29815.1|1366494_1368246_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.8	5.2e-18
AVB29816.1|1368248_1370018_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
AVB29817.1|1370159_1371119_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
AVB29818.1|1371661_1372156_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AVB29819.1|1372283_1376072_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
AVB29820.1|1376184_1376790_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVB32116.1|1376800_1378150_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
AVB29821.1|1378283_1379573_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
AVB29822.1|1379752_1380085_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29823.1|1380484_1381534_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AVB29824.1|1381606_1382512_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29825.1|1382868_1383609_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
AVB29826.1|1383716_1385999_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
AVB29827.1|1386053_1386908_-	formate transporter FocA	NA	NA	NA	NA	NA
AVB29828.1|1387577_1389335_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AVB29829.1|1389562_1390600_+	L-asparaginase 2	NA	NA	NA	NA	NA
AVB29830.1|1390674_1391928_-	hemagglutinin	NA	NA	NA	NA	NA
AVB29831.1|1392064_1393495_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	7.5e-07
AVB29832.1|1393631_1394720_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
AVB29833.1|1394916_1396203_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVB29834.1|1396490_1397168_+	cytidylate kinase	NA	NA	NA	NA	NA
AVB29835.1|1397349_1399023_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVB29836.1|1399087_1399375_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
AVB29837.1|1399800_1402170_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
AVB29838.1|1402206_1403952_+	lipid ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	1.1e-60
AVB29839.1|1403948_1404950_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVB29840.1|1405445_1405661_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AVB29841.1|1406075_1406255_+	hypothetical protein	NA	NA	NA	NA	NA
AVB29842.1|1406259_1407021_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVB29843.1|1407143_1407974_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVB29844.1|1408353_1409127_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVB29845.1|1409136_1410459_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVB29846.1|1410439_1411171_+	condensin subunit E	NA	NA	NA	NA	NA
AVB29847.1|1411167_1415625_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVB29848.1|1415907_1416561_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
AVB29849.1|1416966_1417680_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AVB29850.1|1418022_1419738_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AVB29851.1|1420069_1420618_+	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AVB29852.1|1420667_1421318_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVB29853.1|1421410_1421884_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVB29854.1|1421974_1423711_-	type VI secretion protein	NA	NA	NA	NA	NA
AVB29855.1|1423703_1425059_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29856.1|1428636_1430100_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVB29857.1|1430105_1430756_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AVB29858.1|1430757_1431546_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVB29859.1|1431549_1434261_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
AVB29860.1|1434269_1435025_-	hypothetical protein	NA	NA	NA	NA	NA
AVB29861.1|1435017_1436385_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVB29862.1|1436377_1436929_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVB32117.1|1436930_1438199_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVB29863.1|1438203_1439241_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVB29864.1|1439204_1440980_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVB29865.1|1440987_1441419_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	1596103	1677148	4012640	protease,integrase,tRNA,capsid,terminase,head,lysis,portal,tail	Enterobacteria_phage(20.0%)	95	1608367:1608384	1648640:1648657
AVB29996.1|1596103_1597207_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVB29997.1|1597312_1597765_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVB29998.1|1597757_1598387_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVB29999.1|1598525_1599779_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
AVB30000.1|1599888_1601022_-|integrase	integrase	integrase	Q77Z04	Phage_21	72.2	6.5e-155
AVB30001.1|1600996_1601248_-	excisionase	NA	NA	NA	NA	NA
AVB30002.1|1601333_1601858_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
AVB30003.1|1602142_1602775_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
AVB30004.1|1602875_1603082_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
AVB30005.1|1603119_1603596_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
AVB30006.1|1603658_1603868_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30007.1|1603857_1604037_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
AVB32122.1|1604594_1605110_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
AVB30008.1|1605131_1605938_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
AVB30009.1|1605934_1606960_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
AVB30010.1|1607259_1608339_+	(p)ppGpp synthetase	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
1608367:1608384	attL	TTAAGTGGCCTTCTTTAT	NA	NA	NA	NA
AVB30011.1|1608842_1609241_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
AVB30012.1|1609580_1609793_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
AVB30013.1|1610194_1610716_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AVB30014.1|1611039_1611375_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVB30015.1|1611477_1612404_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVB30016.1|1612820_1613249_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30017.1|1613401_1613653_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30018.1|1614096_1614366_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
AVB30019.1|1614365_1614836_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
AVB30020.1|1614978_1615440_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
AVB30021.1|1616337_1616676_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
AVB30022.1|1616678_1616891_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
AVB30023.1|1617013_1617481_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
AVB30024.1|1617434_1619168_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
AVB30025.1|1619167_1620436_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
AVB30026.1|1620453_1621122_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
AVB30027.1|1621125_1622292_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
AVB30028.1|1622330_1622630_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
AVB30029.1|1622629_1622959_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVB30030.1|1622948_1623422_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.6	2.8e-11
AVB30031.1|1623427_1623769_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AVB30032.1|1623778_1624444_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30033.1|1624508_1624925_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30034.1|1624921_1625200_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AVB30035.1|1625224_1625416_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AVB30036.1|1625542_1628818_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
AVB30037.1|1628818_1629415_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
AVB30038.1|1629414_1629996_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
AVB30039.1|1630012_1630348_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
AVB30040.1|1630426_1630825_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
AVB30041.1|1635231_1635567_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AVB30042.1|1635710_1635959_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVB30043.1|1636012_1638322_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
AVB30044.1|1638882_1639083_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	3.3e-22
AVB30045.1|1639198_1639873_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30046.1|1639859_1640996_-|integrase	integrase	integrase	O21925	Phage_21	60.9	8.8e-128
AVB30047.1|1640976_1641219_-	excisionase	NA	NA	NA	NA	NA
AVB30048.1|1641475_1642135_-	phage repressor protein	NA	H9C160	Pectobacterium_phage	44.0	3.8e-46
AVB30049.1|1642453_1643527_+	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	4.9e-27
AVB30050.1|1643539_1643938_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
AVB30051.1|1644159_1644420_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVB30052.1|1644574_1644832_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVB30053.1|1644837_1645110_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
AVB30054.1|1645416_1645623_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30055.1|1645926_1646949_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	68.0	5.0e-130
AVB30056.1|1647067_1647865_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	37.8	3.4e-41
AVB30057.1|1647861_1648599_+	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	46.3	6.5e-55
AVB30058.1|1648744_1649014_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
1648640:1648657	attR	TTAAGTGGCCTTCTTTAT	NA	NA	NA	NA
AVB30059.1|1649013_1649484_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.2	1.2e-49
AVB30060.1|1649626_1650091_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.7	9.1e-23
AVB30061.1|1650134_1650716_-	hypothetical protein	NA	NA	NA	NA	NA
AVB32123.1|1651103_1652180_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AVB30062.1|1652231_1653971_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30063.1|1654526_1654748_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30064.1|1655292_1655805_+	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
AVB30065.1|1655817_1656312_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	65.6	2.3e-48
AVB30066.1|1656308_1658411_+	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	68.6	2.9e-294
AVB30067.1|1658407_1658623_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
AVB30068.1|1658619_1660110_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	3.1e-189
AVB30069.1|1660075_1662064_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	63.9	3.0e-248
AVB30070.1|1662152_1662494_+	DUF2190 domain-containing protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
AVB30071.1|1662505_1662778_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
AVB32124.1|1662787_1663351_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
AVB32125.1|1663350_1663746_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
AVB30072.1|1663757_1664279_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	73.4	8.3e-65
AVB30073.1|1664290_1664680_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	39.8	1.9e-13
AVB30074.1|1664700_1665021_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	40.6	4.4e-16
AVB30075.1|1664989_1667983_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	33.8	4.9e-109
AVB30076.1|1667983_1668313_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	52.8	2.1e-26
AVB30077.1|1668407_1668983_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
AVB30078.1|1669035_1669740_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.6	4.6e-66
AVB30079.1|1669761_1670490_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.8e-89
AVB30080.1|1670459_1671044_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	3.1e-44
AVB30081.1|1671058_1674262_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	55.3	3.2e-276
AVB30082.1|1674251_1674584_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30083.1|1674583_1675270_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30084.1|1675266_1675533_+	hypothetical protein	NA	NA	NA	NA	NA
AVB30085.1|1675549_1675873_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	61.3	1.5e-24
AVB30086.1|1675873_1677148_+	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	52.7	3.1e-97
>prophage 5
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	1961152	1971144	4012640		Escherichia_phage(66.67%)	9	NA	NA
AVB30324.1|1961152_1963210_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
AVB30325.1|1963221_1964922_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVB30326.1|1964924_1965008_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVB30327.1|1965257_1965944_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AVB30328.1|1965943_1966405_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
AVB30329.1|1966457_1967069_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
AVB30330.1|1967208_1968069_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	2.1e-25
AVB30331.1|1968070_1968688_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
AVB30332.1|1968699_1971144_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.4	7.3e-220
>prophage 6
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	2509541	2528345	4012640	lysis,holin	Burkholderia_phage(26.67%)	22	NA	NA
AVB30815.1|2509541_2511980_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.3	5.5e-260
AVB30816.1|2511991_2512609_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
AVB30817.1|2512612_2513389_+	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	8.6e-42
AVB30818.1|2513504_2514047_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
AVB30819.1|2514615_2514795_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AVB30820.1|2514898_2516104_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
AVB30821.1|2516109_2516766_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
AVB30822.1|2516762_2517950_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	3.2e-72
AVB30823.1|2517942_2518287_-	hypothetical protein	NA	NA	NA	NA	NA
AVB30824.1|2518283_2518976_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	8.8e-30
AVB30825.1|2518978_2519791_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AVB30826.1|2519759_2520080_-	hypothetical protein	NA	NA	NA	NA	NA
AVB30827.1|2520092_2520581_-	hypothetical protein	NA	NA	NA	NA	NA
AVB30828.1|2520583_2522887_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
AVB30829.1|2522969_2523428_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
AVB30830.1|2523487_2523940_-	hypothetical protein	NA	NA	NA	NA	NA
AVB30831.1|2523950_2525438_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
AVB30832.1|2525446_2525959_-	hypothetical protein	NA	NA	NA	NA	NA
AVB30833.1|2525995_2526445_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVB30834.1|2526441_2526846_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
AVB30835.1|2526848_2527148_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
AVB30836.1|2527529_2528345_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 7
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	3001598	3044847	4012640	integrase,tRNA,terminase,holin,lysis,portal,coat,tail	Proteus_phage(25.0%)	61	3001369:3001424	3040447:3040502
3001369:3001424	attL	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVB31216.1|3001598_3001829_+	DNA polymerase II	NA	A0A1P8DTI0	Proteus_phage	93.4	2.4e-32
AVB31217.1|3001893_3004155_-	hypothetical protein	NA	C6ZR19	Salmonella_phage	38.6	3.9e-58
AVB31218.1|3004268_3006299_-	DNA transfer protein	NA	Q716G2	Shigella_phage	49.6	8.6e-166
AVB31219.1|3006298_3007744_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	41.9	2.0e-84
AVB31220.1|3007753_3008428_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.0	8.8e-59
AVB31221.1|3008421_3008883_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	70.7	2.1e-59
AVB31222.1|3008882_3009581_-|tail	phage tail protein	tail	A0A2H4FWI9	Salmonella_phage	66.1	3.2e-35
AVB32155.1|3009580_3010819_-	hypothetical protein	NA	B6SCW0	Bacteriophage	69.5	1.3e-145
AVB31223.1|3011333_3011831_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	61.9	7.4e-47
AVB31224.1|3011808_3012012_-	hypothetical protein	NA	NA	NA	NA	NA
AVB31225.1|3012063_3013347_-|coat	coat protein	coat	G5DA99	Enterobacteria_phage	67.6	1.3e-167
AVB31226.1|3013346_3014261_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.5	1.1e-91
AVB31227.1|3014275_3016366_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.2	3.4e-234
AVB31228.1|3016368_3017865_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	85.1	3.1e-266
AVB31229.1|3017839_3018331_-	DNA-packaging protein	NA	I6S1J2	Salmonella_phage	79.1	5.6e-71
AVB31230.1|3018339_3018699_-	hypothetical protein	NA	R9VYK9	Serratia_phage	38.7	3.1e-18
AVB32156.1|3018753_3018981_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	53.4	3.9e-11
AVB31231.1|3019113_3019569_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	50.0	1.6e-27
AVB31232.1|3019565_3019970_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	44.9	2.9e-25
AVB31233.1|3019962_3020250_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AVB31234.1|3020246_3020636_-	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
AVB31235.1|3021225_3021729_-	antiterminator	NA	A0A1P8DTF1	Proteus_phage	94.0	2.2e-86
AVB31236.1|3021725_3021917_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	2.3e-28
AVB31237.1|3022069_3022663_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	86.2	1.0e-87
AVB31238.1|3022774_3023437_-	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	60.0	4.1e-69
AVB31239.1|3023579_3024023_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	55.3	2.8e-37
AVB31240.1|3024024_3024234_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	95.2	1.0e-29
AVB31241.1|3024258_3024564_-	hypothetical protein	NA	NA	NA	NA	NA
AVB31242.1|3024563_3024803_-	hypothetical protein	NA	NA	NA	NA	NA
AVB31243.1|3024789_3025011_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVB32157.1|3025197_3026565_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.4	5.1e-162
AVB31244.1|3026568_3027414_-	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	54.3	4.0e-69
AVB31245.1|3027406_3027586_-	hypothetical protein	NA	G9L679	Escherichia_phage	59.6	2.9e-09
AVB31246.1|3027851_3028193_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	4.6e-48
AVB31247.1|3028323_3028509_-	hypothetical protein	NA	NA	NA	NA	NA
AVB31248.1|3028616_3029318_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	46.2	4.4e-45
AVB31249.1|3029348_3029654_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31250.1|3030175_3030448_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	96.7	6.3e-40
AVB31251.1|3030472_3030922_-	hypothetical protein	NA	NA	NA	NA	NA
AVB31252.1|3031215_3031533_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31253.1|3031596_3031944_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31254.1|3031946_3032267_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31255.1|3032457_3032703_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	43.9	3.6e-10
AVB31256.1|3032796_3033738_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	3.0e-20
AVB31257.1|3033821_3034004_+	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
AVB31258.1|3034131_3034383_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	92.8	3.5e-37
AVB31259.1|3034379_3035264_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.5	8.5e-94
AVB31260.1|3035260_3035959_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.8	3.1e-75
AVB31261.1|3035948_3036449_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	69.7	1.0e-51
AVB31262.1|3036461_3036647_+	hook protein	NA	NA	NA	NA	NA
AVB31263.1|3036676_3036856_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31264.1|3036865_3037069_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31265.1|3037061_3037415_+	hypothetical protein	NA	NA	NA	NA	NA
AVB31266.1|3037892_3038231_+	protein ninX	NA	A0A2I7QNI7	Vibrio_phage	38.0	1.8e-12
AVB31267.1|3038220_3038766_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	62.6	4.6e-58
AVB31268.1|3038850_3039045_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	5.1e-28
AVB31269.1|3039278_3040436_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.4	4.7e-177
AVB31270.1|3040724_3041597_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3040447:3040502	attR	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVB31271.1|3041600_3041813_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVB31272.1|3042448_3043390_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AVB31273.1|3043455_3044847_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 8
CP026581	Proteus mirabilis isolate GN2 chromosome, complete genome	4012640	3297959	3306803	4012640		Caulobacter_phage(50.0%)	9	NA	NA
AVB31474.1|3297959_3299528_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
AVB31475.1|3299928_3300609_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AVB31476.1|3300705_3301281_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AVB31477.1|3301357_3301936_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
AVB31478.1|3302003_3303029_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
AVB31479.1|3303063_3303519_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AVB31480.1|3303543_3304680_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AVB31481.1|3304680_3305265_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	9.4e-17
AVB31482.1|3305657_3306803_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
