The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	465913	513200	4829687	lysis,head,terminase,portal,capsid,integrase,tRNA,tail	Enterobacteria_phage(60.0%)	60	458548:458563	520706:520721
458548:458563	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
AVF98703.1|465913_467020_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVF98704.1|467073_467535_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVF98705.1|467544_468198_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AVF98706.1|468369_469620_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AVF98707.1|469733_470876_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AVF98708.1|470865_471102_-	excisionase	NA	NA	NA	NA	NA
AVF98709.1|471241_471481_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AVF98710.1|471464_471791_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AVF98711.1|471790_472012_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AVF98712.1|472110_472392_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AVF98713.1|472402_472594_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AVF98714.1|472566_472749_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AVF98715.1|472745_473426_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	1.0e-131
AVF98716.1|473422_474208_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVF98717.1|474213_474510_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
AVF98718.1|474585_474792_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.1	3.5e-27
AVF98719.1|475267_476131_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
AVF98720.1|476197_476953_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVF98721.1|476991_477222_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVF98722.1|477291_477831_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
AVF98723.1|477827_478847_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	67.3	1.3e-109
AVF98724.1|478843_479545_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	3.0e-126
AVF98725.1|479794_484060_+	adhesin	NA	NA	NA	NA	NA
AVF98726.1|484096_485140_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVF98727.1|485489_485591_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98728.1|485587_486043_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	4.5e-59
AVF98729.1|486042_486213_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AVF98730.1|486205_486496_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
AVF98731.1|486492_486855_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
AVF98732.1|486851_486992_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
AVF98733.1|487077_487461_+	antitermination protein	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
AVF98734.1|487649_488732_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AVF98735.1|489321_489537_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.5e-33
AVF98736.1|489536_490034_+	lysozyme	NA	A5LH83	Enterobacteria_phage	99.4	1.7e-91
AVF98737.1|490030_490474_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	92.5	4.3e-70
AVF98738.1|490512_490887_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.5e-47
AVF98739.1|490985_491168_-	hypothetical protein	NA	NA	NA	NA	NA
AVF98740.1|491204_491396_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98741.1|491477_492026_+|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVF98742.1|491997_493926_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
AVF98743.1|493909_494116_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AVF98744.1|494112_495705_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
AVF98745.1|495694_497200_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	7.9e-100
AVF98746.1|497236_497584_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
AVF98747.1|497641_498670_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
AVF98748.1|498673_499096_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98749.1|499088_499442_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
AVF98750.1|499453_500032_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
AVF98751.1|500028_500424_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
AVG02762.1|500431_501172_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.4	4.3e-131
AVF98752.1|501187_501610_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
AVF98753.1|501591_502026_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVF98754.1|502018_504580_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.4	0.0e+00
AVF98755.1|504576_504906_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
AVF98756.1|504905_505604_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AVF98757.1|505608_506352_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
AVF98758.1|506249_506921_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.4	9.3e-101
AVF98759.1|506981_510464_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AVF98760.1|510522_512922_+|tail	phage tail protein	tail	I1TE37	Escherichia_virus	38.6	1.0e-72
AVF98761.1|512918_513200_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	45.7	2.9e-16
520706:520721	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 2
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	830559	873560	4829687	lysis,portal,terminase,transposase,tail	Enterobacteria_phage(58.54%)	55	NA	NA
AVF99051.1|830559_833031_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVF99052.1|833124_833316_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVF99053.1|833312_833501_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVF99054.1|833756_834002_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99055.1|833987_834605_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99056.1|834564_834720_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AVF99057.1|834912_835371_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AVF99058.1|835397_835625_+	transcriptional regulator	NA	NA	NA	NA	NA
AVF99059.1|835608_836130_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99060.1|836056_837076_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.2e-55
AVF99061.1|837116_837539_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
AVF99062.1|837535_837769_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AVF99063.1|837822_838488_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99064.1|839043_839256_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
AVF99065.1|839472_839724_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99066.1|839790_840069_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99067.1|840070_841120_+	hypothetical protein	NA	U5P0K4	Shigella_phage	57.0	4.8e-112
AVF99068.1|841133_841886_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
AVF99069.1|842561_842777_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVF99070.1|843530_843746_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVF99071.1|843750_844062_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVF99072.1|844058_844592_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVF99073.1|844588_845086_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AVF99074.1|845449_845662_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVF99075.1|845672_845861_+	cold-shock protein	NA	NA	NA	NA	NA
AVF99076.1|845891_846164_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99077.1|846335_846509_+	protein GnsB	NA	NA	NA	NA	NA
AVF99078.1|846660_847071_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AVF99079.1|847016_847217_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	4.5e-11
AVF99080.1|847371_847578_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AVF99081.1|848122_849496_+|transposase	IS4 family transposase ISEc13	transposase	NA	NA	NA	NA
AVF99082.1|849697_850237_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AVF99083.1|850245_852345_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.6	0.0e+00
AVF99084.1|852341_852554_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVF99085.1|852553_854062_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
AVF99086.1|854006_856034_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AVF99087.1|856075_856444_+	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	100.0	9.7e-52
AVF99088.1|856436_856712_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVF99089.1|856723_857314_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
AVF99090.1|857310_857712_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
AVF99091.1|857722_858466_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
AVG02775.1|858526_858913_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AVF99092.1|858921_859251_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AVF99093.1|859222_862288_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.3	0.0e+00
AVF99094.1|862287_862617_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVF99095.1|862626_863325_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	6.6e-134
AVF99096.1|863329_864073_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	9.2e-150
AVF99097.1|863970_864618_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	2.5e-111
AVF99098.1|864678_868092_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
AVF99099.1|868152_870525_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
AVF99100.1|870524_870806_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
AVF99101.1|870815_871856_+	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
AVG02776.1|871898_872192_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99102.1|872419_873010_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVF99103.1|873326_873560_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 3
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1418008	1424315	4829687		Enterobacteria_phage(50.0%)	6	NA	NA
AVF99631.1|1418008_1418554_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
AVF99632.1|1418558_1419437_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
AVF99633.1|1419495_1420395_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
AVF99634.1|1420394_1421480_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
AVF99635.1|1421852_1422746_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVF99636.1|1422920_1424315_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
>prophage 4
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1461418	1575367	4829687	lysis,holin,head,portal,terminase,transposase,capsid,tRNA,tail	Enterobacteria_phage(40.0%)	118	NA	NA
AVF99666.1|1461418_1462792_-|transposase	IS4 family transposase ISEc13	transposase	NA	NA	NA	NA
AVF99667.1|1462808_1463024_+	hypothetical protein	NA	NA	NA	NA	NA
AVG02809.1|1463203_1463260_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99668.1|1463538_1464786_+	multidrug transporter subunit MdtA	NA	NA	NA	NA	NA
AVF99669.1|1464785_1467908_+	multidrug transporter subunit MdtB	NA	NA	NA	NA	NA
AVF99670.1|1467908_1470986_+	multidrug transporter subunit MdtC	NA	NA	NA	NA	NA
AVF99671.1|1470986_1472402_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
AVF99672.1|1472398_1473802_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
AVF99673.1|1473798_1474521_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVF99674.1|1474700_1475033_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVF99675.1|1475179_1476541_+	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
AVG02810.1|1477040_1477358_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99676.1|1477773_1478673_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AVF99677.1|1478754_1479534_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVF99678.1|1479633_1480674_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AVF99679.1|1482079_1482364_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AVF99680.1|1482394_1482847_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AVF99681.1|1482856_1484119_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
AVF99682.1|1484147_1485002_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AVF99683.1|1485228_1486281_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVF99684.1|1486537_1487815_+	MFS transporter	NA	NA	NA	NA	NA
AVF99685.1|1487811_1488816_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.0e-14
AVF99686.1|1488812_1489778_+	sugar kinase	NA	NA	NA	NA	NA
AVF99687.1|1489751_1490498_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVF99688.1|1490549_1491368_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
AVF99689.1|1491432_1492233_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVF99690.1|1492229_1493018_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AVF99691.1|1493240_1493513_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF99692.1|1493633_1494458_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AVF99693.1|1494676_1495015_+	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AVF99694.1|1495201_1496575_+|transposase	IS4 family transposase ISEc13	transposase	NA	NA	NA	NA
AVF99695.1|1496654_1497689_-	adhesin	NA	NA	NA	NA	NA
AVF99696.1|1497704_1500185_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVF99697.1|1500200_1500875_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AVF99698.1|1500955_1501498_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99699.1|1502328_1503438_-	protein mrp	NA	NA	NA	NA	NA
AVF99700.1|1503569_1505603_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
AVF99701.1|1505743_1509532_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AVF99702.1|1509541_1513174_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AVF99703.1|1514182_1515271_+	MoxR family ATPase	NA	NA	NA	NA	NA
AVF99704.1|1515281_1517561_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99705.1|1517553_1518690_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.6e-161
AVF99706.1|1518686_1520690_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
AVF99707.1|1520814_1521276_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVF99708.1|1521316_1521787_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVF99709.1|1521833_1522553_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVF99710.1|1522549_1524235_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVF99711.1|1524749_1524998_+	damage-inducible protein DinI	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
AVF99712.1|1525115_1525412_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99713.1|1525421_1525700_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
AVF99714.1|1525696_1527757_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
AVF99715.1|1527908_1528508_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.0	6.5e-106
AVF99716.1|1528575_1532268_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
AVF99717.1|1532611_1533292_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AVF99718.1|1533189_1533933_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
AVF99719.1|1533938_1534637_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
AVF99720.1|1534636_1534966_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AVF99721.1|1534962_1537539_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.6	0.0e+00
AVF99722.1|1537519_1537933_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AVF99723.1|1537959_1538391_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
AVF99724.1|1538409_1539156_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	5.6e-123
AVF99725.1|1539163_1539559_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVF99726.1|1539555_1540131_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
AVF99727.1|1540146_1540500_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AVF99728.1|1540492_1540876_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AVF99729.1|1540927_1541956_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	6.6e-114
AVF99730.1|1542013_1542361_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	54.8	3.7e-21
AVF99731.1|1542397_1543903_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	1.2e-100
AVF99732.1|1543892_1545485_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
AVF99733.1|1545481_1545688_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVF99734.1|1545671_1547600_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	7.2e-263
AVF99735.1|1547571_1548081_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AVF99736.1|1548484_1548670_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
AVF99737.1|1548802_1548943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99738.1|1549651_1550173_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
AVF99739.1|1550374_1550812_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
AVF99740.1|1551110_1551644_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
AVG02811.1|1551707_1552058_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	90.2	6.6e-50
AVF99741.1|1552062_1552278_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AVF99742.1|1552353_1552623_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
AVF99743.1|1552660_1552843_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	91.5	9.4e-24
AVF99744.1|1552994_1554956_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	5.1e-240
AVF99745.1|1555726_1556440_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVF99746.1|1556574_1556772_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AVF99747.1|1557050_1557668_-	hypothetical protein	NA	NA	NA	NA	NA
AVF99748.1|1557743_1558115_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
AVF99749.1|1558132_1559122_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
AVF99750.1|1559129_1559945_-	DNA-binding protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
AVF99751.1|1560107_1560503_-	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
AVF99752.1|1560499_1560826_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
AVF99753.1|1560822_1561476_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AVF99754.1|1561475_1561970_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	7.3e-87
AVF99755.1|1561966_1562785_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	5.2e-122
AVF99756.1|1562781_1563006_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
AVF99757.1|1563002_1564148_-	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
AVF99758.1|1564144_1564702_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
AVF99759.1|1564694_1564955_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AVF99760.1|1564926_1565079_-	amino acid permease	NA	NA	NA	NA	NA
AVF99761.1|1565052_1565745_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
AVF99762.1|1565824_1566079_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AVF99763.1|1566180_1566375_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
AVF99764.1|1566447_1566810_+	hypothetical protein	NA	U5P4J6	Shigella_phage	94.2	2.2e-56
AVF99765.1|1566875_1567700_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AVF99766.1|1567827_1568364_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
AVF99767.1|1568354_1568717_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	1.5e-65
AVF99768.1|1568713_1568917_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
AVF99769.1|1568909_1569149_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
AVF99770.1|1569145_1569745_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.5	1.2e-104
AVG02812.1|1569974_1570262_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.9	1.4e-53
AVF99771.1|1570258_1570777_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.6	1.3e-65
AVF99772.1|1570861_1571104_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
AVF99773.1|1571107_1571242_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	4.2e-21
AVF99774.1|1571260_1571515_+	excisionase	NA	Q859D3	Escherichia_coli_phage	98.8	3.3e-43
AVF99775.1|1571548_1572835_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	98.8	9.3e-251
AVF99776.1|1572870_1573557_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.4	1.9e-101
AVF99777.1|1573616_1573724_+	hypothetical protein	NA	NA	NA	NA	NA
AVF99778.1|1573704_1574436_-	ABC transporter permease	NA	NA	NA	NA	NA
AVF99779.1|1574440_1575367_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 5
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1987629	2060722	4829687	holin,head,terminase,transposase,tRNA,tail	Salmonella_phage(47.06%)	77	NA	NA
AVG00144.1|1987629_1988370_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVG00145.1|1988488_1989292_+	inositol monophosphatase	NA	NA	NA	NA	NA
AVG00146.1|1989436_1990291_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG00147.1|1990481_1991762_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AVG00148.1|1991753_1992893_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AVG00149.1|1993262_1993685_+	DoxX family protein	NA	NA	NA	NA	NA
AVG00150.1|1993759_1995107_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	3.0e-74
AVG00151.1|1995168_1996041_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AVG02823.1|1996052_1997114_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVG00152.1|1997179_1998178_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG00153.1|1998202_1999714_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
AVG00154.1|1999736_2000720_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG00155.1|2000816_2004098_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
AVG00156.1|2004215_2005409_+	ROK family protein	NA	NA	NA	NA	NA
AVG00157.1|2005472_2006726_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AVG00158.1|2007053_2008244_+	flavohemoprotein	NA	NA	NA	NA	NA
AVG00159.1|2008288_2008627_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVG00160.1|2008687_2010022_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVG00161.1|2010011_2010725_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVG00162.1|2010889_2012317_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	6.7e-16
AVG00163.1|2012892_2016780_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
AVG00164.1|2016794_2016944_-	phosphoribosylglycinamide synthetase	NA	NA	NA	NA	NA
AVG00165.1|2017037_2018594_+	lytic transglycosylase F	NA	NA	NA	NA	NA
AVG00166.1|2018590_2019127_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AVG00167.1|2019151_2019787_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVG00168.1|2019995_2020844_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVG00169.1|2021156_2021423_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	81.8	3.5e-35
AVG00170.1|2021723_2022569_+	hypothetical protein	NA	NA	NA	NA	NA
AVG02824.1|2022918_2023437_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	62.6	3.1e-56
AVG00171.1|2023436_2024039_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.0e-98
AVG00172.1|2024010_2024448_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	1.4e-49
AVG00173.1|2024449_2025136_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
AVG00174.1|2025135_2025816_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	2.9e-102
AVG00175.1|2025812_2027012_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
AVG00176.1|2027011_2027365_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
AVG00177.1|2027364_2028117_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.9e-87
AVG00178.1|2028174_2028747_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AVG00179.1|2029072_2029417_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
AVG00180.1|2029420_2030482_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	7.7e-158
AVG00181.1|2030484_2030787_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	1.8e-48
AVG00182.1|2030786_2031374_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
AVG00183.1|2031373_2033362_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.7	2.3e-272
AVG00184.1|2033351_2033528_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	68.0	1.4e-11
AVG00185.1|2033539_2033992_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
AVG00186.1|2033995_2034436_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	4.6e-56
AVG00187.1|2034446_2035592_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	8.8e-160
AVG00188.1|2035595_2036159_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
AVG00189.1|2036133_2036523_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
AVG00190.1|2036509_2037064_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	2.6e-80
AVG00191.1|2037060_2037468_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
AVG00192.1|2037433_2037655_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AVG00193.1|2037696_2038638_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	2.9e-156
AVG00194.1|2038649_2039156_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
AVG00195.1|2039159_2040380_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	87.8	1.2e-199
AVG00196.1|2040394_2040925_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.6	1.5e-82
AVG00197.1|2041019_2042486_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	1.8e-261
AVG00198.1|2042485_2044108_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
AVG00199.1|2044110_2044683_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
AVG00200.1|2044744_2045269_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	65.4	1.3e-41
AVG00201.1|2045252_2045729_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
AVG00202.1|2045732_2046074_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	1.6e-53
AVG00203.1|2046519_2046861_-	hypothetical protein	NA	NA	NA	NA	NA
AVG00204.1|2046892_2047315_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
AVG00205.1|2047596_2049789_-	replication protein	NA	B6SCY1	Bacteriophage	71.4	2.7e-173
AVG00206.1|2049792_2050005_-	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
AVG00207.1|2050125_2050749_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
AVG00208.1|2051528_2052431_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
AVG00209.1|2052433_2053735_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.3e-132
AVG00210.1|2053750_2054299_+	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
AVG02825.1|2054350_2054992_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	64.1	1.8e-69
AVG00211.1|2054985_2055675_-	hypothetical protein	NA	NA	NA	NA	NA
AVG00212.1|2055736_2057800_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	7.9e-276
AVG00213.1|2057805_2058021_+	hypothetical protein	NA	NA	NA	NA	NA
AVG00214.1|2058017_2058317_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	5.5e-29
AVG00215.1|2058306_2058576_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	3.0e-26
AVG00216.1|2058581_2059292_-	hypothetical protein	NA	NA	NA	NA	NA
AVG00217.1|2059330_2060722_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	72.8	6.0e-211
>prophage 6
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	2190201	2197341	4829687		Escherichia_phage(83.33%)	6	NA	NA
AVG00344.1|2190201_2192763_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.7e-31
AVG00345.1|2192868_2193525_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	6.2e-49
AVG00346.1|2193575_2194343_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AVG00347.1|2194538_2195447_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AVG00348.1|2195443_2196706_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AVG00349.1|2196702_2197341_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 7
CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	4381297	4465420	4829687	plate,holin,head,protease,terminase,portal,transposase,capsid,integrase,tail	Shigella_phage(53.03%)	101	4423942:4423990	4464881:4464929
AVG02319.1|4381297_4382644_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVG02320.1|4382646_4383171_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVG02911.1|4383167_4384448_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVG02321.1|4384464_4385514_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVG02322.1|4385477_4387337_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVG02323.1|4387324_4387750_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVG02324.1|4387754_4389239_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVG02325.1|4389261_4389765_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVG02326.1|4390470_4390989_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVG02327.1|4391209_4393441_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	8.0e-24
AVG02328.1|4393453_4394218_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AVG02329.1|4394745_4394919_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVG02330.1|4394888_4395209_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVG02912.1|4395223_4395748_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVG02331.1|4395732_4396275_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVG02332.1|4396259_4398353_+	hypothetical protein	NA	NA	NA	NA	NA
AVG02333.1|4399620_4400124_+	hypothetical protein	NA	NA	NA	NA	NA
AVG02334.1|4400190_4400703_+	integrating conjugative element protein	NA	NA	NA	NA	NA
AVG02335.1|4400973_4401744_-	amidohydrolase	NA	NA	NA	NA	NA
AVG02336.1|4401897_4402371_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AVG02337.1|4402413_4404858_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVG02338.1|4405097_4405676_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVG02339.1|4405880_4406654_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVG02340.1|4406624_4407365_-	transpeptidase	NA	NA	NA	NA	NA
AVG02341.1|4407667_4408426_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AVG02342.1|4408601_4409099_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG02343.1|4409214_4410954_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AVG02913.1|4410913_4411684_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AVG02344.1|4411754_4412810_+	DNA polymerase IV	NA	NA	NA	NA	NA
AVG02345.1|4412861_4413155_+	antitoxin YafN	NA	NA	NA	NA	NA
AVG02346.1|4413157_4413556_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AVG02347.1|4413565_4414018_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	27.5	1.3e-05
AVG02348.1|4414195_4415347_+	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	30.1	2.5e-29
AVG02349.1|4415343_4415958_+	peptide chain release factor H	NA	NA	NA	NA	NA
AVG02350.1|4416013_4417471_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AVG02351.1|4417731_4418190_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG02352.1|4418281_4419526_+	esterase FrsA	NA	NA	NA	NA	NA
AVG02353.1|4419583_4419985_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AVG02354.1|4420085_4421141_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
AVG02355.1|4421429_4422533_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVG02356.1|4422544_4423798_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
4423942:4423990	attL	CATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
AVG02914.1|4424002_4424941_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AVG02357.1|4425042_4425393_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AVG02358.1|4425392_4425698_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
AVG02359.1|4425697_4426060_-	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AVG02360.1|4426050_4426587_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
AVG02361.1|4426714_4427539_-	hypothetical protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
AVG02362.1|4427604_4427967_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
AVG02363.1|4428039_4428234_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	2.5e-30
AVG02364.1|4428335_4428590_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.4e-12
AVG02365.1|4428669_4429362_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
AVG02915.1|4429335_4429488_+	amino acid permease	NA	NA	NA	NA	NA
AVG02366.1|4429459_4429720_+	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AVG02367.1|4429712_4430264_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	95.1	1.0e-97
AVG02368.1|4430260_4431409_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	80.2	3.1e-165
AVG02369.1|4431405_4431630_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AVG02370.1|4431626_4432445_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
AVG02371.1|4432441_4432936_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	7.3e-87
AVG02372.1|4432935_4433589_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	2.4e-125
AVG02373.1|4433585_4433912_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	99.1	5.9e-53
AVG02374.1|4433908_4434298_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AVG02375.1|4434317_4435115_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
AVG02376.1|4435122_4436112_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.4e-193
AVG02377.1|4436129_4436471_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	99.1	4.7e-61
AVG02916.1|4436492_4436954_-	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	99.3	1.2e-72
AVG02378.1|4437024_4438056_-	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
AVG02379.1|4438336_4438663_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	100.0	1.4e-57
AVG02380.1|4438666_4439143_+	lysozyme	NA	S5FV07	Shigella_phage	97.5	4.1e-87
AVG02381.1|4439126_4439519_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	91.5	3.7e-57
AVG02382.1|4439702_4440053_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	1.2e-62
AVG02383.1|4440169_4440673_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AVG02384.1|4440669_4442403_+|terminase	terminase	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AVG02385.1|4442414_4442597_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AVG02386.1|4442596_4443838_+|portal	phage portal protein	portal	U5P411	Shigella_phage	98.8	2.9e-241
AVG02387.1|4443779_4444466_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.6	2.5e-125
AVG02388.1|4444480_4445686_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	3.1e-224
AVG02389.1|4445735_4445936_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
AVG02390.1|4445938_4446262_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AVG02391.1|4446258_4446669_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
AVG02392.1|4446643_4447150_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
AVG02393.1|4447146_4447707_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
AVG02394.1|4447715_4447886_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AVG02395.1|4447869_4449366_+|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.6	1.0e-277
AVG02396.1|4449365_4449722_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	2.0e-62
AVG02397.1|4449721_4449991_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AVG02398.1|4449957_4450140_+	hypothetical protein	NA	NA	NA	NA	NA
AVG02399.1|4450132_4451968_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.2	2.9e-306
AVG02400.1|4451986_4453357_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.5	1.1e-252
AVG02401.1|4453353_4454433_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
AVG02402.1|4454432_4454981_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AVG02403.1|4454977_4455406_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	1.7e-79
AVG02404.1|4455392_4456451_+|plate	phage baseplate protein	plate	U5P424	Shigella_phage	98.6	2.8e-200
AVG02405.1|4456441_4457026_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	1.6e-112
AVG02406.1|4457029_4457680_+	hypothetical protein	NA	S5FKM2	Shigella_phage	98.6	1.1e-114
AVG02407.1|4457636_4458086_+|tail	tail assembly chaperone	tail	S5FXM8	Shigella_phage	97.2	6.9e-76
AVG02917.1|4458857_4459670_-	acyltransferase	NA	S5FNR8	Shigella_phage	98.5	1.4e-146
AVG02408.1|4461935_4462193_-	hypothetical protein	NA	O21944	Shigella_phage	98.8	2.1e-45
AVG02409.1|4462318_4463395_-	glucosyl transferase	NA	O21944	Shigella_phage	99.1	2.6e-182
AVG02410.1|4463391_4464321_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	99.7	7.9e-175
AVG02411.1|4464317_4464680_-	GtrA family protein	NA	U5P0S6	Shigella_phage	99.2	2.3e-58
AVG02412.1|4465081_4465420_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	47.7	4.8e-21
4464881:4464929	attR	CATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
>prophage 1
CP014110	Escherichia coli strain FDAARGOS_144 plasmid unnamed1, complete sequence	115764	29048	57264	115764	transposase,integrase	Escherichia_phage(33.33%)	30	30713:30733	55712:55732
AVF98085.1|29048_30221_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
AVF98086.1|30217_31018_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
30713:30733	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
AVF98174.1|31011_31842_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVF98087.1|31879_32149_-	hypothetical protein	NA	NA	NA	NA	NA
AVF98088.1|32260_33481_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
AVF98089.1|33499_34018_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AVF98090.1|34152_34401_+	DinI family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
AVF98091.1|34397_34835_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
AVF98092.1|36109_36538_-	plasmid stability protein	NA	NA	NA	NA	NA
AVF98093.1|36506_37478_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
AVF98094.1|37706_38351_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AVF98095.1|38344_38620_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AVF98096.1|38757_39567_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
AVF98097.1|39567_39873_-	toxin CcdB	NA	NA	NA	NA	NA
AVF98098.1|39874_40093_-	antitoxin CcdA	NA	NA	NA	NA	NA
AVF98099.1|40730_40958_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98100.1|41744_43118_-|transposase	IS4 family transposase ISEc13	transposase	Q9JMP3	Wolbachia_phage	29.1	2.1e-43
AVF98101.1|43134_43350_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98102.1|43972_44614_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98103.1|44670_44877_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98104.1|44990_45479_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98105.1|45788_46766_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
AVF98106.1|47008_47749_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AVF98107.1|47869_48058_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AVF98108.1|48424_49594_+	hypothetical protein	NA	NA	NA	NA	NA
AVF98109.1|50440_50713_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF98110.1|51955_53926_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AVF98111.1|53932_54724_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AVF98112.1|55462_56245_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
55712:55732	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
AVF98113.1|56241_57264_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
