The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1249043	1294246	5302595	tail,terminase,coat,holin,integrase	Klebsiella_phage(20.41%)	61	1245776:1245791	1264732:1264747
1245776:1245791	attL	CTGCCGCCGTTGCCAG	NA	NA	NA	NA
AVB70999.1|1249043_1250273_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	95.8	1.5e-237
AVB71000.1|1250250_1250526_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AVB74701.1|1250564_1250804_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AVB71001.1|1250811_1251120_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
AVB71002.1|1251116_1251800_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	44.2	5.8e-42
AVB71003.1|1251834_1252923_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.0	1.1e-106
AVB71004.1|1252935_1255974_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.9	5.0e-295
AVB71005.1|1256111_1256267_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AVB71006.1|1256275_1256467_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVB74702.1|1256573_1256672_-	hypothetical protein	NA	NA	NA	NA	NA
AVB71007.1|1256897_1257254_-	hypothetical protein	NA	NA	NA	NA	NA
AVB71008.1|1257350_1257614_+	transcriptional regulator	NA	NA	NA	NA	NA
AVB71009.1|1257616_1258153_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	3.1e-59
AVB71010.1|1258500_1259421_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
AVB71011.1|1259417_1260161_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
AVB71012.1|1260153_1260489_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
AVB71013.1|1260481_1261267_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	1.8e-63
AVB71014.1|1261263_1261467_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	83.3	3.8e-26
AVB71015.1|1261459_1261714_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
AVB71016.1|1261710_1261947_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.4e-13
AVB71017.1|1261939_1262485_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71018.1|1262486_1262759_+	hypothetical protein	NA	K7PMC8	Enterobacterial_phage	84.4	2.5e-36
AVB71019.1|1263357_1263615_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71020.1|1263611_1265579_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.2	1.3e-203
1264732:1264747	attR	CTGGCAACGGCGGCAG	NA	NA	NA	NA
AVB71021.1|1265727_1265961_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
AVB71022.1|1266038_1266260_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71023.1|1266317_1266917_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.3e-90
AVB71024.1|1266916_1267123_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
AVB71025.1|1267125_1267422_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AVB71026.1|1267418_1267775_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
AVB71027.1|1267890_1268712_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
AVB71028.1|1268956_1269268_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AVB71029.1|1269264_1269804_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
AVB71030.1|1269800_1270148_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
AVB71031.1|1270144_1270420_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.2	3.5e-06
AVB71032.1|1270370_1270565_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.2	1.2e-24
AVB71033.1|1270561_1270822_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	58.0	2.1e-21
AVB71034.1|1270926_1271163_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
AVB71035.1|1271172_1271409_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71036.1|1271412_1272417_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.3	1.7e-34
AVB71037.1|1272394_1273699_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	2.7e-144
AVB71038.1|1273702_1275127_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.9	8.3e-192
AVB71039.1|1275110_1276223_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.1	1.2e-108
AVB71040.1|1276326_1277091_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	1.3e-79
AVB71041.1|1277178_1278315_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	1.3e-155
AVB71042.1|1278850_1279261_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	41.2	9.3e-11
AVB71043.1|1279262_1279496_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.8	2.6e-10
AVB71044.1|1279482_1279866_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
AVB71045.1|1279867_1280419_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	1.0e-28
AVB71046.1|1280415_1280808_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVB71047.1|1280831_1282004_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
AVB71048.1|1282057_1282540_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71049.1|1282707_1282884_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71050.1|1282960_1283317_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AVB71051.1|1283366_1283651_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71052.1|1283861_1287440_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.4	7.0e-78
AVB71053.1|1287439_1287904_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.1	9.3e-60
AVB71054.1|1288084_1288567_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	93.8	3.4e-81
AVB71055.1|1288576_1288957_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
AVB71056.1|1288953_1292016_+	kinase	NA	A0A286S259	Klebsiella_phage	94.0	0.0e+00
AVB71057.1|1292092_1294246_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
>prophage 2
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1360482	1375204	5302595	integrase,tail	Morganella_phage(50.0%)	17	1360235:1360255	1380299:1380319
1360235:1360255	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
AVB74704.1|1360482_1361736_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	7.2e-147
AVB71115.1|1361831_1362839_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71116.1|1362969_1363188_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVB71117.1|1363187_1363622_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
AVB71118.1|1363635_1364238_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
AVB71119.1|1364237_1364417_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVB71120.1|1364413_1365379_+	HAD family hydrolase	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
AVB71121.1|1365375_1365879_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71122.1|1365875_1366085_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71123.1|1366081_1366708_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
AVB71124.1|1366717_1367068_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
AVB71125.1|1367060_1369823_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
AVB74705.1|1370162_1370609_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVB74706.1|1370622_1370973_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVB71126.1|1370977_1371451_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71127.1|1371804_1372131_+	hypothetical protein	NA	NA	NA	NA	NA
AVB71128.1|1372138_1375204_+|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1380299:1380319	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 3
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1717107	1724012	5302595		Planktothrix_phage(33.33%)	6	NA	NA
AVB74724.1|1717107_1717971_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AVB71423.1|1717981_1718755_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
AVB74725.1|1718995_1719889_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVB71424.1|1720134_1721496_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVB71425.1|1721814_1722537_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVB71426.1|1722533_1724012_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 4
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	2685823	2696710	5302595		Escherichia_phage(87.5%)	9	NA	NA
AVB72310.1|2685823_2688931_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
AVB72311.1|2688985_2690251_+	MFS transporter	NA	NA	NA	NA	NA
AVB72312.1|2690281_2691370_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
AVB72313.1|2691456_2691717_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AVB72314.1|2692014_2692875_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AVB72315.1|2692895_2693657_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
AVB72316.1|2693917_2694820_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVB72317.1|2694831_2696097_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AVB72318.1|2696089_2696710_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	2731993	2811232	5302595	protease,tail,head,terminase,portal,capsid,holin,integrase	Klebsiella_phage(20.93%)	89	2757534:2757550	2790296:2790312
AVB74777.1|2731993_2732731_+|protease	serine protease	protease	NA	NA	NA	NA
AVB72352.1|2732744_2732861_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVB72353.1|2732904_2733234_-	spermidine export protein MdtI	NA	NA	NA	NA	NA
AVB72354.1|2733220_2733583_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AVB72355.1|2734025_2735060_+	AI-2E family transporter	NA	NA	NA	NA	NA
AVB72356.1|2735284_2736940_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
AVB72357.1|2736939_2737782_+	2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	NA	NA	NA	NA	NA
AVB72358.1|2737799_2738099_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
AVB72359.1|2738091_2738925_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
AVB72360.1|2738924_2739725_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
AVB72361.1|2739861_2740821_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
AVB72362.1|2740824_2741442_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
AVB72363.1|2741441_2742344_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
AVB72364.1|2742333_2743260_-	malonate utilization transcriptional regulator	NA	NA	NA	NA	NA
AVB72365.1|2743417_2745073_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVB72366.1|2745337_2746258_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVB72367.1|2746421_2746778_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72368.1|2746933_2748550_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AVB72369.1|2748546_2749266_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AVB72370.1|2749246_2750197_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AVB72371.1|2750264_2753042_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
AVB72372.1|2753128_2753260_-	transcriptional regulator	NA	NA	NA	NA	NA
AVB72373.1|2753684_2755196_+	anion permease	NA	NA	NA	NA	NA
AVB72374.1|2755250_2756903_+	fumarate hydratase	NA	NA	NA	NA	NA
AVB72375.1|2757074_2758682_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
2757534:2757550	attL	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
AVB72376.1|2758741_2759293_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72377.1|2759726_2760116_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVB72378.1|2760108_2760873_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AVB72379.1|2760862_2762215_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AVB72380.1|2762224_2763427_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AVB72381.1|2763437_2764094_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AVB72382.1|2764104_2764791_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
AVB72383.1|2764960_2765767_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVB72384.1|2765763_2766327_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AVB72385.1|2766428_2767337_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVB72386.1|2767503_2768814_+	amidohydrolase	NA	NA	NA	NA	NA
AVB72387.1|2768813_2770259_+	amidohydrolase	NA	NA	NA	NA	NA
AVB72388.1|2770378_2771497_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
AVB72389.1|2771625_2772726_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
AVB72390.1|2773927_2774227_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72391.1|2774394_2775039_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72392.1|2775094_2775829_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72393.1|2775841_2777995_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	4.8e-90
AVB72394.1|2778067_2781145_-	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
AVB72395.1|2781141_2781522_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AVB72396.1|2781534_2782011_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
AVB72397.1|2781997_2782471_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
AVB72398.1|2782491_2785881_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.5	0.0e+00
AVB72399.1|2785941_2786175_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AVB72400.1|2786248_2786554_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AVB72401.1|2786556_2786961_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
AVB72402.1|2786991_2787696_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
AVB72403.1|2787752_2788100_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AVB72404.1|2788096_2788546_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
AVB72405.1|2788542_2788881_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
AVB72406.1|2788889_2789207_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
AVB72407.1|2789284_2790523_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	1.8e-158
2790296:2790312	attR	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
AVB72408.1|2790532_2791132_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AVB72409.1|2791124_2792351_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AVB72410.1|2792498_2794250_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
AVB72411.1|2794253_2794751_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
AVB72412.1|2794908_2795259_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	4.6e-51
AVB72413.1|2795360_2795762_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AVB72414.1|2795837_2796083_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	91.4	4.8e-31
AVB72415.1|2796402_2796594_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	3.4e-24
AVB72416.1|2796544_2796820_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72417.1|2796816_2797164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	2.0e-38
AVB72418.1|2797160_2797700_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	97.2	4.8e-100
AVB72419.1|2797696_2798008_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AVB72420.1|2799405_2800227_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72421.1|2800251_2800737_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72422.1|2800785_2801127_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
AVB72423.1|2801145_2802126_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
AVB72424.1|2802138_2802516_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AVB72425.1|2802525_2803335_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.5	5.0e-109
AVB72426.1|2803331_2804270_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.2	2.0e-101
AVB72427.1|2804259_2804439_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
AVB72428.1|2804676_2805138_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AVB72429.1|2805163_2805361_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AVB74778.1|2805465_2806113_+	phage repressor protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
AVB74779.1|2806341_2806548_+	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	85.2	2.7e-19
AVB72430.1|2806880_2807180_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
AVB72431.1|2807179_2807965_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
AVB72432.1|2808092_2808437_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72433.1|2808429_2809092_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
AVB72434.1|2809088_2809274_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72435.1|2809393_2809654_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
AVB72436.1|2810265_2810424_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AVB72437.1|2810716_2811232_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 6
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3109110	3154112	5302595	tail,tRNA,terminase,portal,plate,capsid,integrase	Enterobacteria_phage(54.55%)	55	3114338:3114355	3150379:3150396
AVB72711.1|3109110_3109611_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVB72712.1|3109727_3110174_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVB74789.1|3110157_3110949_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVB72713.1|3111050_3112235_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVB72714.1|3112266_3112959_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72715.1|3113104_3113614_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVB72716.1|3113600_3113957_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVB72717.1|3113946_3114186_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3114338:3114355	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVB72718.1|3114450_3114702_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AVB72719.1|3114745_3115885_-	hypothetical protein	NA	B9A7A9	Serratia_phage	71.0	1.6e-145
AVB72720.1|3116039_3117212_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AVB72721.1|3117211_3117727_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	6.3e-57
AVB72722.1|3117772_3118090_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AVB74790.1|3118089_3118248_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	4.6e-11
AVB72723.1|3118234_3121210_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	4.4e-219
AVB72724.1|3121224_3121698_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.6	1.3e-53
AVB72725.1|3122160_3122823_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72726.1|3122840_3124064_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
AVB72727.1|3124663_3125761_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AVB72728.1|3125760_3125973_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72729.1|3125969_3128996_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AVB72730.1|3128985_3129909_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	5.8e-53
AVB72731.1|3129910_3130261_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AVB72732.1|3130257_3130845_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	2.6e-59
AVB72733.1|3130841_3131477_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.4	1.6e-57
AVB72734.1|3131473_3131941_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
AVB74791.1|3132122_3132452_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVB72735.1|3132463_3133009_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	7.4e-32
AVB72736.1|3133005_3133290_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVB72737.1|3133280_3133481_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AVB72738.1|3133480_3133996_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AVB72739.1|3134108_3134966_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	2.8e-70
AVB72740.1|3135015_3136050_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AVB72741.1|3136059_3136899_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
AVB72742.1|3137055_3138783_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
AVB72743.1|3138776_3139838_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.6	4.1e-143
AVB72744.1|3140429_3141599_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72745.1|3142590_3142857_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72746.1|3142853_3145481_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.8	7.1e-189
AVB72747.1|3145498_3146455_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.1	1.9e-83
AVB72748.1|3146689_3147256_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.6	5.5e-14
AVB72749.1|3147252_3147477_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72750.1|3147545_3147818_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72751.1|3147833_3148211_-	hypothetical protein	NA	NA	NA	NA	NA
AVB72752.1|3148226_3148445_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AVB72753.1|3148465_3148744_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AVB72754.1|3148864_3149164_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AVB72755.1|3149279_3150263_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AVB72756.1|3150527_3151541_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3150379:3150396	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVB72757.1|3151598_3151700_+	hypothetical protein	NA	NA	NA	NA	NA
AVB74792.1|3151699_3151774_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72758.1|3151891_3152017_+	hypothetical protein	NA	NA	NA	NA	NA
AVB72759.1|3152075_3152339_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVB72760.1|3152469_3153108_-	leucine efflux protein	NA	NA	NA	NA	NA
AVB72761.1|3153197_3154112_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 7
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3436537	3446001	5302595	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AVB72997.1|3436537_3438259_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AVB74808.1|3438303_3439005_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVB72998.1|3439358_3439577_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVB72999.1|3439697_3441977_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVB73000.1|3442007_3442325_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVB73001.1|3442650_3442872_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVB73002.1|3442805_3443009_-	hypothetical protein	NA	NA	NA	NA	NA
AVB73003.1|3442948_3444889_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
AVB73004.1|3444885_3446001_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3928525	3976176	5302595	tail,head,tRNA,coat,terminase,integrase	Cronobacter_phage(18.52%)	65	3927340:3927386	3973247:3973293
3927340:3927386	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVB73425.1|3928525_3930709_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
AVB73426.1|3930795_3933273_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.5	8.8e-197
AVB73427.1|3933259_3933655_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	2.1e-36
AVB73428.1|3933651_3934122_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
AVB74835.1|3934121_3934541_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
AVB73429.1|3934660_3935284_-	hypothetical protein	NA	NA	NA	NA	NA
AVB73430.1|3935306_3938612_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	53.9	1.4e-213
AVB74836.1|3938684_3939713_-	hypothetical protein	NA	A0A0P0ZBT0	Stx2-converting_phage	68.4	9.9e-86
AVB74837.1|3939729_3939897_-	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
AVB74838.1|3940022_3940376_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVB73431.1|3940416_3940851_-	hypothetical protein	NA	NA	NA	NA	NA
AVB73432.1|3940925_3941180_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
AVB73433.1|3941182_3941938_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.1e-61
AVB73434.1|3942116_3942794_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	2.2e-73
AVB73435.1|3942846_3943599_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AVB73436.1|3943667_3944060_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
AVB73437.1|3944056_3944482_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	6.6e-28
AVB73438.1|3944484_3944847_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
AVB73439.1|3944846_3945020_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
AVB73440.1|3945019_3945403_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.2	8.0e-49
AVB73441.1|3945405_3945645_-	hypothetical protein	NA	NA	NA	NA	NA
AVB73442.1|3945677_3946733_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.5e-102
AVB73443.1|3946729_3947191_-	hypothetical protein	NA	B1GS72	Salmonella_phage	51.0	1.7e-29
AVB73444.1|3947190_3948546_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	5.1e-130
AVB73445.1|3948611_3949292_-	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	38.7	1.5e-37
AVB73446.1|3949393_3950398_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	2.1e-112
AVB73447.1|3950324_3951794_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	6.9e-149
AVB73448.1|3951806_3953279_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	2.0e-249
AVB73449.1|3953278_3953881_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	2.9e-77
AVB73450.1|3954240_3954426_-	rz1 lytic protein	NA	U5P461	Shigella_phage	58.5	2.7e-10
AVB73451.1|3954406_3954790_-	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
AVB73452.1|3954786_3955290_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
AVB73453.1|3955292_3955607_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
AVB74839.1|3956121_3956577_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	39.4	3.6e-24
AVB73454.1|3956759_3956900_-	YlcG family protein	NA	NA	NA	NA	NA
AVB73455.1|3956896_3957259_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	3.3e-52
AVB73456.1|3957255_3957546_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
AVB73457.1|3957538_3957709_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	63.6	1.6e-09
AVB73458.1|3957708_3958164_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
AVB73459.1|3959185_3959374_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
AVB73460.1|3959373_3959682_-	hypothetical protein	NA	NA	NA	NA	NA
AVB73461.1|3959788_3960169_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.3	9.2e-13
AVB73462.1|3960165_3960459_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AVB73463.1|3960458_3961889_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	67.2	1.2e-185
AVB73464.1|3961878_3962778_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	9.2e-88
AVB73465.1|3963002_3963224_-	transcriptional regulator	NA	NA	NA	NA	NA
AVB73466.1|3963263_3963482_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.1e-13
AVB73467.1|3963590_3964250_+	LexA family transcriptional repressor	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
AVB73468.1|3964310_3964430_+	hypothetical protein	NA	NA	NA	NA	NA
AVB73469.1|3964575_3966018_+	AAA family ATPase	NA	NA	NA	NA	NA
AVB73470.1|3966095_3966299_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	3.5e-19
AVB73471.1|3966735_3966942_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AVB73472.1|3967022_3967307_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
AVB73473.1|3967322_3968168_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.0	4.5e-68
AVB73474.1|3968164_3968845_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
AVB73475.1|3968841_3969270_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
AVB73476.1|3969266_3969920_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.3e-111
AVB73477.1|3969916_3970375_+	HNH endonuclease	NA	G9FH70	Rhodococcus_phage	42.1	2.1e-24
AVB73478.1|3971420_3971639_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
AVB73479.1|3971640_3971856_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	57.1	1.2e-14
AVB73480.1|3972069_3973233_+|integrase	integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
AVB73481.1|3973302_3973626_-	hypothetical protein	NA	NA	NA	NA	NA
3973247:3973293	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVB73482.1|3973664_3974531_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AVB73483.1|3974532_3974745_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVB73484.1|3974790_3976176_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
CP026587	Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence	215697	44378	93564	215697	transposase,integrase	Bacillus_phage(27.78%)	41	34840:34854	80501:80515
34840:34854	attL	TTTGTTGAATAAATA	NA	NA	NA	NA
AVB74936.1|44378_47348_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
AVB74937.1|47350_47908_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
AVB74938.1|48037_49114_-	signal peptidase II	NA	NA	NA	NA	NA
AVB74939.1|49110_51516_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
AVB74940.1|51601_52036_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVB74941.1|52331_53732_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AVB74942.1|53728_54409_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVB74943.1|54463_55393_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AVB74944.1|55397_55778_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVB74945.1|55817_56714_-	copper resistance protein B	NA	NA	NA	NA	NA
AVB74946.1|56713_58531_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVB74947.1|58764_59214_+	copper resistance protein	NA	NA	NA	NA	NA
AVB74948.1|59502_60240_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AVB74949.1|60273_60471_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVB74950.1|60511_62959_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AVB74951.1|63085_63526_-	hypothetical protein	NA	NA	NA	NA	NA
AVB74952.1|63612_66759_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AVB74953.1|66769_68062_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVB74954.1|68175_68538_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVB74955.1|68566_69952_-	hypothetical protein	NA	NA	NA	NA	NA
AVB74956.1|70141_70822_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
AVB74957.1|70814_72290_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVB74958.1|72540_72972_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AVB74959.1|73115_73466_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
AVB75084.1|73852_74761_-	HNH endonuclease	NA	NA	NA	NA	NA
AVB74960.1|75397_76372_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AVB75085.1|77304_78117_+	hypothetical protein	NA	NA	NA	NA	NA
AVB74961.1|78113_78893_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
AVB75086.1|79037_79967_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
AVB74962.1|80279_80438_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
AVB74963.1|80552_81476_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
80501:80515	attR	TTTGTTGAATAAATA	NA	NA	NA	NA
AVB74964.1|81561_82416_+	hypothetical protein	NA	NA	NA	NA	NA
AVB74965.1|82464_84690_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
AVB74966.1|84691_85594_-	transcriptional regulator	NA	NA	NA	NA	NA
AVB74967.1|85677_85860_+	hypothetical protein	NA	NA	NA	NA	NA
AVB74968.1|85878_86340_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVB74969.1|86455_87403_+	EamA family transporter	NA	NA	NA	NA	NA
AVB74970.1|87738_88734_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
AVB74971.1|88939_89953_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
AVB74972.1|90065_90593_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVB74973.1|90606_93564_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
>prophage 2
CP026587	Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence	215697	143245	213005	215697	transposase	Enterobacteria_phage(17.65%)	60	NA	NA
AVB75020.1|143245_144214_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AVB75021.1|144541_146134_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.2e-176
AVB75022.1|146164_146515_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.5e-38
AVB75023.1|146511_146952_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
AVB75024.1|147148_147331_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AVB75025.1|148579_149551_-	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	6.6e-156
AVB75026.1|149550_150717_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
AVB75027.1|150672_150921_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75028.1|151135_151417_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75029.1|151446_152457_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
AVB75030.1|154776_155313_-	plasmid transfer protein	NA	NA	NA	NA	NA
AVB75031.1|158063_158846_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
AVB75032.1|161192_161630_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75033.1|161629_162661_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
AVB75034.1|162660_163527_-	ParA family protein	NA	NA	NA	NA	NA
AVB75090.1|166243_167167_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
AVB75035.1|167257_167548_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75036.1|167899_168106_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75037.1|168095_168389_-	korC	NA	NA	NA	NA	NA
AVB75038.1|168404_169538_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75039.1|170145_170376_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVB75040.1|170372_170816_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AVB75041.1|172598_172781_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75042.1|173112_173388_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75043.1|173315_173519_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75044.1|173609_174530_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVB75045.1|174578_175070_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75046.1|175132_175408_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVB75047.1|175491_175920_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AVB75048.1|175957_176518_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVB75049.1|176559_176820_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
AVB75050.1|177096_177378_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75051.1|177486_179688_-	ferric aerobactin receptor	NA	NA	NA	NA	NA
AVB75052.1|179769_181047_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AVB75053.1|181050_182784_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AVB75054.1|182783_183731_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVB75055.1|183731_185519_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
AVB75056.1|185612_186812_+	MFS transporter	NA	NA	NA	NA	NA
AVB75057.1|187161_187368_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75058.1|187509_187704_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75059.1|188564_189074_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
AVB75060.1|189623_189941_-	lysozyme	NA	NA	NA	NA	NA
AVB75061.1|189937_190177_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75062.1|190177_190564_-	transcriptional repressor	NA	NA	NA	NA	NA
AVB75063.1|190661_191861_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AVB75064.1|192267_192975_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVB75091.1|193637_194636_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVB75065.1|194641_195598_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVB75066.1|195619_196447_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
AVB75067.1|197191_198115_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
AVB75092.1|198221_198545_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75068.1|199728_200382_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVB75069.1|201939_202491_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVB75070.1|202563_203466_+	EamA family transporter	NA	NA	NA	NA	NA
AVB75071.1|203608_203830_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75072.1|203891_206066_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
AVB75073.1|206525_207755_-	esterase family protein	NA	NA	NA	NA	NA
AVB75074.1|207859_211504_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.2e-46
AVB75075.1|211646_212762_-	DUF1205 domain-containing protein	NA	NA	NA	NA	NA
AVB75076.1|212777_213005_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	0	12940	126149		Escherichia_phage(37.5%)	16	NA	NA
AVB75094.1|1244_1424_-	Par-like protein	NA	NA	NA	NA	NA
AVB75095.1|1543_2170_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AVB75096.1|2834_3710_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AVB75097.1|4121_5393_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
AVB75098.1|5392_5824_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AVB75099.1|6057_7029_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AVB75100.1|7031_7703_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVB75101.1|7766_7997_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75102.1|8433_9135_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AVB75103.1|9134_9356_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75104.1|9365_9785_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVB75105.1|9838_10606_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75106.1|11286_11715_+	antirestriction protein	NA	NA	NA	NA	NA
AVB75107.1|11757_12264_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
AVB75108.1|12306_12498_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75109.1|12685_12940_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 2
CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	15978	20338	126149		Vibrio_phage(33.33%)	6	NA	NA
AVB75115.1|15978_16542_+	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
AVB75116.1|16436_16757_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75117.1|17049_17268_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75118.1|17371_17914_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AVB75119.1|17962_18211_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVB75120.1|18280_20338_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
>prophage 3
CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	26264	31185	126149	transposase	Klebsiella_phage(20.0%)	9	NA	NA
AVB75130.1|26264_26621_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AVB75131.1|26681_26894_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75132.1|26904_27129_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75133.1|27209_27530_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AVB75134.1|27519_27798_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AVB75135.1|27798_28212_+	transcriptional regulator	NA	NA	NA	NA	NA
AVB75136.1|28347_29556_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	2.8e-47
AVB75239.1|30048_30267_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75137.1|30363_31185_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 4
CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	65741	108539	126149	integrase,transposase	Escherichia_phage(28.57%)	46	91743:91802	105959:106779
AVB75173.1|65741_66467_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
AVB75174.1|66538_67132_+	conjugal transfer protein	NA	NA	NA	NA	NA
AVB75175.1|67298_67895_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75176.1|67944_68589_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75177.1|68644_69295_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AVB75178.1|69291_69600_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AVB75179.1|69787_70492_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVB75180.1|70525_70783_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75181.1|71018_71348_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AVB75182.1|71328_71610_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AVB75183.1|71756_72332_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
AVB75184.1|72382_72973_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVB75185.1|73109_73682_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AVB75186.1|73718_75110_+|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AVB75187.1|75391_76048_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AVB75188.1|77808_78795_+|transposase	IS1380 family transposase	transposase	A0A2L1IV26	Escherichia_phage	100.0	3.3e-06
AVB75189.1|80012_80888_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
AVB75190.1|80934_81411_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVB75191.1|81669_82530_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVB75192.1|82712_83270_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVB75193.1|83433_86439_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.8	0.0e+00
AVB75194.1|86440_87169_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AVB75195.1|87385_88600_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
AVB75196.1|88627_88933_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVB75197.1|89199_90399_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AVB75198.1|90477_91155_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVB75199.1|91186_91429_-	relaxase	NA	NA	NA	NA	NA
91743:91802	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVB75200.1|91805_92510_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75201.1|92631_93537_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVB75202.1|93533_94772_+	MFS transporter	NA	NA	NA	NA	NA
AVB75203.1|94771_95356_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVB75204.1|95301_95658_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75205.1|95848_96613_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVB75206.1|96700_96814_+	NTP-binding protein	NA	NA	NA	NA	NA
AVB75207.1|97496_99038_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVB75208.1|99442_100282_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVB75209.1|100275_100623_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVB75242.1|100739_101585_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AVB75210.1|101765_102239_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AVB75211.1|102371_102824_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AVB75243.1|102920_103475_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVB75212.1|103766_104780_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVB75213.1|104718_105033_+|transposase	transposase	transposase	NA	NA	NA	NA
AVB75214.1|105250_105955_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75215.1|106278_107856_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
105959:106779	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTCCTCCTGAGGGAAATGTGTCAGGAAGAAATCTATGACCCTTGACGGCGTATGTCAATCAATTCGGAAGGCAACTCTATTCTGACGATTTAGCGCCGGATGGTCTGACGCCAAGTTAGGGTATAGCCTAGATTGACATGCGCGATGCAACCCTTAACTTGCTTGCACCTATCGTTTCCATGCTAGCTTTATCGTAACGCTCAAGAAATTGGGCTTAATGCCGAAAACAATAAAATAAAACAGCCAACCCTTGAGGTTCTTATGCGCCAGAATTTACCAGTGACGGGTCGAAACTTAGAACTCCCAAAAGATGCCAATATTCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGC	NA	NA	NA	NA
AVB75216.1|108029_108539_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
>prophage 5
CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	113284	113518	126149		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVB75219.1|113284_113518_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	51.3	1.7e-17
>prophage 1
CP026589	Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence	89247	2356	19079	89247	transposase,protease	Escherichia_phage(60.0%)	16	NA	NA
AVB75255.1|2356_3010_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVB75256.1|3229_3694_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVB75257.1|3690_3795_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75258.1|5004_5709_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75259.1|6219_7095_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AVB75260.1|7174_8098_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AVB75261.1|9848_10553_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75262.1|11663_12368_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75263.1|12433_12952_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75264.1|12956_13373_-	hypothetical protein	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AVB75265.1|13758_14463_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75266.1|15140_15329_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75350.1|15420_15957_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AVB75267.1|16139_17000_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVB75268.1|17169_17925_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AVB75269.1|18374_19079_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP026589	Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence	89247	49069	57722	89247	transposase	Escherichia_phage(25.0%)	10	NA	NA
AVB75307.1|49069_49774_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75308.1|50089_50515_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AVB75309.1|50843_51140_+	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AVB75310.1|52374_53256_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVB75311.1|53531_54512_-|transposase	IS481 family transposase ISKpn27	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AVB75312.1|54634_55108_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AVB75313.1|55147_55852_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVB75314.1|55977_56352_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
AVB75315.1|56977_57337_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75316.1|57398_57722_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
>prophage 3
CP026589	Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence	89247	62205	76011	89247	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
AVB75320.1|62205_62466_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AVB75321.1|62652_62844_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75322.1|62886_63393_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AVB75323.1|63797_64577_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75324.1|64630_65050_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVB75325.1|65060_65282_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75326.1|65281_65959_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AVB75327.1|66317_66989_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AVB75328.1|67168_67591_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AVB75329.1|67590_68862_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AVB75330.1|68997_69969_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AVB75331.1|69965_71171_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AVB75332.1|71533_72166_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AVB75333.1|72219_72420_+	hypothetical protein	NA	NA	NA	NA	NA
AVB75334.1|72566_73517_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AVB75335.1|73513_74125_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVB75356.1|74121_74517_-	hypothetical protein	NA	NA	NA	NA	NA
AVB75336.1|75030_76011_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
CP026590	Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence	49215	11561	18459	49215	integrase,transposase	Escherichia_phage(33.33%)	8	12247:12261	22131:22145
AVB75372.1|11561_12266_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
12247:12261	attL	GCAGAGTTTTTGAAA	NA	NA	NA	NA
AVB75373.1|12480_13494_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVB75374.1|13640_14123_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AVB75375.1|14343_14610_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AVB75376.1|14752_15517_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVB75377.1|15558_15771_+	resolvase	NA	NA	NA	NA	NA
AVB75378.1|15783_16992_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AVB75379.1|17025_18459_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
22131:22145	attR	GCAGAGTTTTTGAAA	NA	NA	NA	NA
