The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	8512	18467	4166265	holin	Bacillus_phage(100.0%)	11	NA	NA
AVB08076.1|8512_9556_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	56.1	6.1e-91
AVB11839.1|9662_10034_+	hypothetical protein	NA	NA	NA	NA	NA
AVB08077.1|10046_10298_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
AVB08078.1|10358_10640_+	hypothetical protein	NA	NA	NA	NA	NA
AVB08079.1|11062_12223_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
AVB08080.1|12386_13637_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	90.9	5.7e-221
AVB08081.1|13629_13962_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	6.3e-42
AVB08082.1|14189_14963_-	sporulation protein YunB	NA	NA	NA	NA	NA
AVB08083.1|15091_15295_-	hypothetical protein	NA	NA	NA	NA	NA
AVB08084.1|16062_16551_-	TIGR01741 family protein	NA	NA	NA	NA	NA
AVB08085.1|16556_18467_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	67.1	1.7e-163
>prophage 2
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	121554	127806	4166265		Staphylococcus_phage(66.67%)	10	NA	NA
AVB08186.1|121554_122148_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AVB08187.1|122137_122893_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	5.0e-10
AVB08188.1|123100_123190_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AVB08189.1|123277_123799_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVB08190.1|123743_123959_+	hypothetical protein	NA	NA	NA	NA	NA
AVB08191.1|123864_124239_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVB08192.1|124354_124819_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AVB08193.1|124851_126048_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
AVB08194.1|126062_126710_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
AVB08195.1|126690_127806_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	4.4e-55
>prophage 3
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	1491196	1540399	4166265	protease,coat	Staphylococcus_phage(16.67%)	49	NA	NA
AVB09442.1|1491196_1491856_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AVB09443.1|1491961_1492150_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AVB09444.1|1492187_1492607_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVB09445.1|1492990_1494370_+	amino acid permease	NA	NA	NA	NA	NA
AVB09446.1|1494434_1494935_-	YwgA family protein	NA	NA	NA	NA	NA
AVB09447.1|1494974_1496276_-	hypothetical protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	1.8e-23
AVB09448.1|1496435_1496660_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AVB09449.1|1496862_1497636_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AVB09450.1|1497935_1498211_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVB09451.1|1498211_1498766_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVB09452.1|1498863_1499784_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.1	6.4e-36
AVB09453.1|1499780_1500734_+	ABC transporter permease	NA	NA	NA	NA	NA
AVB09454.1|1500723_1501560_-	hypothetical protein	NA	NA	NA	NA	NA
AVB09455.1|1501550_1502348_-	hypothetical protein	NA	NA	NA	NA	NA
AVB09456.1|1502316_1503240_-	hypothetical protein	NA	NA	NA	NA	NA
AVB09457.1|1503288_1503468_-	hypothetical protein	NA	NA	NA	NA	NA
AVB09458.1|1503620_1504484_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AVB09459.1|1504530_1505430_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
AVB09460.1|1505545_1506523_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AVB09461.1|1506559_1507531_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AVB09462.1|1507793_1508558_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AVB09463.1|1508677_1509457_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AVB09464.1|1509473_1510673_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVB09465.1|1510685_1511867_-	MFS transporter	NA	NA	NA	NA	NA
AVB09466.1|1511863_1513282_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AVB09467.1|1513299_1514061_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
AVB09468.1|1514057_1514768_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVB09469.1|1514757_1515372_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AVB09470.1|1516993_1518196_+	MFS transporter	NA	S4TR35	Salmonella_phage	26.9	7.1e-27
AVB09471.1|1519671_1521354_-	peptidase M20	NA	NA	NA	NA	NA
AVB09472.1|1521425_1522973_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVB09473.1|1523180_1524467_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AVB09474.1|1524698_1525634_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	7.5e-24
AVB09475.1|1525635_1526334_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.8	1.4e-35
AVB09476.1|1526525_1527392_-	protein liaG	NA	NA	NA	NA	NA
AVB09477.1|1527412_1528117_-	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AVB11911.1|1528181_1529108_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
AVB09478.1|1529466_1529922_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB09479.1|1529918_1530767_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
AVB09480.1|1530787_1531735_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	2.3e-68
AVB09481.1|1531737_1532475_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AVB09482.1|1532502_1533507_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB09483.1|1533508_1534252_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB09484.1|1534241_1535363_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB09485.1|1535362_1536226_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVB09486.1|1536226_1537396_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AVB09487.1|1537418_1538843_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AVB09488.1|1538847_1539618_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AVB09489.1|1539898_1540399_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 4
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	2407034	2460147	4166265	capsid,portal,terminase,head,protease,integrase,tRNA,tail,plate,holin	Bacillus_phage(56.82%)	69	2417296:2417317	2461380:2461401
AVB10254.1|2407034_2407511_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AVB10255.1|2407491_2408181_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVB10256.1|2408191_2408647_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AVB10257.1|2408639_2409680_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	4.1e-63
AVB10258.1|2409904_2411833_-	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	2.1e-60
AVB10259.1|2411972_2412485_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AVB10260.1|2412481_2413129_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AVB10261.1|2413147_2413318_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AVB10262.1|2413324_2414086_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AVB10263.1|2414123_2414315_-	DUF4305 domain-containing protein	NA	NA	NA	NA	NA
AVB10264.1|2414311_2415046_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVB10265.1|2415282_2415567_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
AVB10266.1|2415608_2417243_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
2417296:2417317	attL	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
AVB10267.1|2417324_2418542_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	63.9	7.5e-141
AVB10268.1|2418555_2419188_-	XRE family transcriptional regulator	NA	A0A1B2APZ3	Phage_Wrath	61.0	2.1e-70
AVB10269.1|2419352_2419601_+	XRE family transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	67.1	5.0e-20
AVB10270.1|2419623_2419824_+	DNA-binding protein	NA	NA	NA	NA	NA
AVB10271.1|2419835_2420582_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	74.6	1.3e-100
AVB10272.1|2420595_2420826_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10273.1|2420953_2421229_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10274.1|2421282_2421597_-	hypothetical protein	NA	NA	NA	NA	NA
AVB10275.1|2421651_2421921_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	57.0	2.4e-23
AVB10276.1|2422118_2422676_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
AVB10277.1|2422679_2423612_+	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
AVB10278.1|2423611_2424049_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
AVB10279.1|2424109_2426542_+	DNA primase	NA	D6R422	Bacillus_phage	80.5	0.0e+00
AVB10280.1|2426768_2427140_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10281.1|2427117_2427555_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	77.9	1.0e-63
AVB10282.1|2427551_2428091_+	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	5.0e-89
AVB10283.1|2428087_2428258_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	65.1	1.4e-08
AVB10284.1|2428261_2428777_+	hypothetical protein	NA	D6R425	Bacillus_phage	84.2	1.8e-83
AVB10285.1|2428773_2429187_+	hypothetical protein	NA	Q5YA89	Bacillus_phage	43.5	3.1e-22
AVB10286.1|2429186_2429603_+	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	58.3	1.4e-22
AVB10287.1|2429733_2430048_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10288.1|2430060_2430498_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	74.3	1.1e-54
AVB11948.1|2430585_2430807_+	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.0	1.8e-08
AVB10289.1|2430919_2431300_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	5.1e-48
AVB10290.1|2431951_2432191_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10291.1|2432177_2432435_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	62.7	9.8e-27
AVB10292.1|2432431_2432740_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10293.1|2432736_2432937_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10294.1|2432967_2433528_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10295.1|2433514_2433829_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10296.1|2433855_2434230_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	1.2e-28
AVB11949.1|2434459_2434975_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	1.7e-33
AVB10297.1|2434971_2436681_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	64.0	1.9e-211
AVB10298.1|2436692_2436884_+	DUF1056 domain-containing protein	NA	NA	NA	NA	NA
AVB10299.1|2436884_2438195_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.5	1.4e-105
AVB10300.1|2438139_2438871_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.2	4.0e-57
AVB10301.1|2438909_2440193_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.8	2.7e-80
AVB10302.1|2440217_2440646_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.4	9.3e-14
AVB10303.1|2440666_2440969_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	8.0e-12
AVB10304.1|2440958_2441267_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	39.6	7.4e-13
AVB10305.1|2441266_2441665_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10306.1|2441661_2442045_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10307.1|2442059_2442677_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVB10308.1|2442733_2443099_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10309.1|2443307_2447777_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.6	4.2e-72
AVB10310.1|2447776_2448613_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	1.3e-107
AVB10311.1|2448625_2450338_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	67.8	9.9e-224
AVB10312.1|2452948_2454289_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.7	4.3e-65
AVB10313.1|2454303_2454606_+	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
AVB10314.1|2454602_2454779_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	8.5e-06
AVB10315.1|2454813_2455224_+|holin	holin	holin	A0A0N7GFE6	Paenibacillus_phage	50.0	3.9e-25
AVB10316.1|2455275_2456118_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	56.7	8.7e-48
AVB10317.1|2456152_2456569_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	58.0	3.5e-42
AVB10318.1|2456580_2458230_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	49.6	9.1e-57
AVB10319.1|2458482_2459604_+	tetratricopeptide repeat-containing protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
AVB11950.1|2459826_2460147_-	YolD-like family protein	NA	O64030	Bacillus_phage	36.9	6.5e-12
2461380:2461401	attR	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
>prophage 5
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	2531525	2541416	4166265		Synechococcus_phage(50.0%)	9	NA	NA
AVB10380.1|2531525_2532818_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AVB10381.1|2532893_2533613_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
AVB10382.1|2533612_2533867_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AVB10383.1|2533863_2534547_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVB10384.1|2534530_2536759_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	2.1e-157
AVB10385.1|2536734_2538165_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AVB10386.1|2538256_2539297_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
AVB10387.1|2539293_2539881_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
AVB10388.1|2539877_2541416_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	1.9e-77
>prophage 6
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3004730	3038328	4166265	coat,tRNA	Planktothrix_phage(16.67%)	37	NA	NA
AVB10817.1|3004730_3005723_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVB10818.1|3006464_3008099_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVB10819.1|3008205_3009141_+	ABC transporter permease	NA	NA	NA	NA	NA
AVB10820.1|3009144_3010062_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVB10821.1|3010074_3011151_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
AVB10822.1|3011143_3012061_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AVB10823.1|3012167_3013355_+	GTP-binding protein	NA	NA	NA	NA	NA
AVB10824.1|3013472_3014051_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVB10825.1|3014229_3014625_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVB10826.1|3014680_3015337_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
AVB10827.1|3015612_3016269_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVB10828.1|3016419_3017580_+	competence protein CoiA	NA	NA	NA	NA	NA
AVB11975.1|3017807_3019637_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AVB10829.1|3020127_3021030_-	DsbA family protein	NA	NA	NA	NA	NA
AVB10830.1|3021026_3021425_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AVB10831.1|3021653_3022340_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
AVB10832.1|3022344_3022917_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVB10833.1|3023041_3023407_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10834.1|3023434_3024070_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AVB10835.1|3024087_3024888_+	NAD kinase	NA	NA	NA	NA	NA
AVB10836.1|3024902_3025796_+	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	4.7e-07
AVB10837.1|3025828_3026578_-	hypothetical protein	NA	A0A1V0SJW2	Klosneuvirus	26.7	3.4e-11
AVB10838.1|3026805_3028650_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVB11976.1|3028899_3029607_+	thiaminase II	NA	NA	NA	NA	NA
AVB11977.1|3029584_3030202_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AVB10839.1|3030185_3031295_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AVB10840.1|3031291_3031495_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AVB10841.1|3031491_3032262_+	thiazole synthase	NA	NA	NA	NA	NA
AVB10842.1|3032258_3033269_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AVB10843.1|3033291_3034104_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVB10844.1|3034234_3035011_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVB10845.1|3035108_3035717_+|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10846.1|3035774_3036218_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10847.1|3036363_3036846_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10848.1|3036996_3037497_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10849.1|3037589_3037904_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10850.1|3037941_3038328_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3098741	3133684	4166265	holin,coat,portal,terminase	Bacillus_phage(41.18%)	40	NA	NA
AVB10914.1|3098741_3098924_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVB10915.1|3099037_3099211_-	putative motility protein	NA	NA	NA	NA	NA
AVB10916.1|3099254_3099656_-	hypothetical protein	NA	NA	NA	NA	NA
AVB10917.1|3099753_3100323_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AVB10918.1|3100447_3103405_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AVB10919.1|3103397_3103940_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AVB10920.1|3104147_3105368_+	cytochrome P450	NA	NA	NA	NA	NA
AVB10921.1|3105364_3106549_+	UDP-glucosyltransferase	NA	A0A1L5JH75	Plodia_interpunctella_granulovirus	27.9	7.3e-08
AVB10922.1|3106591_3106777_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
AVB10923.1|3106952_3107771_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AVB10924.1|3107795_3108557_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVB10925.1|3108558_3109296_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.3	2.4e-17
AVB10926.1|3109322_3110306_-	hypothetical protein	NA	NA	NA	NA	NA
AVB10927.1|3110435_3110933_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10928.1|3111319_3111736_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AVB10929.1|3111775_3112954_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVB10930.1|3113139_3114537_+	glucuronate isomerase	NA	NA	NA	NA	NA
AVB10931.1|3116009_3117008_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVB10932.1|3117083_3118529_+	altronate oxidoreductase	NA	NA	NA	NA	NA
AVB10933.1|3118525_3120019_+	altronate hydrolase	NA	NA	NA	NA	NA
AVB10934.1|3120052_3120817_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVB10935.1|3120962_3121430_-	hypothetical protein	NA	NA	NA	NA	NA
AVB10936.1|3121634_3122771_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AVB10937.1|3123037_3123991_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
AVB10938.1|3124028_3124406_-	helicase	NA	A5GYQ0	Lactococcus_phage	41.4	2.0e-15
AVB10939.1|3124515_3125121_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
AVB10940.1|3125275_3125866_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AVB10941.1|3126014_3126353_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AVB10942.1|3126544_3126724_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10943.1|3126713_3127541_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.5	2.9e-19
AVB10944.1|3127440_3128241_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	6.1e-59
AVB10945.1|3128505_3128847_+|portal	phage portal protein	portal	NA	NA	NA	NA
AVB10946.1|3128836_3129040_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
AVB10947.1|3129146_3129659_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
AVB10948.1|3129771_3130431_+|terminase	terminase	terminase	A0A1B1P867	Bacillus_phage	33.3	4.5e-07
AVB10949.1|3130808_3131180_+	hypothetical protein	NA	NA	NA	NA	NA
AVB10950.1|3131438_3132200_+|portal	phage portal protein	portal	NA	NA	NA	NA
AVB10951.1|3132251_3132515_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.5	2.1e-24
AVB10952.1|3132528_3132792_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AVB10953.1|3132805_3133684_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 8
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3671081	3677295	4166265		Bacillus_phage(50.0%)	7	NA	NA
AVB11384.1|3671081_3671474_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	1.1e-29
AVB11385.1|3671433_3673536_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
AVB11386.1|3673553_3674543_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AVB11387.1|3674591_3675209_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	4.6e-46
AVB11388.1|3675261_3676020_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
AVB11389.1|3676053_3676278_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11390.1|3676326_3677295_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 9
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3705585	3723326	4166265	tail	Bacillus_phage(71.43%)	18	NA	NA
AVB12003.1|3705585_3712467_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	79.0	0.0e+00
AVB11408.1|3712529_3713156_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	34.3	4.4e-28
AVB11409.1|3713227_3713638_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11410.1|3713731_3713914_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11411.1|3713942_3714995_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
AVB11412.1|3714991_3715492_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11413.1|3715647_3716664_-	recombinase XerD	NA	A0A0K2FM05	Brevibacillus_phage	59.7	3.7e-109
AVB11414.1|3716638_3717055_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	5.3e-46
AVB11415.1|3717054_3717540_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.9	6.3e-59
AVB11416.1|3717629_3717776_-	XkdX family protein	NA	A0A2H4PQV2	Staphylococcus_phage	46.8	1.6e-05
AVB11417.1|3717777_3718161_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	48.7	3.2e-21
AVB11418.1|3718175_3719684_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	75.9	1.2e-31
AVB11419.1|3719683_3720040_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
AVB11420.1|3720111_3720579_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11421.1|3720599_3721397_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.8	3.1e-18
AVB11422.1|3721435_3722161_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.5e-27
AVB11423.1|3722157_3722664_-	hypothetical protein	NA	O64060	Bacillus_phage	67.9	9.9e-63
AVB11424.1|3722660_3723326_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	54.7	5.8e-47
>prophage 10
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3744968	3754396	4166265		Bacillus_phage(83.33%)	7	NA	NA
AVB11447.1|3744968_3746201_+	hypothetical protein	NA	O64082	Bacillus_phage	64.5	2.9e-156
AVB11448.1|3746493_3748380_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11449.1|3748430_3750032_+	DNA methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	33.1	1.9e-14
AVB11450.1|3750217_3751072_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	93.0	2.2e-139
AVB11451.1|3751076_3751994_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	88.6	2.0e-138
AVB11452.1|3751995_3752598_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	98.0	3.6e-104
AVB11453.1|3752599_3754396_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.2	0.0e+00
>prophage 11
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3758435	3786597	4166265	integrase	Bacillus_phage(90.62%)	50	3756860:3756878	3777318:3777336
3756860:3756878	attL	AAGAGTAAAAATAAAATTA	NA	NA	NA	NA
AVB11459.1|3758435_3758639_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	78.8	2.6e-22
AVB12006.1|3758728_3758950_+	hypothetical protein	NA	NA	NA	NA	NA
AVB12007.1|3759181_3759448_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11460.1|3759475_3759865_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11461.1|3759912_3760392_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11462.1|3760440_3760668_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11463.1|3760692_3760917_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11464.1|3760930_3761113_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	84.5	1.4e-24
AVB11465.1|3761183_3761435_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.2	9.3e-22
AVB11466.1|3761437_3761653_+	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	5.2e-13
AVB11467.1|3761664_3761796_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
AVB11468.1|3761812_3762370_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11469.1|3762387_3762720_+	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	59.4	1.3e-31
AVB11470.1|3762805_3763216_+	pilus assembly protein HicB	NA	A0A1L2JY34	Aeribacillus_phage	58.9	1.0e-38
AVB11471.1|3763377_3764517_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11472.1|3765109_3765322_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
AVB11473.1|3765336_3765567_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
AVB11474.1|3765778_3766837_+|integrase	integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.4	8.7e-154
AVB11475.1|3766913_3768263_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.7	2.5e-190
AVB11476.1|3768283_3769267_+|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	77.1	4.8e-138
AVB11477.1|3769487_3769709_-	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
AVB11478.1|3769874_3770174_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	49.0	1.8e-19
AVB11479.1|3770248_3770494_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
AVB11480.1|3770602_3770827_+	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	50.6	1.5e-15
AVB11481.1|3770862_3771087_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11482.1|3771083_3771296_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11483.1|3771283_3771466_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11484.1|3771462_3771663_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11485.1|3771659_3771935_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	3.1e-18
AVB11486.1|3771969_3772179_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11487.1|3772175_3772514_+	hypothetical protein	NA	O64111	Bacillus_phage	78.6	2.6e-43
AVB11488.1|3772520_3772928_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	90.4	3.4e-66
AVB11489.1|3772967_3773654_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11490.1|3773893_3776092_+	phosphatase	NA	Q4Z932	Staphylococcus_phage	43.1	6.9e-161
AVB11491.1|3776136_3776586_+	hypothetical protein	NA	W5QUC5	Bacillus_phage	36.2	2.3e-15
AVB11492.1|3776655_3776898_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	90.0	4.1e-35
AVB11493.1|3776909_3777155_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11494.1|3777351_3777567_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	94.4	7.9e-30
3777318:3777336	attR	AAGAGTAAAAATAAAATTA	NA	NA	NA	NA
AVB11495.1|3777580_3777955_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.2	1.4e-37
AVB11496.1|3778321_3778630_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11497.1|3778673_3779111_+	DUF1768 domain-containing protein	NA	A0A172JI41	Bacillus_phage	67.6	1.8e-49
AVB11498.1|3780219_3780480_+	hypothetical protein	NA	U5PXA4	Bacillus_phage	54.9	2.8e-21
AVB11499.1|3780597_3781410_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.9	1.6e-139
AVB11500.1|3781479_3782154_-	hypothetical protein	NA	A0A1P8CX02	Bacillus_phage	95.8	4.2e-77
AVB11501.1|3782224_3782470_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	85.5	7.2e-27
AVB12008.1|3782495_3782747_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11502.1|3782762_3783239_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	36.0	2.2e-08
AVB11503.1|3783313_3783532_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11504.1|3783642_3784464_+	hypothetical protein	NA	O64134	Bacillus_phage	61.4	3.5e-86
AVB11505.1|3786219_3786597_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	3.4e-52
>prophage 12
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3790723	3819634	4166265	tRNA	Bacillus_phage(78.12%)	43	NA	NA
AVB11510.1|3790723_3792205_+	DNA helicase	NA	A0A2R2ZGP1	Clostridioides_phage	30.2	4.5e-55
AVB11511.1|3792226_3793243_+	hypothetical protein	NA	A0A1W6JK26	Lactococcus_phage	25.6	3.7e-16
AVB11512.1|3793259_3794321_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11513.1|3794330_3796055_+	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	55.1	1.8e-177
AVB12009.1|3796117_3796771_+	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	36.1	5.2e-24
AVB11514.1|3796782_3796986_+	hypothetical protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
AVB11515.1|3797145_3797643_+	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	77.6	3.1e-69
AVB11516.1|3797682_3798030_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11517.1|3798154_3798991_+	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	42.9	5.3e-45
AVB11518.1|3799036_3799732_+|tRNA	tRNA methyltransferase	tRNA	A0A0N9SHZ9	Staphylococcus_phage	45.6	5.2e-46
AVB11519.1|3799745_3800720_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7RCS2	Vibrio_phage	42.4	1.7e-66
AVB11520.1|3800774_3800993_+	hypothetical protein	NA	O64155	Bacillus_phage	60.0	4.3e-15
AVB11521.1|3801030_3801258_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	69.3	1.2e-23
AVB11522.1|3801531_3801717_+	hypothetical protein	NA	A0A1P8CX22	Bacillus_phage	66.7	1.6e-18
AVB11523.1|3802087_3802558_+	hypothetical protein	NA	O64162	Bacillus_phage	85.9	1.0e-74
AVB11524.1|3802712_3803033_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	80.2	7.6e-45
AVB11525.1|3803045_3803468_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	62.2	7.5e-40
AVB11526.1|3803503_3803797_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11527.1|3803840_3804218_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11528.1|3804224_3804437_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	82.9	1.1e-28
AVB11529.1|3804782_3804995_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11530.1|3804987_3805233_+	hypothetical protein	NA	O64168	Bacillus_phage	67.5	6.7e-09
AVB11531.1|3805435_3805792_+	hypothetical protein	NA	O64171	Bacillus_phage	47.5	4.5e-22
AVB12010.1|3805794_3806184_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	82.9	4.4e-55
AVB12011.1|3806191_3806869_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.4e-120
AVB11532.1|3809668_3810190_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.9	7.5e-90
AVB11533.1|3810770_3811019_+	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	76.2	1.2e-29
AVB11534.1|3811018_3811525_+	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	33.7	4.6e-12
AVB11535.1|3811576_3812005_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	1.4e-73
AVB11536.1|3812105_3812540_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11537.1|3812850_3813159_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11538.1|3813151_3813451_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	53.5	6.7e-19
AVB11539.1|3813819_3814212_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	60.5	1.2e-36
AVB12012.1|3814208_3814718_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11540.1|3814887_3815727_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	88.5	1.8e-149
AVB11541.1|3815726_3816233_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	41.5	7.4e-34
AVB11542.1|3816361_3816727_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11543.1|3816786_3817131_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11544.1|3817130_3818126_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	39.8	9.4e-49
AVB11545.1|3818122_3818326_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11546.1|3818566_3818773_+	hypothetical protein	NA	O64193	Bacillus_phage	69.0	3.1e-15
AVB12013.1|3818762_3819005_-	transcriptional regulator	NA	O64194	Bacillus_phage	92.3	5.4e-35
AVB11547.1|3819079_3819634_+	hypothetical protein	NA	O64195	Bacillus_phage	94.4	3.4e-93
>prophage 13
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3850748	3860155	4166265	transposase	Bacillus_phage(87.5%)	11	NA	NA
AVB11585.1|3850748_3852416_-	recombinase family protein	NA	O64015	Bacillus_phage	90.9	4.9e-276
AVB11586.1|3852473_3852782_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11587.1|3852917_3853901_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.5	1.6e-77
AVB12016.1|3854156_3854594_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVB11588.1|3854630_3856517_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	58.6	3.0e-120
AVB11589.1|3856529_3856988_+	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	81.6	3.2e-68
AVB11590.1|3857013_3857499_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	88.8	8.8e-85
AVB11591.1|3857685_3857823_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11592.1|3858047_3858515_+	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	56.5	8.0e-43
AVB11593.1|3858520_3858880_+	hypothetical protein	NA	O64028	Bacillus_phage	61.4	7.5e-33
AVB11594.1|3858907_3860155_-|transposase	IS256 family transposase ISBsu2	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 14
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	3863601	3869707	4166265		Bacillus_phage(83.33%)	7	NA	NA
AVB11598.1|3863601_3863934_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	72.7	3.4e-40
AVB11599.1|3863926_3865177_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.1	1.5e-221
AVB11600.1|3865340_3866501_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
AVB11601.1|3867561_3867936_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	53.7	3.6e-30
AVB12017.1|3868350_3868704_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AVB11602.1|3869071_3869248_+	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
AVB11603.1|3869281_3869707_-	SDR family oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
>prophage 15
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	4100218	4109237	4166265	transposase	Bacillus_phage(66.67%)	9	NA	NA
AVB11782.1|4100218_4100839_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
AVB11783.1|4101178_4101607_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11784.1|4101760_4102210_+	DUF2512 domain-containing protein	NA	NA	NA	NA	NA
AVB11785.1|4102237_4103068_-	hypothetical protein	NA	A0A172JI70	Bacillus_phage	72.3	6.5e-104
AVB11786.1|4103309_4104134_-	replication protein	NA	O64134	Bacillus_phage	41.9	2.7e-49
AVB11787.1|4104531_4105884_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.6	3.1e-87
AVB11788.1|4106004_4106439_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	85.2	8.7e-68
AVB11789.1|4106435_4106618_-	hypothetical protein	NA	NA	NA	NA	NA
AVB11790.1|4106819_4109237_+	peptidase G2	NA	D6R401	Bacillus_phage	50.3	2.1e-219
>prophage 16
CP026533	Bacillus velezensis strain DKU_NT_04 chromosome, complete genome	4166265	4148510	4159407	4166265		Bacillus_phage(75.0%)	15	NA	NA
AVB11822.1|4148510_4149176_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.5	3.1e-48
AVB11823.1|4149172_4149679_+	hypothetical protein	NA	O64060	Bacillus_phage	67.9	2.0e-63
AVB11824.1|4149675_4150401_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.6	1.1e-27
AVB11825.1|4150440_4151235_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	34.9	9.8e-17
AVB11826.1|4151255_4151723_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11827.1|4151794_4152151_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
AVB11828.1|4152150_4153659_+	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	75.9	1.2e-31
AVB11829.1|4153673_4154057_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	47.8	9.2e-21
AVB11830.1|4154058_4154205_+	XkdX family protein	NA	A0A2H4PQV2	Staphylococcus_phage	46.8	1.6e-05
AVB11831.1|4154294_4154780_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	67.7	1.9e-55
AVB11832.1|4154779_4155196_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.2	4.0e-46
AVB11833.1|4155546_4156666_+	DDE domain-containing protein	NA	A0A2I7SC85	Paenibacillus_phage	65.6	3.0e-104
AVB12028.1|4157474_4157690_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11834.1|4157857_4158358_+	hypothetical protein	NA	NA	NA	NA	NA
AVB11835.1|4158354_4159407_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
