The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	91547	112525	5531975	transposase	Bacillus_phage(50.0%)	21	NA	NA
AUY17397.1|91547_93080_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUY17398.1|93240_93507_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17399.1|93517_94312_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17400.1|94379_94802_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22426.1|94901_95324_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY22427.1|95653_96076_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY17401.1|96271_97324_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
AUY17402.1|97335_97653_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY17403.1|97655_97907_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17404.1|98602_99847_+	secretin	NA	NA	NA	NA	NA
AUY17405.1|99848_100817_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
AUY17406.1|100956_101154_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17407.1|101410_102043_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17408.1|102071_103475_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AUY17409.1|103586_105119_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUY17410.1|105295_105928_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17411.1|105956_107360_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AUY17412.1|108161_109172_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUY17413.1|109250_110231_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUY17414.1|110439_110811_-	DUF2255 domain-containing protein	NA	NA	NA	NA	NA
AUY17415.1|110986_112525_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	3.9e-280
>prophage 2
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	217705	228592	5531975		Escherichia_phage(87.5%)	9	NA	NA
AUY17518.1|217705_220813_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AUY17519.1|220867_222133_+	MFS transporter	NA	NA	NA	NA	NA
AUY17520.1|222163_223252_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUY17521.1|223338_223599_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AUY17522.1|223896_224757_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AUY17523.1|224777_225539_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUY17524.1|225799_226702_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AUY17525.1|226713_227979_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
AUY17526.1|227971_228592_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	421008	556192	5531975	holin,protease,tail,portal,transposase,terminase,capsid,plate,tRNA,head	Klebsiella_phage(60.47%)	148	NA	NA
AUY17702.1|421008_421944_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AUY17703.1|421989_423363_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
AUY17704.1|423377_423572_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17705.1|423888_424872_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUY22442.1|425150_425894_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.8e-16
AUY17706.1|425910_426975_+	oxidoreductase	NA	NA	NA	NA	NA
AUY17707.1|427211_427406_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17708.1|427518_428265_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17709.1|428515_429895_-	amino acid permease	NA	NA	NA	NA	NA
AUY17710.1|430229_430709_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUY17711.1|430960_431575_+	YitT family protein	NA	NA	NA	NA	NA
AUY17712.1|431613_432813_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUY17713.1|432841_433510_-	ABC transporter permease	NA	NA	NA	NA	NA
AUY22443.1|433502_434516_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
AUY17714.1|434524_435331_-	methionine-binding protein	NA	NA	NA	NA	NA
AUY17715.1|435551_436727_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AUY17716.1|436773_437808_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUY17717.1|437896_438445_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17718.1|438499_439411_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AUY17719.1|439403_440270_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUY17720.1|440360_441284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17721.1|441303_442209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17722.1|442348_443278_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AUY17723.1|443303_443510_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUY17724.1|443560_444439_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUY17725.1|444597_445353_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUY17726.1|445357_445951_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17727.1|446024_446738_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUY17728.1|446804_447299_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17729.1|447425_447968_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUY17730.1|447945_449031_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUY17731.1|448994_450749_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUY17732.1|450825_451296_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17733.1|451292_452348_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17734.1|452378_453977_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUY17735.1|453976_457432_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUY17736.1|457428_458637_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17737.1|458976_459201_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17738.1|460085_461184_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
AUY17739.1|461376_461898_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17740.1|464887_465250_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22444.1|465644_465920_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17741.1|466053_467265_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17742.1|467257_469777_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	1.1e-16
AUY17743.1|472687_473179_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUY17744.1|473183_474890_-	OmpA family protein	NA	NA	NA	NA	NA
AUY17745.1|474886_475576_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUY22445.1|475572_476913_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUY17746.1|476925_478470_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUY17747.1|478512_479004_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUY17748.1|479849_480098_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AUY17749.1|480505_480928_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUY17750.1|481005_481188_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AUY17751.1|481199_482000_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17752.1|484049_487118_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
AUY17753.1|487114_487495_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
AUY17754.1|487504_487987_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
AUY17755.1|487973_488453_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AUY17756.1|488452_490900_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
AUY17757.1|491476_491740_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AUY17758.1|491772_492126_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AUY17759.1|492169_492661_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AUY17760.1|493948_494146_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
AUY17761.1|495932_496613_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AUY17762.1|496618_497896_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AUY17763.1|497898_499431_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AUY17764.1|499440_499875_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AUY17765.1|499996_500206_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
AUY17766.1|500218_500509_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
AUY17767.1|500579_500786_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
AUY17768.1|500866_501103_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
AUY17769.1|501234_501495_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17770.1|501427_501700_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17771.1|501832_502117_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17772.1|502207_502402_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	1.5e-24
AUY17773.1|502352_502628_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
AUY17774.1|502635_503265_-	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AUY17775.1|503264_503546_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AUY17776.1|503532_503928_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AUY17777.1|504490_504937_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17778.1|505252_506035_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
AUY17779.1|506996_508655_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
AUY17780.1|508696_509065_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
AUY17781.1|509326_509611_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.1e-31
AUY17782.1|509735_509969_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
AUY17783.1|510109_510784_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
AUY17784.1|510947_511361_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17785.1|511543_511768_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17786.1|511768_512134_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AUY17787.1|512126_512381_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
AUY17788.1|512567_512993_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
AUY17789.1|512989_513184_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17790.1|513180_514008_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
AUY17791.1|514752_514944_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
AUY17792.1|514924_516106_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
AUY17793.1|516489_516738_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AUY17794.1|517145_517568_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUY17795.1|517645_517828_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AUY17796.1|517839_518640_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17797.1|520689_523758_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
AUY17798.1|523754_524135_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
AUY17799.1|524144_524627_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
AUY17800.1|527579_528047_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17801.1|528112_528376_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AUY17802.1|528408_528762_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AUY17803.1|528805_529297_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AUY17804.1|529352_529718_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AUY17805.1|529714_530254_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
AUY17806.1|530246_530579_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
AUY17807.1|530580_530778_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
AUY17808.1|530838_531165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
AUY17809.1|531391_532555_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
AUY17810.1|532566_533247_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AUY17811.1|533252_534530_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AUY17812.1|534532_536065_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AUY17813.1|536074_536509_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AUY17814.1|536630_536840_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
AUY17815.1|536852_537143_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
AUY17816.1|537213_537420_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
AUY17817.1|537500_537737_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
AUY17818.1|537868_538129_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17819.1|538061_538334_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17820.1|538466_538751_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17821.1|538841_539036_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	1.5e-24
AUY17822.1|538986_539262_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
AUY17823.1|539269_539899_-	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AUY17824.1|539898_540180_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AUY17825.1|540166_540562_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AUY17826.1|541124_541571_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17827.1|541885_542668_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
AUY17828.1|542664_543627_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
AUY17829.1|543628_545287_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
AUY17830.1|545328_545697_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
AUY17831.1|545958_546243_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.1e-31
AUY17832.1|546367_546601_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
AUY17833.1|546741_547416_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
AUY17834.1|547579_547993_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17835.1|548175_548400_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17836.1|548400_548766_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AUY17837.1|548758_549013_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
AUY17838.1|549199_549625_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
AUY17839.1|549621_549816_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17840.1|549812_550640_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
AUY17841.1|551384_551576_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
AUY17842.1|551556_552738_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
AUY17843.1|552970_553483_+|protease	protease	protease	NA	NA	NA	NA
AUY17844.1|553681_555214_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.5	1.5e-21
AUY17845.1|555430_556192_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
>prophage 4
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	677287	763699	5531975	holin,protease,tail,portal,capsid,transposase,terminase,tRNA,head,integrase	Salmonella_phage(16.13%)	100	677256:677315	762679:764123
677256:677315	attL	TGGACTGACCCCATAAAGTTGGATGGTTCATATTAAGCGGCTCTCAGAGCCTGGGTTCGG	NA	NA	NA	NA
AUY17957.1|677287_678651_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
AUY17958.1|678786_679338_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AUY17959.1|679503_681357_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AUY17960.1|681495_682515_+	L-asparaginase 1	NA	NA	NA	NA	NA
AUY17961.1|682524_683166_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	4.2e-18
AUY17962.1|683336_684590_+	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
AUY17963.1|684750_685095_+	HNH endonuclease	NA	NA	NA	NA	NA
AUY17964.1|685189_685468_-	DUF1315 domain-containing protein	NA	NA	NA	NA	NA
AUY17965.1|685511_685925_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUY17966.1|686263_687259_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUY17967.1|687333_688218_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
AUY17968.1|688274_689129_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
AUY17969.1|689220_689967_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AUY17970.1|690383_692318_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AUY17971.1|692403_693687_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
AUY17972.1|693732_694296_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17973.1|694454_694937_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AUY17974.1|695058_695370_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17975.1|695627_696509_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17976.1|696684_697902_+	MFS transporter	NA	NA	NA	NA	NA
AUY17977.1|697898_698648_-	KR domain-containing protein	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
AUY17978.1|698814_699720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY17979.1|699726_700992_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
AUY17980.1|700994_701414_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AUY17981.1|701492_702977_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUY17982.1|702976_703228_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17983.1|703585_703768_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	85.2	1.5e-18
AUY17984.1|703778_704579_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17985.1|706627_709705_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
AUY17986.1|709701_710082_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AUY17987.1|710094_710571_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.2	2.4e-50
AUY17988.1|710557_711031_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AUY17989.1|711052_714460_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.1	5.6e-194
AUY17990.1|714527_714911_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
AUY17991.1|715107_715638_-	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	2.1e-63
AUY17992.1|715830_716136_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	3.6e-28
AUY17993.1|716138_716543_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	8.5e-33
AUY17994.1|716573_717278_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
AUY17995.1|717334_717682_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	1.8e-31
AUY17996.1|717678_718128_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.9	1.3e-63
AUY17997.1|718124_718463_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	8.1e-37
AUY22451.1|718475_718808_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AUY17998.1|718813_719068_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17999.1|719113_720334_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	8.3e-140
AUY18000.1|720343_721051_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AUY18001.1|721026_722346_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
AUY18002.1|722352_724089_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AUY18003.1|724042_724507_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AUY18004.1|724690_725044_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	72.7	9.0e-47
AUY18005.1|725242_725704_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18006.1|725778_726024_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	61.7	3.0e-17
AUY22452.1|726152_726485_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	62.7	4.4e-35
AUY18007.1|727053_727338_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	75.5	1.1e-31
AUY18008.1|727423_727606_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18009.1|727811_728438_-	endolysin	NA	F1C591	Cronobacter_phage	76.8	1.5e-89
AUY18010.1|728437_728716_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.9	1.7e-32
AUY18011.1|728705_729095_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	79.1	2.6e-47
AUY18012.1|729789_730839_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.4	8.9e-167
AUY18013.1|730988_731180_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
AUY18014.1|731389_732220_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.9e-59
AUY22453.1|732238_733225_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.6	1.1e-89
AUY18015.1|733306_734128_-	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AUY18016.1|734217_734616_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	6.2e-44
AUY18017.1|734612_735089_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	61.8	1.4e-15
AUY18018.1|735085_736936_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	1.5e-196
AUY18019.1|738298_738757_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUY18020.1|738753_739665_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	4.4e-53
AUY18021.1|739654_739834_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AUY18022.1|740006_740555_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
AUY18023.1|740635_741103_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18024.1|741336_741567_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
AUY18025.1|741664_742297_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
AUY18026.1|742569_743085_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18027.1|743641_743827_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	65.0	1.2e-05
AUY18028.1|743901_744273_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
AUY18029.1|744325_745156_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
AUY22454.1|745291_745819_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	6.0e-63
AUY18030.1|745818_746019_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18031.1|746011_746797_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	6.9e-63
AUY18032.1|746924_747269_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18033.1|747696_747924_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18034.1|747920_748472_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
AUY18035.1|748464_748701_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
AUY18036.1|748697_748973_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
AUY18037.1|749001_749238_+	excisionase	NA	NA	NA	NA	NA
AUY18038.1|749227_750370_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
AUY18039.1|750482_751733_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AUY18040.1|751973_752624_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUY18041.1|752641_753100_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUY22455.1|753156_754263_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUY18042.1|754317_754959_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUY18043.1|754962_756333_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
AUY18044.1|756387_756750_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUY18045.1|756833_757640_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUY18046.1|757922_758594_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUY18047.1|758593_760060_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUY18048.1|760145_761267_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUY18049.1|761342_762705_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
AUY18050.1|762724_762904_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18051.1|763207_763699_-|transposase	transposase	transposase	NA	NA	NA	NA
762679:764123	attR	CCGAACCCAGGCTCTGAGAGCCGCTTAATATGAACCATCCAACTTTATGGGGTCAGTCCACTGCGCTTGCCGGGCCTACGGGTTCCGCGCTCACCGGCTGGACCGCAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGATGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACAGGTTCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGTTCTGCTGTTCACCGCCCGACGGCGCTGCGCTTGCCGGGCCTACGGTTCCCGCGCTCACCGGCTGAACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGCTGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTCCCGCGGTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCACTTTGTGGTTTCGATGGCGGCAATGTCTTACCCGAGCATTATCGCCTCTCGCCTGCATCAAATTCGCTTACCTCACCCGCCCAATCCGTCGGATACCATCCCCGGCGCACATCGCGATGAAAGGTCGAATACGGCCAATCCTGCACCCGACGGACATGACCGTGCTTAACGGGATTGATATAAACGTAATCCATATGCCGTCGGTAATCTTCTTCATTACGGATGGCATGTTCCCAGAATCGCGGCTGCCAGATATGGCGCTGCGCCAGCGCTCGGGTAAACATTTTTTTAATGTCCCGCCAGCGACCGGAATAATCGGTATCCCCCTCAGGTAGGGTCCAGATGCAGTGCATATGCTCTGGTAAAACCACCCAGGCGTTAATCAGAAAAGGTTTTTTGCTTTTAACAGACGCTGTAGCGGCACGCAGATGAACAATATGCCGCGTCAGGAGATCGCTGCGCCGATTTTGCAGGTTAACGGTGAAGAACCAGCAGCCGCCAGGGATATAACTGCGACGATAATCAGACATGTGAGGTTCCCTCCTCAGTATTAGCCTTATCGCTTTTGTCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTCCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGCTGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTTCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGACCCGCTCTAATGTTGAACGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTTCTGCGGTCACCGTCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATGAAGACAGGCACCCGCTCTGATGTTGAACGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGT	NA	NA	NA	NA
>prophage 5
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	903190	913359	5531975		Enterobacteria_phage(33.33%)	9	NA	NA
AUY18181.1|903190_903721_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
AUY18182.1|903717_904257_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
AUY18183.1|904258_904474_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
AUY18184.1|904803_904956_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	79.6	2.1e-13
AUY18185.1|905100_905754_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18186.1|905817_906030_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18187.1|906030_908955_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.3	3.9e-196
AUY22462.1|908954_910337_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18188.1|910644_913359_-	transglycosylase	NA	K4NWI2	Pseudomonas_phage	24.0	3.7e-23
>prophage 6
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	918395	942214	5531975	head,tail,integrase	Pectobacterium_phage(45.0%)	33	932795:932808	940276:940289
AUY18194.1|918395_918869_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	3.1e-26
AUY18195.1|918907_919903_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
AUY18196.1|919913_920639_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18197.1|920625_920949_-	GTP-binding protein	NA	NA	NA	NA	NA
AUY18198.1|920951_922616_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.2	4.5e-104
AUY18199.1|922615_924010_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	2.4e-58
AUY18200.1|924094_924547_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
AUY18201.1|924553_924814_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18202.1|924797_925031_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18203.1|925027_925384_-	enterotoxin	NA	NA	NA	NA	NA
AUY18204.1|925371_925695_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
AUY18205.1|925684_926278_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	71.6	4.7e-80
AUY18206.1|926346_926538_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18207.1|926913_927441_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	28.7	9.1e-11
AUY18208.1|927437_927917_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18209.1|928130_928823_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18210.1|929063_929297_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18211.1|929300_929951_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18212.1|929989_931378_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.3	2.0e-105
AUY22465.1|931374_932343_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
AUY22466.1|932360_932519_-	adenylate cyclase	NA	NA	NA	NA	NA
AUY18213.1|932602_933049_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.2	1.2e-27
932795:932808	attL	CTTGGCCAGGGCCA	NA	NA	NA	NA
AUY18214.1|933109_933310_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	48.3	1.4e-09
AUY18215.1|933392_933800_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	50.8	3.7e-28
AUY22467.1|934730_934964_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18216.1|935008_937138_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
AUY18217.1|937137_937704_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
AUY18218.1|937705_937891_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
AUY18219.1|937940_938135_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	66.1	4.4e-11
AUY18220.1|938100_938325_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
AUY18221.1|938328_939366_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
AUY18222.1|939632_941285_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
940276:940289	attR	TGGCCCTGGCCAAG	NA	NA	NA	NA
AUY18223.1|941554_942214_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 7
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	1059759	1069222	5531975	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AUY18308.1|1059759_1061481_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AUY22473.1|1061525_1062227_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUY18309.1|1062580_1062799_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUY18310.1|1062918_1065198_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	5.6e-166
AUY18311.1|1065228_1065546_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AUY18312.1|1065871_1066093_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AUY18313.1|1066047_1066230_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18314.1|1066169_1068110_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AUY18315.1|1068106_1069222_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	1140598	1149173	5531975	transposase	Cronobacter_phage(33.33%)	9	NA	NA
AUY18372.1|1140598_1142086_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	24.9	1.6e-15
AUY22481.1|1142745_1143579_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUY18373.1|1143568_1143919_+	hypothetical protein	NA	E5DSD7	Aeromonas_virus	35.2	9.0e-07
AUY18374.1|1143920_1144529_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18375.1|1144932_1145688_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	46.9	1.2e-59
AUY18376.1|1145684_1146425_+	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	46.3	2.3e-60
AUY18377.1|1146685_1147300_+	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	28.1	8.4e-08
AUY18378.1|1147569_1148148_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18379.1|1148192_1149173_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 9
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	1526863	1595215	5531975	holin,terminase,transposase,tRNA,head,integrase	Escherichia_phage(18.97%)	85	1544797:1544843	1592286:1592332
AUY18716.1|1526863_1528381_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AUY18717.1|1528712_1530188_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AUY18718.1|1530247_1532395_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AUY18719.1|1532477_1533812_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AUY18720.1|1534177_1535746_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AUY18721.1|1535892_1536054_+	ABC transporter	NA	NA	NA	NA	NA
AUY18722.1|1536092_1537073_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.0e-185
AUY18723.1|1537071_1537305_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18724.1|1537238_1537511_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUY18725.1|1537611_1538532_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	39.7	1.6e-50
AUY18726.1|1539042_1539909_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUY18727.1|1539981_1541286_-	citrate synthase	NA	NA	NA	NA	NA
AUY18728.1|1541796_1541967_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AUY18729.1|1542045_1542447_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUY18730.1|1542617_1542758_+	ABC transporter	NA	NA	NA	NA	NA
AUY18731.1|1542796_1543777_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUY18732.1|1544042_1544336_-	hypothetical protein	NA	NA	NA	NA	NA
1544797:1544843	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUY18733.1|1545431_1545683_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18734.1|1547049_1547484_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18735.1|1547450_1547639_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18736.1|1547639_1548347_+	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
AUY18737.1|1548437_1548617_-	hypothetical protein	NA	H2DE47	Erwinia_phage	49.2	7.1e-08
AUY18738.1|1551167_1552211_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
AUY18739.1|1552212_1552800_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	3.2e-33
AUY18740.1|1552792_1554025_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.5	1.1e-104
AUY18741.1|1554032_1554389_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18742.1|1554843_1555434_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	7.6e-06
AUY18743.1|1555423_1556293_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.5	2.0e-26
AUY18744.1|1556289_1556595_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
AUY18745.1|1556596_1557436_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.7	3.8e-27
AUY18746.1|1557439_1559398_-	transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.2	9.8e-42
AUY18747.1|1559602_1560079_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	3.2e-07
AUY18748.1|1560131_1560386_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
AUY18749.1|1560388_1561144_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
AUY18750.1|1561324_1561768_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18751.1|1561767_1563249_-	hypothetical protein	NA	Q2NPD0	Xanthomonas_phage	34.4	6.7e-59
AUY18752.1|1563252_1563804_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18753.1|1563785_1564154_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	30.6	1.5e-07
AUY18754.1|1564150_1564714_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	4.8e-18
AUY18755.1|1564716_1565160_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
AUY18756.1|1565159_1565486_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	42.6	2.1e-10
AUY18757.1|1565487_1566525_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	4.2e-84
AUY18758.1|1566524_1567007_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
AUY18759.1|1567008_1568826_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	6.9e-58
AUY18760.1|1568888_1569578_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	54.9	2.9e-65
AUY18761.1|1569630_1571151_-	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	5.7e-106
AUY18762.1|1571151_1572828_-|terminase	terminase	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
AUY18763.1|1572829_1573462_-|terminase	terminase small subunit	terminase	A0A2I7RHH8	Vibrio_phage	48.0	1.6e-41
AUY18764.1|1573920_1574310_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
AUY22500.1|1574306_1574804_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
AUY18765.1|1574781_1575051_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AUY18766.1|1575766_1576576_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
AUY18767.1|1576709_1576940_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18768.1|1576936_1577545_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
AUY22501.1|1577537_1577708_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AUY18769.1|1577713_1578310_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.3e-57
AUY18770.1|1578473_1578713_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
AUY18771.1|1578705_1578894_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	71.7	2.7e-18
AUY18772.1|1578893_1579091_-	hypothetical protein	NA	NA	NA	NA	NA
AUY18773.1|1580051_1580564_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.6	4.8e-73
AUY18774.1|1580563_1581238_-	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	49.7	1.6e-28
AUY18775.1|1581234_1581504_-	antitoxin	NA	NA	NA	NA	NA
AUY22502.1|1581500_1582064_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	42.9	8.2e-10
AUY18776.1|1582300_1582594_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
AUY18777.1|1582590_1583439_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
AUY18778.1|1583435_1584296_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	3.5e-60
AUY18779.1|1584382_1584604_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AUY18780.1|1584643_1584865_-	transcriptional regulator	NA	Q716D6	Shigella_phage	55.1	1.8e-13
AUY18781.1|1584967_1585663_+	phage repressor protein C	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
AUY18782.1|1585682_1586117_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18783.1|1586578_1586773_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18784.1|1586861_1587146_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
AUY18785.1|1587161_1588007_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	2.0e-68
AUY18786.1|1588003_1588684_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.0	1.1e-122
AUY18787.1|1588680_1589109_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
AUY18788.1|1589105_1589762_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AUY18789.1|1589758_1589977_+	hypothetical protein	NA	NA	NA	NA	NA
AUY18790.1|1589973_1590198_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
AUY18791.1|1590194_1590680_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
AUY18792.1|1590676_1590895_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AUY18793.1|1591108_1592272_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
AUY18794.1|1592341_1592665_-	hypothetical protein	NA	NA	NA	NA	NA
1592286:1592332	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUY18795.1|1592703_1593570_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AUY18796.1|1593571_1593784_+	ribosome-associated protein	NA	NA	NA	NA	NA
AUY18797.1|1593829_1595215_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4149073	4254350	5531975	holin,protease,tail,portal,terminase,transposase,capsid,tRNA,head	Klebsiella_phage(50.0%)	115	NA	NA
AUY21130.1|4149073_4150054_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUY22602.1|4150092_4150215_-	ABC transporter	NA	NA	NA	NA	NA
AUY22603.1|4150373_4150736_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUY21131.1|4150746_4151319_-	flavin reductase	NA	NA	NA	NA	NA
AUY21132.1|4151530_4152415_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY21133.1|4152539_4153340_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21134.1|4154154_4154340_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21135.1|4154377_4155202_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AUY21136.1|4155398_4157732_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
AUY21137.1|4157743_4158064_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21138.1|4158060_4158288_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21139.1|4158284_4158614_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.5	1.6e-29
AUY21140.1|4158567_4158834_-	ash family protein	NA	NA	NA	NA	NA
AUY21141.1|4159638_4160376_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.7	7.1e-70
AUY21142.1|4160372_4160618_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
AUY21143.1|4160635_4161202_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
AUY21144.1|4161723_4163883_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21145.1|4163884_4164802_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AUY21146.1|4164956_4166147_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.0	3.4e-106
AUY21147.1|4166477_4167386_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
AUY21148.1|4167873_4169049_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.8	7.3e-210
AUY21149.1|4169003_4169216_-	excisionase	NA	I6PBM8	Cronobacter_phage	74.2	8.4e-24
AUY21150.1|4169273_4169486_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AUY21151.1|4169482_4169707_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
AUY21152.1|4169696_4170422_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	98.3	2.7e-130
AUY21153.1|4170427_4170946_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AUY21154.1|4171050_4171878_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AUY21155.1|4171874_4172069_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21156.1|4172065_4172491_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AUY21157.1|4172677_4172932_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AUY21158.1|4172924_4173290_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AUY21159.1|4173459_4173648_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AUY21160.1|4173640_4173955_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AUY21161.1|4174125_4174794_-	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AUY21162.1|4174891_4175113_+	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AUY21163.1|4175087_4175381_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AUY21164.1|4175689_4177348_+	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AUY21165.1|4177349_4178312_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AUY21166.1|4178308_4178785_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AUY21167.1|4178781_4179564_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
AUY21168.1|4179783_4180332_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21169.1|4180583_4180976_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
AUY21170.1|4180965_4181244_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
AUY21171.1|4181243_4181873_+	endolysin	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
AUY21172.1|4181880_4182156_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
AUY21173.1|4182106_4182301_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	3.1e-25
AUY21174.1|4182391_4182676_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21175.1|4182812_4183013_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.3e-18
AUY21176.1|4183409_4183655_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
AUY22604.1|4183751_4183964_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21177.1|4184073_4184370_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21178.1|4184426_4184660_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21179.1|4184647_4184998_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	1.0e-50
AUY21180.1|4185153_4185651_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
AUY21181.1|4185654_4187406_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
AUY21182.1|4187553_4188780_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AUY21183.1|4188772_4189372_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AUY21184.1|4189381_4190620_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AUY21185.1|4190697_4191015_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
AUY21186.1|4191084_4191282_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AUY21187.1|4191283_4191616_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	6.5e-55
AUY21188.1|4191608_4192148_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	93.3	8.5e-89
AUY21189.1|4192144_4192510_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
AUY21190.1|4192566_4193058_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
AUY21191.1|4193101_4193455_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	79.5	1.3e-48
AUY21192.1|4193487_4193751_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	86.0	8.2e-37
AUY21193.1|4194495_4196796_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	51.1	5.3e-180
AUY21194.1|4196795_4197275_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	5.6e-92
AUY21195.1|4197261_4197744_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
AUY21196.1|4197753_4198134_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AUY21197.1|4198130_4201199_+	kinase	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
AUY22605.1|4202070_4203363_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.0	3.1e-68
AUY21198.1|4203363_4204113_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21199.1|4204244_4205057_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21200.1|4207151_4207700_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.0	2.7e-90
AUY21201.1|4207784_4208033_-	DinI family protein	NA	S5MQI1	Escherichia_phage	69.5	8.0e-26
AUY21202.1|4208809_4209292_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AUY21203.1|4209402_4209879_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUY21204.1|4209868_4210159_+	RnfH family protein	NA	NA	NA	NA	NA
AUY21205.1|4210225_4210567_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUY21206.1|4210714_4212376_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUY21207.1|4212462_4213341_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUY21208.1|4213465_4214056_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUY21209.1|4214175_4215462_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUY21210.1|4215481_4216273_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUY21211.1|4216436_4217801_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUY21212.1|4218060_4218309_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUY21213.1|4218327_4218876_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUY21214.1|4218907_4219675_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUY21215.1|4219714_4220062_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUY21216.1|4220181_4220640_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUY21217.1|4220696_4222067_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUY21218.1|4222075_4222558_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21219.1|4222571_4223795_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUY21220.1|4223787_4224297_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUY21221.1|4224639_4225710_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AUY21222.1|4225719_4226841_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUY21223.1|4226903_4227776_+	gluconolactonase	NA	NA	NA	NA	NA
AUY21224.1|4227772_4228933_-	prephenate dehydratase	NA	NA	NA	NA	NA
AUY22606.1|4229033_4229081_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21225.1|4229187_4229523_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUY21226.1|4229793_4230531_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUY21227.1|4230662_4231643_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUY21228.1|4231639_4232371_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUY21229.1|4232500_4235074_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AUY21230.1|4240950_4242249_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	4.1e-44
AUY21231.1|4242252_4242576_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21232.1|4242617_4243973_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUY21233.1|4247135_4248410_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUY21234.1|4248946_4249372_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AUY21235.1|4249575_4250661_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUY21236.1|4250718_4251408_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AUY21237.1|4251720_4252104_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AUY21238.1|4252149_4253481_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AUY21239.1|4253612_4254350_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
>prophage 11
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4259496	4305851	5531975	tail,holin,terminase	Salmonella_phage(28.0%)	63	NA	NA
AUY21245.1|4259496_4260726_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	96.3	1.3e-238
AUY21246.1|4260703_4260979_-	excisionase	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AUY22607.1|4261017_4261257_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AUY21247.1|4261264_4261573_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
AUY21248.1|4261569_4262172_-	hypothetical protein	NA	R9VWB9	Serratia_phage	51.4	1.7e-53
AUY21249.1|4262206_4263295_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.5	4.4e-108
AUY21250.1|4263307_4266406_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	4.3e-294
AUY21251.1|4266543_4266699_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
AUY21252.1|4266707_4266899_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUY22608.1|4267005_4267104_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22609.1|4267364_4267568_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
AUY21253.1|4267596_4268007_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21254.1|4268133_4268520_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
AUY21255.1|4268623_4268854_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
AUY21256.1|4268856_4269420_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	3.6e-29
AUY21257.1|4269764_4269953_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21258.1|4269967_4270876_+	DNA-binding protein	NA	V5URT9	Shigella_phage	53.9	8.4e-89
AUY21259.1|4270878_4271628_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AUY21260.1|4271635_4271971_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AUY21261.1|4271963_4272749_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
AUY21262.1|4272876_4273380_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21263.1|4273376_4273781_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21264.1|4273777_4274407_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21265.1|4275184_4275469_+	hypothetical protein	NA	A0A0S1S1U7	Klebsiella_phage	94.7	3.8e-48
AUY21266.1|4275803_4276031_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21267.1|4276406_4276640_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
AUY21268.1|4276744_4276993_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AUY21269.1|4277027_4277624_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
AUY22610.1|4277831_4278128_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	9.2e-37
AUY21270.1|4278124_4278481_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.8	1.4e-42
AUY21271.1|4278596_4279418_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	66.1	2.9e-96
AUY21272.1|4279662_4280049_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.6e-57
AUY21273.1|4280035_4280317_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
AUY21274.1|4280316_4280946_+	endolysin	NA	F1C591	Cronobacter_phage	75.4	4.2e-87
AUY21275.1|4280948_4281224_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	93.4	7.1e-07
AUY21276.1|4281174_4281363_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.5	4.3e-24
AUY21277.1|4281751_4281988_+	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	60.3	6.5e-17
AUY21278.1|4282045_4282234_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21279.1|4282237_4283242_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.1	3.8e-34
AUY21280.1|4283219_4284527_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.5e-150
AUY21281.1|4284526_4285927_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	6.4e-128
AUY21282.1|4285910_4287023_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.7	4.8e-110
AUY21283.1|4287107_4287893_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.8	3.8e-69
AUY21284.1|4287903_4288857_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
AUY21285.1|4289178_4289574_+	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	2.1e-12
AUY21286.1|4289575_4289830_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AUY21287.1|4289839_4290073_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AUY21288.1|4290059_4290443_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
AUY21289.1|4290444_4290996_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	42.8	5.0e-28
AUY21290.1|4290992_4291385_+	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	31.5	1.5e-13
AUY21291.1|4291408_4292581_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.0e-22
AUY21292.1|4292635_4293118_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21293.1|4293285_4293462_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21294.1|4293538_4293895_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AUY21295.1|4293942_4294308_+	hypothetical protein	NA	S4TR42	Salmonella_phage	48.3	1.0e-05
AUY21296.1|4294403_4298030_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.8	1.1e-78
AUY21297.1|4298059_4298287_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21298.1|4298344_4298809_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.5	7.9e-51
AUY21299.1|4298805_4299288_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
AUY21300.1|4299297_4299666_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21301.1|4299794_4300175_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	93.7	7.6e-68
AUY21302.1|4300171_4303240_+	kinase	NA	A0A286S259	Klebsiella_phage	90.7	0.0e+00
AUY21303.1|4305581_4305851_+	hypothetical protein	NA	H2DE47	Erwinia_phage	40.4	6.1e-11
>prophage 12
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4710109	4717014	5531975		Planktothrix_phage(33.33%)	6	NA	NA
AUY22628.1|4710109_4710973_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AUY21649.1|4710983_4711757_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AUY22629.1|4711997_4712891_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	30.2	2.1e-15
AUY21650.1|4713136_4714498_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AUY21651.1|4714816_4715539_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AUY21652.1|4715535_4717014_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 13
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4758391	4766769	5531975		Enterobacteria_phage(28.57%)	7	NA	NA
AUY21679.1|4758391_4759798_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	28.8	2.9e-27
AUY21680.1|4760021_4761086_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	1.9e-103
AUY21681.1|4761112_4761982_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	1.5e-111
AUY21682.1|4762013_4762904_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AUY21683.1|4762918_4763473_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AUY21684.1|4763652_4764819_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AUY21685.1|4765764_4766769_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 14
CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4874578	4933181	5531975	holin,tail,terminase,coat,tRNA,head,integrase	Escherichia_phage(20.97%)	78	4880974:4880996	4926989:4927011
AUY21787.1|4874578_4876312_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AUY21788.1|4876547_4877117_+	VOC family protein	NA	NA	NA	NA	NA
AUY21789.1|4877193_4877937_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUY21790.1|4878018_4879023_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUY21791.1|4879019_4879763_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AUY21792.1|4879802_4880198_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21793.1|4880250_4881024_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
4880974:4880996	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
AUY21794.1|4881026_4882286_-|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	90.2	8.1e-223
AUY21795.1|4882328_4882574_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AUY21796.1|4882577_4882796_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	50.0	3.3e-07
AUY21797.1|4882792_4882984_-	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AUY21798.1|4882980_4883205_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
AUY21799.1|4883527_4884001_-	hypothetical protein	NA	B4XYU1	Lactobacillus_phage	43.2	7.9e-22
AUY21800.1|4883997_4884156_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AUY21801.1|4884152_4884776_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	4.6e-46
AUY21802.1|4884772_4885276_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	30.1	9.3e-13
AUY21803.1|4885287_4885572_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	80.9	5.0e-40
AUY21804.1|4885579_4886551_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.3	7.4e-67
AUY21805.1|4886638_4886833_-	hypothetical protein	NA	NA	NA	NA	NA
AUY21806.1|4886932_4887202_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	42.9	6.9e-07
AUY21807.1|4887561_4888251_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	5.1e-62
AUY21808.1|4888378_4888612_+	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AUY21809.1|4888652_4888874_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY21810.1|4888959_4889757_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
AUY22639.1|4889816_4890782_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	1.8e-65
AUY21811.1|4890778_4891516_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
AUY21812.1|4891512_4891815_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21813.1|4892248_4892644_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	80.6	8.8e-59
AUY22640.1|4893450_4894011_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.3	2.7e-05
AUY21814.1|4894010_4894259_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21815.1|4894424_4894745_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21816.1|4895099_4895567_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
AUY21817.1|4895547_4895718_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
AUY21818.1|4895710_4896319_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
AUY21819.1|4896315_4896699_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	1.0e-19
AUY21820.1|4896832_4897642_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
AUY21821.1|4898678_4898948_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AUY22641.1|4898925_4899423_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
AUY21822.1|4899419_4899809_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
AUY21823.1|4900267_4900915_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	2.0e-100
AUY21824.1|4900945_4901434_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	72.9	1.5e-47
AUY21825.1|4901430_4902999_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.8	6.2e-289
AUY21826.1|4903010_4904462_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	52.1	5.4e-122
AUY22642.1|4904397_4905390_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.8	5.5e-118
AUY21827.1|4905529_4906048_+	Fis family transcriptional regulator	NA	Q4TZV0	Escherichia_virus	39.9	9.2e-24
AUY21828.1|4906121_4907477_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	8.6e-130
AUY21829.1|4907476_4907938_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AUY21830.1|4907934_4908990_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.8e-101
AUY21831.1|4909022_4909262_+	hypothetical protein	NA	NA	NA	NA	NA
AUY21832.1|4909264_4909645_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AUY21833.1|4909644_4909818_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
AUY21834.1|4909817_4910180_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
AUY21835.1|4910182_4910608_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AUY21836.1|4910604_4910997_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
AUY21837.1|4911065_4911818_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	4.4e-43
AUY21838.1|4911870_4912548_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
AUY21839.1|4912723_4913479_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	1.8e-60
AUY21840.1|4913481_4913736_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	71.4	4.4e-19
AUY21841.1|4913732_4914245_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22643.1|4914285_4914639_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUY21842.1|4914764_4914932_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
AUY21843.1|4914918_4915623_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	43.9	9.0e-38
AUY21844.1|4915688_4916474_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.3	3.2e-84
AUY21845.1|4916564_4920005_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	47.3	1.7e-153
AUY22644.1|4920104_4920524_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AUY21846.1|4920523_4920994_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AUY21847.1|4920990_4921386_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
AUY21848.1|4921372_4923850_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.2	1.1e-196
AUY21849.1|4923938_4926218_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	38.7	4.2e-12
AUY21850.1|4926317_4926497_+	hypothetical protein	NA	H2DE47	Erwinia_phage	50.0	9.3e-08
AUY21851.1|4926512_4926701_+	hypothetical protein	NA	A0A248SL22	Klebsiella_phage	67.3	3.8e-12
AUY21852.1|4927080_4927647_-	hydrolase	NA	NA	NA	NA	NA
4926989:4927011	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
AUY21853.1|4927914_4929702_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AUY21854.1|4929703_4930147_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUY21855.1|4930174_4930915_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUY21856.1|4930949_4931471_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AUY21857.1|4931550_4932162_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUY21858.1|4932170_4933181_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
>prophage 1
CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	0	11921	63725	transposase	Salmonella_phage(33.33%)	8	NA	NA
AUY22679.1|463_3361_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUY22680.1|4031_5783_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUY22681.1|5800_6163_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUY22682.1|6210_6564_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	1.7e-24
AUY22683.1|7282_8602_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUY22684.1|8851_9733_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUY22685.1|10119_10899_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUY22686.1|10895_11921_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 2
CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	19767	26466	63725	transposase	Bacillus_phage(40.0%)	9	NA	NA
AUY22691.1|19767_20631_+	DNA polymerase III subunit epsilon	NA	K7RFY5	Vibrio_phage	34.9	3.3e-26
AUY22692.1|20683_21079_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22693.1|21075_21687_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AUY22694.1|21683_22613_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
AUY22695.1|22736_23333_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.4	1.4e-20
AUY22736.1|23224_23449_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22696.1|23745_24180_-	copper-binding protein	NA	NA	NA	NA	NA
AUY22697.1|24388_25789_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	8.3e-19
AUY22698.1|25785_26466_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	2.1e-31
>prophage 3
CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	31548	38793	63725		Clostridium_phage(33.33%)	5	NA	NA
AUY22705.1|31548_32289_+	peptidase M23	NA	E5G070	Clostridium_phage	33.3	6.1e-13
AUY22706.1|32319_32517_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUY22707.1|32547_35001_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	1.3e-80
AUY22708.1|35119_35560_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22709.1|35646_38793_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	2.3e-61
>prophage 4
CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	42144	56339	63725		Bacillus_phage(18.18%)	15	NA	NA
AUY22714.1|42144_42825_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
AUY22715.1|42817_44296_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
AUY22716.1|44532_44964_+	copper-binding protein	NA	NA	NA	NA	NA
AUY22717.1|45112_45463_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
AUY22718.1|45634_47461_-	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
AUY22719.1|48068_49274_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AUY22720.1|49270_50242_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
AUY22721.1|50387_51659_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
AUY22722.1|51658_52081_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AUY22723.1|52260_52932_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
AUY22724.1|53283_53961_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
AUY22725.1|53960_54182_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22726.1|54192_54612_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUY22727.1|54729_54879_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUY22728.1|55793_56339_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.2	6.1e-18
>prophage 5
CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	62315	62741	63725		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUY22733.1|62315_62741_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
>prophage 1
CP026395	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence	80642	4684	29997	80642	protease,integrase,transposase	Escherichia_phage(41.67%)	22	10680:10739	11989:12130
AUY22745.1|4684_5338_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUY22746.1|5417_5801_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AUY22747.1|5905_6301_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUY22748.1|6345_7608_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AUY22749.1|7618_8569_+	DsbC family protein	NA	NA	NA	NA	NA
AUY22750.1|8581_10669_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
10680:10739	attL	AGGGGTCTGAAGGCCAATAGAACGAAAACGTACGTTAGTGAAGTAACTGTCTGATATATC	NA	NA	NA	NA
AUY22751.1|10852_11200_-|integrase	class 1 integron integrase IntI1	integrase	NA	NA	NA	NA
AUY22824.1|11348_11882_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUY22752.1|12277_13138_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
11989:12130	attR	AGGGGTCTGAAGGCCAATAGAACGAAAACGTACGTTAGTGAAGTAACTGTCTGATATATCGAAACATAATGTACATTGGAAAACGCCATCAAAACGGTGTCTTTTTAATCGAAAATTGGCACTTAACGGACTTTCTTGTCTA	NA	NA	NA	NA
AUY22753.1|13320_13878_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUY22754.1|14235_14940_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY22755.1|15241_16504_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUY22756.1|18289_19051_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUY22757.1|19071_19932_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUY22758.1|19895_20078_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22759.1|20068_20773_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY22760.1|21084_21729_-	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
AUY22761.1|22406_23111_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY22762.1|23635_24517_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUY22763.1|24766_26086_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUY22764.1|26399_27005_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUY22765.1|27099_29997_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
CP026397	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence	220406	75295	124375	220406	transposase,integrase,protease	Escherichia_phage(26.32%)	55	88701:88715	118447:118461
AUY23050.1|75295_76699_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUY23051.1|76796_78329_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUY23052.1|78534_79875_-|transposase	transposase	transposase	NA	NA	NA	NA
AUY23053.1|79963_81496_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUY23188.1|81485_83198_-	peptidase S8	NA	NA	NA	NA	NA
AUY23054.1|83562_84603_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
AUY23055.1|84772_86148_-	DDE domain-containing protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	73.6	2.7e-78
AUY23056.1|86348_86723_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23057.1|86778_87105_-	theronine dehydrogenase	NA	NA	NA	NA	NA
AUY23058.1|87101_87830_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUY23059.1|87826_88258_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AUY23060.1|88302_90360_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
88701:88715	attL	TGGAGCAGGCGGTGC	NA	NA	NA	NA
AUY23061.1|90429_90678_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUY23062.1|90726_91269_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AUY23189.1|91506_91767_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23063.1|91884_92205_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23064.1|92099_92663_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	38.5	1.7e-18
AUY23065.1|92710_94066_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AUY23066.1|94117_94348_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23067.1|94439_94667_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23068.1|95448_95766_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23069.1|95800_96055_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	55.8	1.9e-14
AUY23070.1|96248_96440_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23071.1|96482_96989_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	32.0	4.1e-08
AUY23072.1|97031_97460_-	antirestriction protein	NA	NA	NA	NA	NA
AUY23073.1|98139_98907_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23074.1|98960_99380_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUY23075.1|99389_99611_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23076.1|99610_100312_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.7e-26
AUY23077.1|100748_100979_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23078.1|101039_101711_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUY23079.1|101713_102685_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUY23080.1|102933_104418_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	5.0e-30
AUY23081.1|104417_104669_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23082.1|104827_105259_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUY23083.1|105258_106530_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	2.0e-152
AUY23084.1|106611_107589_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	53.5	4.2e-86
AUY23085.1|107585_108791_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AUY23086.1|109905_110733_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AUY23087.1|111190_111439_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23190.1|111620_111851_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23088.1|111942_112896_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23089.1|112976_113795_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23090.1|113937_114387_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23091.1|114458_115169_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23092.1|115591_116374_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	86.6	3.9e-50
AUY23191.1|116370_117183_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23093.1|117232_117562_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23094.1|117761_118088_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23095.1|118140_118371_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUY23096.1|118367_118784_+	PIN domain-containing protein	NA	NA	NA	NA	NA
118447:118461	attR	TGGAGCAGGCGGTGC	NA	NA	NA	NA
AUY23097.1|118824_119703_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
AUY23098.1|120364_121642_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AUY23099.1|121631_123740_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	3.2e-38
AUY23100.1|123739_124375_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP026397	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence	220406	131726	177420	220406	transposase	Bacillus_phage(26.67%)	50	NA	NA
AUY23107.1|131726_132707_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AUY23108.1|132745_132892_-	ABC transporter	NA	NA	NA	NA	NA
AUY23109.1|133743_134094_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AUY23110.1|134241_134673_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUY23111.1|134923_136399_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUY23112.1|136391_137072_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AUY23113.1|137261_138647_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23114.1|138675_139029_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY23115.1|139142_140435_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUY23116.1|140445_143592_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AUY23117.1|143678_144119_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23118.1|144245_146693_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	1.3e-83
AUY23119.1|146733_146931_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUY23120.1|146964_147702_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AUY23121.1|147990_148440_-	copper resistance protein	NA	NA	NA	NA	NA
AUY23122.1|148673_150491_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AUY23123.1|150490_151387_+	copper resistance protein B	NA	NA	NA	NA	NA
AUY23124.1|151426_151807_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AUY23125.1|151811_152741_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AUY23126.1|152795_153476_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUY23127.1|153472_154873_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AUY23128.1|155088_155523_+	copper-binding protein	NA	NA	NA	NA	NA
AUY23129.1|155901_156021_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY23130.1|155986_156166_-	antitoxin	NA	NA	NA	NA	NA
AUY23131.1|156479_156728_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23132.1|156724_157957_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23133.1|158090_158582_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY23134.1|158950_159355_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AUY23135.1|159351_159699_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUY23136.1|159747_161286_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	6.1e-281
AUY23193.1|162082_162379_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23194.1|162268_162577_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23137.1|162683_163804_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AUY23195.1|163927_164164_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23138.1|164295_164844_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AUY23139.1|164890_165325_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AUY23140.1|165569_165836_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUY23141.1|165823_166306_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUY23142.1|166506_167910_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUY23143.1|167938_168571_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23144.1|169094_170099_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AUY23145.1|170177_170735_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUY23146.1|170728_171100_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23147.1|171096_171597_-|transposase	transposase	transposase	NA	NA	NA	NA
AUY23148.1|171593_171920_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23149.1|172174_172531_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUY23150.1|172520_172922_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUY23151.1|172918_173209_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUY23152.1|173367_176337_+|transposase	Tn3-like element TnShfr1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUY23153.1|176415_177420_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
>prophage 1
CP026396	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence	144072	7612	66045	144072	transposase,protease,integrase	Stx2-converting_phage(27.27%)	43	37796:37811	61210:61225
AUY22834.1|7612_8593_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AUY22835.1|8839_13861_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	29.2	6.4e-53
AUY22836.1|13874_21578_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.8	5.0e-65
AUY22837.1|21456_22239_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22838.1|22317_23538_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22960.1|24897_25122_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22961.1|25279_26005_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22839.1|26254_27658_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AUY22962.1|27686_28319_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22840.1|28647_29814_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUY22841.1|30194_31613_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22842.1|31674_32979_+	KamA family radical SAM protein	NA	NA	NA	NA	NA
AUY22843.1|32978_34424_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22844.1|34401_35571_+	MFS transporter	NA	NA	NA	NA	NA
AUY22845.1|35567_35810_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22963.1|36082_36313_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	55.9	8.0e-12
AUY22846.1|36564_37179_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AUY22847.1|37273_40303_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
37796:37811	attL	GTTCGCCTTCTCACCG	NA	NA	NA	NA
AUY22964.1|40286_40889_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
AUY22848.1|41080_41437_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUY22849.1|41438_41774_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY22850.1|41788_42124_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY22851.1|42147_42474_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22852.1|42470_42851_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22853.1|42968_44228_+	hypothetical protein	NA	NA	NA	NA	NA
AUY22854.1|44812_45808_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
AUY22855.1|45943_46273_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22856.1|46188_49086_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUY22857.1|49180_49786_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUY22858.1|49801_50248_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22859.1|51432_52446_-	replication initiation protein	NA	NA	NA	NA	NA
AUY22860.1|52438_52990_-	replication protein	NA	NA	NA	NA	NA
AUY22965.1|52982_53060_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AUY22861.1|53271_53541_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY22862.1|53913_54363_-	hypothetical protein	NA	NA	NA	NA	NA
AUY22863.1|54352_56290_-|integrase	integrase	integrase	NA	NA	NA	NA
AUY22864.1|56286_58086_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUY22865.1|58082_59276_-|integrase	integrase domain-containing protein SAM domain-containing protein	integrase	NA	NA	NA	NA
AUY22866.1|60528_62121_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
61210:61225	attR	CGGTGAGAAGGCGAAC	NA	NA	NA	NA
AUY22867.1|62151_62502_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
AUY22868.1|62498_62906_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
AUY22966.1|64147_65401_-	secretion protein HlyD	NA	NA	NA	NA	NA
AUY22869.1|65403_66045_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP026396	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence	144072	125869	132864	144072	integrase	Escherichia_phage(50.0%)	7	127753:127765	134457:134469
AUY22943.1|125869_126841_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUY22944.1|127074_127506_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUY22945.1|127505_128777_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
127753:127765	attL	TGATGAACTGCCT	NA	NA	NA	NA
AUY22946.1|129188_130064_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AUY22969.1|130712_131339_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AUY22947.1|131458_131638_+	Par-like protein	NA	NA	NA	NA	NA
AUY22948.1|132069_132864_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
134457:134469	attR	AGGCAGTTCATCA	NA	NA	NA	NA
>prophage 1
CP026398	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence	249238	16365	33981	249238	transposase,tail	Salmonella_phage(27.78%)	25	NA	NA
AUY23214.1|16365_17607_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
AUY23215.1|18490_18946_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23216.1|19233_19842_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AUY23217.1|19911_20361_-|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AUY23218.1|20370_20556_-	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AUY23219.1|21129_21402_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AUY23220.1|21671_21857_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23221.1|21856_22546_-	hypothetical protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.4e-19
AUY23222.1|22542_23025_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AUY23223.1|24275_24662_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AUY23224.1|24754_25078_-	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AUY23225.1|25078_25723_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AUY23226.1|25719_25947_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.9e-10
AUY23227.1|26424_26613_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23228.1|26609_27107_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
AUY23430.1|27100_27247_+	ABC transporter	NA	NA	NA	NA	NA
AUY23229.1|27285_28266_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUY23230.1|28400_28619_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AUY23231.1|28784_29036_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AUY23232.1|29156_29471_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23233.1|29551_29872_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AUY23234.1|30281_31250_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUY23235.1|31531_31825_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23236.1|31841_32423_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23237.1|32496_33981_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 2
CP026398	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence	249238	54270	61462	249238		Burkholderia_phage(33.33%)	11	NA	NA
AUY23257.1|54270_55473_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
AUY23258.1|55562_56978_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	4.1e-106
AUY23259.1|57104_57848_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AUY23260.1|57844_58279_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23434.1|58311_58572_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AUY23261.1|58580_58784_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23262.1|58825_59269_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23263.1|59499_59859_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23435.1|60043_60454_-	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	1.3e-41
AUY23264.1|60578_60893_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23265.1|60883_61462_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
>prophage 3
CP026398	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence	249238	137550	197784	249238	transposase	Caulobacter_phage(23.08%)	56	NA	NA
AUY23332.1|137550_140448_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUY23333.1|141192_141645_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23334.1|141887_142202_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23335.1|142231_142435_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23336.1|143176_143389_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23337.1|143482_143761_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUY23338.1|144308_144713_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
AUY23437.1|144988_145471_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23339.1|145849_147349_-	kinase	NA	NA	NA	NA	NA
AUY23340.1|147376_149110_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AUY23438.1|149109_150150_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AUY23341.1|150242_150881_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AUY23342.1|150881_151523_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AUY23343.1|151547_152186_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AUY23344.1|152665_153124_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AUY23345.1|153126_154350_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AUY23346.1|154360_155317_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AUY23347.1|155316_156396_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.6e-40
AUY23348.1|156397_157171_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23439.1|157163_158306_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.0	8.3e-33
AUY23349.1|158317_159376_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AUY23350.1|159687_160272_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
AUY23351.1|160268_161420_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AUY23352.1|161442_161898_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AUY23353.1|161921_162962_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AUY23354.1|163000_163579_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AUY23355.1|163665_164241_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
AUY23356.1|164325_165567_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	24.7	1.8e-09
AUY23357.1|165903_166551_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AUY23358.1|167135_167525_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23359.1|167590_168349_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23360.1|168581_169313_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUY23361.1|169572_170175_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23362.1|171167_172439_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AUY23363.1|172621_173116_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	34.2	6.1e-17
AUY23364.1|173226_174045_+	DNA repair protein	NA	NA	NA	NA	NA
AUY23365.1|174448_174847_+	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AUY23366.1|174944_175238_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23367.1|175433_176066_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23368.1|176094_177498_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUY23369.1|177609_179142_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUY23370.1|179318_179951_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23371.1|179979_181383_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUY23372.1|181589_181904_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23440.1|182004_182136_+	ABC transporter	NA	NA	NA	NA	NA
AUY23373.1|182174_183155_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUY23441.1|183180_183681_+	hypothetical protein	NA	NA	NA	NA	NA
AUY23374.1|183954_184557_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23375.1|184559_185075_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23376.1|185192_186149_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23377.1|186378_187335_-	thioredoxin	NA	NA	NA	NA	NA
AUY23378.1|187394_187736_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23379.1|187749_188061_-	hypothetical protein	NA	NA	NA	NA	NA
AUY23380.1|188077_188806_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUY23381.1|188939_189554_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUY23382.1|196815_197784_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
