The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	313713	350749	3795065	tail,portal,integrase,protease,terminase,capsid,transposase,head	uncultured_Caudovirales_phage(32.35%)	58	311587:311605	350927:350945
311587:311605	attL	AAATTCGAATTTCAAATTC	NA	NA	NA	NA
AUX84849.1|313713_314007_-	anaerobic dehydrogenase	NA	A0A1B2IBL3	Erwinia_phage	42.3	7.3e-18
AUX84850.1|314007_314511_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	68.1	3.9e-59
AUX87805.1|314497_314731_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84851.1|314850_315834_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84852.1|315830_318659_-	hypothetical protein	NA	A0A2H4J328	uncultured_Caudovirales_phage	45.8	4.8e-215
AUX84853.1|318642_318834_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87806.1|318833_319058_-	hypothetical protein	NA	A0A2H4J8S6	uncultured_Caudovirales_phage	55.9	2.0e-15
AUX84854.1|319089_320007_-	hypothetical protein	NA	A0A2H4J3E9	uncultured_Caudovirales_phage	59.4	1.4e-102
AUX84855.1|320003_321212_-	hypothetical protein	NA	A0A2H4J3F5	uncultured_Caudovirales_phage	73.9	2.4e-176
AUX84856.1|321236_323870_-	hypothetical protein	NA	A0A2H4J326	uncultured_Caudovirales_phage	35.0	1.9e-117
AUX87807.1|323928_324447_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84857.1|324528_325197_-	hypothetical protein	NA	A0A2H4J8A2	uncultured_Caudovirales_phage	44.2	6.7e-43
AUX84858.1|325284_325497_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84859.1|325514_325952_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84860.1|325951_326428_-	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	38.6	1.5e-20
AUX84861.1|326497_326716_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84862.1|326787_327075_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84863.1|327104_327476_-	DUF3168 domain-containing protein	NA	A0A2H4J570	uncultured_Caudovirales_phage	77.0	1.5e-52
AUX84864.1|327472_327931_-	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	76.3	4.4e-62
AUX87808.1|327934_328264_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4J8R2	uncultured_Caudovirales_phage	77.1	2.8e-42
AUX84865.1|328260_328578_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	52.4	3.1e-22
AUX84866.1|328977_330177_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	61.9	2.4e-136
AUX84867.1|330179_330845_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	72.7	3.7e-86
AUX84868.1|330822_332052_-|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	71.7	2.7e-167
AUX84869.1|332051_333776_-|terminase	terminase	terminase	G3EN96	Psychrobacter_phage	76.2	3.3e-259
AUX84870.1|333784_334276_-|terminase	phage terminase small subunit P27 family	terminase	G3EN95	Psychrobacter_phage	63.8	1.4e-53
AUX84871.1|334378_334705_-	hypothetical protein	NA	A2I2Y8	Vibrio_virus	66.7	4.4e-32
AUX84872.1|334697_335057_-	HNH endonuclease	NA	G3EN93	Psychrobacter_phage	61.1	8.9e-34
AUX84873.1|335049_335283_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84874.1|335285_335480_-	hypothetical protein	NA	A0A2H4J8C2	uncultured_Caudovirales_phage	63.9	7.0e-09
AUX84875.1|336196_336472_-	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	70.3	2.9e-32
AUX84876.1|336461_336641_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84877.1|336643_336850_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84878.1|337580_337991_-	antitermination protein	NA	NA	NA	NA	NA
AUX84879.1|338003_338681_-	serine/threonine protein phosphatase	NA	A0A0A0RMI8	Acinetobacter_phage	46.3	5.0e-54
AUX84880.1|338688_339120_-	nuclease	NA	A0A0D4DBJ8	Acinetobacter_phage	79.1	1.5e-59
AUX84881.1|339116_339422_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84882.1|339418_339697_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87809.1|339693_340047_-	hypothetical protein	NA	A0A0U1VTD7	Pseudomonas_phage	58.1	4.2e-36
AUX84883.1|340052_340847_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	55.0	3.4e-78
AUX84884.1|340843_341215_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	61.6	3.4e-28
AUX84885.1|341309_341972_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUX84886.1|342484_343201_-	DNA-binding protein	NA	A0A191ZDI8	Acinetobacter_phage	42.9	4.5e-21
AUX84887.1|343247_343748_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84888.1|343807_344032_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX84889.1|344163_344853_+	XRE family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	45.1	6.1e-47
AUX84890.1|344955_345198_+	hypothetical protein	NA	NA	NA	NA	NA
AUX84891.1|345194_345437_-	hypothetical protein	NA	NA	NA	NA	NA
AUX84892.1|345608_345947_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	44.3	4.2e-17
AUX84893.1|345998_346832_+	hypothetical protein	NA	NA	NA	NA	NA
AUX84894.1|346914_347163_+	hypothetical protein	NA	NA	NA	NA	NA
AUX84895.1|347159_347462_+	hypothetical protein	NA	NA	NA	NA	NA
AUX84896.1|347551_347824_+	hypothetical protein	NA	NA	NA	NA	NA
AUX84897.1|347823_348213_+	hypothetical protein	NA	I2GUB5	Acinetobacter_phage	50.0	1.7e-09
AUX84898.1|348202_348862_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	48.1	5.4e-53
AUX84899.1|348858_349242_+	hypothetical protein	NA	A0A059VA44	Pseudomonas_phage	31.1	5.8e-07
AUX87810.1|349241_349508_+	DNA-binding protein	NA	NA	NA	NA	NA
AUX84900.1|349519_350749_-|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	55.3	1.0e-129
350927:350945	attR	AAATTCGAATTTCAAATTC	NA	NA	NA	NA
>prophage 2
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	1621525	1687011	3795065	holin,transposase	uncultured_Caudovirales_phage(25.0%)	48	NA	NA
AUX85938.1|1621525_1623499_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	6.9e-19
AUX85939.1|1623550_1624429_-	carbapenem susceptibility porin CarO	NA	NA	NA	NA	NA
AUX85940.1|1624905_1625106_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87883.1|1625490_1626330_+	class D beta-lactamase	NA	NA	NA	NA	NA
AUX85941.1|1626532_1627489_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87884.1|1627527_1628617_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUX85942.1|1628651_1629425_+	hypothetical protein	NA	NA	NA	NA	NA
AUX85943.1|1629459_1630275_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87885.1|1631114_1632204_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUX85944.1|1632535_1633198_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUX85945.1|1634272_1637104_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.9	1.0e-310
AUX85946.1|1637348_1637951_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUX85947.1|1637954_1638932_+	NADPH:quinone oxidoreductase	NA	NA	NA	NA	NA
AUX85948.1|1639001_1639355_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AUX85949.1|1639735_1640077_+	hypothetical protein	NA	NA	NA	NA	NA
AUX85950.1|1640119_1640926_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUX85951.1|1641019_1641391_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUX85952.1|1641462_1642137_-	thiaminase II	NA	NA	NA	NA	NA
AUX85953.1|1642348_1643434_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.3	7.7e-89
AUX85954.1|1643584_1644949_+	MFS transporter	NA	NA	NA	NA	NA
AUX85955.1|1645000_1645600_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	66.4	1.4e-36
AUX85956.1|1646126_1647566_+	amino acid permease	NA	NA	NA	NA	NA
AUX87886.1|1647638_1649216_-	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	28.3	5.1e-17
AUX85957.1|1649294_1650593_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	5.9e-27
AUX85958.1|1650589_1652047_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUX85959.1|1652265_1652829_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AUX85960.1|1652920_1653877_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX85961.1|1653951_1654578_-	hydrolase	NA	NA	NA	NA	NA
AUX85962.1|1654885_1655770_+	pirin family protein	NA	NA	NA	NA	NA
AUX87887.1|1656230_1657502_+	monoamine oxidase	NA	NA	NA	NA	NA
AUX85963.1|1657506_1658346_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUX85964.1|1658604_1658931_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUX85965.1|1658964_1660209_-	MFS transporter	NA	NA	NA	NA	NA
AUX87888.1|1660330_1661251_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX85966.1|1661411_1661876_+	hypothetical protein	NA	NA	NA	NA	NA
AUX85967.1|1661899_1662781_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX85968.1|1662949_1664467_+	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AUX85969.1|1664478_1665369_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUX85970.1|1665454_1667116_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	38.8	7.4e-75
AUX87889.1|1667209_1668361_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUX85971.1|1668451_1669255_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUX85972.1|1669270_1670329_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUX85973.1|1671833_1672295_+	SAM-dependent methyltransferase	NA	A0A2H4J2Z2	uncultured_Caudovirales_phage	66.1	1.4e-15
AUX85974.1|1672830_1675668_+	ATP-dependent helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	93.2	0.0e+00
AUX85975.1|1675709_1675982_+	hypothetical protein	NA	A0A2H4IYJ6	uncultured_Caudovirales_phage	68.9	4.4e-25
AUX87890.1|1677051_1678142_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUX85976.1|1679550_1682715_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	25.9	2.7e-25
AUX85977.1|1685792_1687011_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	9.0e-78
>prophage 3
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	2168863	2299124	3795065	tail,portal,tRNA,holin,integrase,terminase,capsid,transposase	uncultured_Caudovirales_phage(62.5%)	114	2214351:2214410	2275836:2277146
AUX86379.1|2168863_2169598_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUX86380.1|2169682_2170636_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.2	1.1e-59
AUX87925.1|2170888_2173963_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.5	3.0e-77
AUX86381.1|2174016_2174898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUX86382.1|2175005_2175908_+	transporter	NA	NA	NA	NA	NA
AUX86383.1|2175959_2176247_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86384.1|2176343_2176616_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUX86385.1|2176618_2177431_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUX86386.1|2177496_2178225_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUX86387.1|2178347_2179397_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUX86388.1|2179401_2180340_-	acyltransferase	NA	NA	NA	NA	NA
AUX86389.1|2180607_2181255_+	OmpA family protein	NA	NA	NA	NA	NA
AUX86390.1|2181402_2183442_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.0	8.7e-110
AUX86391.1|2183477_2183930_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.2	6.8e-47
AUX86392.1|2184136_2185561_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.3e-38
AUX86393.1|2185573_2186473_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AUX86394.1|2186618_2187401_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUX86395.1|2187500_2188349_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUX87926.1|2188611_2189067_+	hemerythrin	NA	NA	NA	NA	NA
AUX86396.1|2189241_2190324_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86397.1|2190323_2190647_+	RnfH family protein	NA	NA	NA	NA	NA
AUX86398.1|2190692_2191091_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUX86399.1|2191205_2191643_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUX86400.1|2191754_2195348_-	ATP-dependent dsDNA exonuclease	NA	Q5ULP4	Lactobacillus_virus	28.4	2.0e-08
AUX86401.1|2195357_2196611_-	exonuclease sbcCD subunit D	NA	NA	NA	NA	NA
AUX86402.1|2196708_2197086_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUX86403.1|2197393_2197840_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86404.1|2197907_2198804_+	TIGR01777 family protein	NA	Q58M85	Prochlorococcus_phage	25.3	8.0e-07
AUX86405.1|2198818_2199937_-	glycine oxidase ThiO	NA	NA	NA	NA	NA
AUX86406.1|2199953_2200967_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AUX86407.1|2201075_2201573_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86408.1|2201847_2202981_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUX86409.1|2202987_2204511_+	MFS transporter	NA	NA	NA	NA	NA
AUX86410.1|2204557_2206042_-	glycerol kinase	NA	NA	NA	NA	NA
AUX86411.1|2206721_2207861_+|integrase	integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	71.5	4.4e-159
AUX86412.1|2208239_2208437_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86413.1|2208448_2208802_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.8	1.0e-34
AUX86414.1|2208789_2209107_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86415.1|2209099_2209285_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86416.1|2209281_2209470_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87927.1|2209473_2209902_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86417.1|2210178_2212905_-	toprim	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	74.1	0.0e+00
AUX86418.1|2212912_2213296_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86419.1|2213721_2214063_+	XRE family transcriptional regulator	NA	A0A2H4J8M8	uncultured_Caudovirales_phage	46.7	3.1e-20
AUX86420.1|2214025_2214253_-	hypothetical protein	NA	NA	NA	NA	NA
2214351:2214410	attL	TTTGAACCGTACTGGGTTTGTCGGAGACTTTTTTATTTAAGTTAGGCCACCTGACCTAAC	NA	NA	NA	NA
AUX86421.1|2214391_2215611_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	9.0e-78
AUX86422.1|2215585_2215894_-	hypothetical protein	NA	A0A2H4J8M9	uncultured_Caudovirales_phage	63.3	7.1e-24
AUX86423.1|2215903_2216581_-	hypothetical protein	NA	A0A2H4JC99	uncultured_Caudovirales_phage	62.5	1.9e-69
AUX86424.1|2216750_2216972_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86425.1|2217521_2218346_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86426.1|2218497_2219499_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87928.1|2220388_2220910_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86427.1|2221078_2222245_+	hypothetical protein	NA	A0A0N9SHY1	Staphylococcus_phage	36.2	5.3e-35
AUX86428.1|2222472_2223456_-	hypothetical protein	NA	A0A2H4JAG0	uncultured_Caudovirales_phage	77.7	2.1e-141
AUX86429.1|2223452_2223866_-	oxidoreductase	NA	A0A2H4J8N8	uncultured_Caudovirales_phage	74.0	7.1e-51
AUX86430.1|2223876_2226462_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	64.7	1.0e-288
AUX87929.1|2226458_2226578_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AUX86431.1|2226592_2226919_-|tail	phage tail assembly protein	tail	A0A2H4J8P1	uncultured_Caudovirales_phage	65.7	8.1e-34
AUX86432.1|2226962_2227469_-|tail	phage major tail tube protein	tail	A0A2H4JCA8	uncultured_Caudovirales_phage	83.3	3.6e-81
AUX86433.1|2227480_2228104_-|tail	phage tail protein	tail	A0A2H4J8M7	uncultured_Caudovirales_phage	81.1	1.5e-97
AUX86434.1|2228245_2228551_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86435.1|2228589_2229204_-	hypothetical protein	NA	A0A2H4JFB5	uncultured_Caudovirales_phage	59.0	3.3e-60
AUX86436.1|2229329_2230343_-	hypothetical protein	NA	A0A2H4JDV2	uncultured_Caudovirales_phage	61.1	5.6e-49
AUX86437.1|2230351_2230873_-|tail	phage tail protein I	tail	A0A2H4JFW9	uncultured_Caudovirales_phage	64.9	3.4e-58
AUX86438.1|2230865_2231762_-	hypothetical protein	NA	A0A2H4JAG9	uncultured_Caudovirales_phage	69.2	1.4e-112
AUX86439.1|2231758_2232130_-	hypothetical protein	NA	A0A2H4J8P9	uncultured_Caudovirales_phage	52.8	7.3e-31
AUX86440.1|2232133_2232658_-	hypothetical protein	NA	A0A2H4JGB7	uncultured_Caudovirales_phage	64.0	1.1e-61
AUX86441.1|2232738_2233587_-	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	76.2	8.9e-125
AUX86442.1|2233629_2233743_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUX86443.1|2233739_2234177_-	phage virion morphogenesis protein	NA	A0A2H4JCC1	uncultured_Caudovirales_phage	74.3	1.7e-58
AUX86444.1|2234176_2234569_-	hypothetical protein	NA	A0A2H4J8N7	uncultured_Caudovirales_phage	65.9	1.0e-46
AUX87930.1|2234571_2235087_-	secretion activator protein	NA	A0A2H4J8Q8	uncultured_Caudovirales_phage	77.2	4.6e-76
AUX86445.1|2235101_2235473_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	69.1	3.5e-41
AUX86446.1|2235483_2235687_-	hypothetical protein	NA	A0A2H4JDW1	uncultured_Caudovirales_phage	56.7	3.6e-16
AUX86447.1|2235683_2236082_-	hypothetical protein	NA	A0A2H4JFX3	uncultured_Caudovirales_phage	65.2	3.5e-39
AUX86448.1|2236085_2236910_-	hypothetical protein	NA	A0A2H4JAI1	uncultured_Caudovirales_phage	59.7	8.5e-80
AUX86449.1|2236912_2237941_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4J8R3	uncultured_Caudovirales_phage	77.8	1.9e-153
AUX86450.1|2237955_2238879_-|capsid	capsid scaffolding protein	capsid	A0A2H4JGC7	uncultured_Caudovirales_phage	52.2	4.3e-80
AUX86451.1|2239020_2240799_+|terminase	terminase	terminase	A0A2H4J8R1	uncultured_Caudovirales_phage	78.1	1.1e-262
AUX86452.1|2240798_2241881_+|portal	phage portal protein	portal	A0A2H4JCD2	uncultured_Caudovirales_phage	70.9	7.3e-148
AUX86453.1|2243032_2244166_+|integrase	integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	38.4	8.4e-70
AUX86454.1|2245229_2245676_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86455.1|2245699_2246775_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.0e-45
AUX86456.1|2247266_2248772_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87931.1|2248795_2250823_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86457.1|2250834_2251527_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86458.1|2252454_2254395_+	DUF4407 domain-containing protein	NA	NA	NA	NA	NA
AUX86459.1|2254407_2255853_+	oxidoreductase	NA	NA	NA	NA	NA
AUX86460.1|2257492_2258416_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	36.4	7.8e-50
AUX86461.1|2258471_2260136_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.9	9.2e-25
AUX86462.1|2260458_2261649_+	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AUX86463.1|2261650_2263081_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUX86464.1|2263109_2264465_+	rubredoxin-NAD(+) reductase	NA	NA	NA	NA	NA
AUX86465.1|2264476_2265793_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUX87932.1|2265806_2266160_+	ethanolamine utilization protein EutQ	NA	NA	NA	NA	NA
AUX86466.1|2266362_2267502_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87933.1|2267443_2268534_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUX86467.1|2268822_2269437_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86468.1|2269479_2270382_-	EamA family transporter	NA	NA	NA	NA	NA
AUX86469.1|2270498_2271425_-	EamA family transporter	NA	NA	NA	NA	NA
AUX86470.1|2271424_2271625_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	55.4	2.5e-09
AUX86471.1|2272672_2273671_+	cell filamentation protein Fic	NA	D7RWK9	Brochothrix_phage	25.7	1.0e-07
AUX86472.1|2274634_2275853_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	9.0e-78
AUX86473.1|2276323_2277151_+	hypothetical protein	NA	NA	NA	NA	NA
2275836:2277146	attR	GTTAGGTCAGGTGGCCTAACTTAAATAAAAAAGTCTCCGACAAACCCAGTACGGTTCAAAATGGCGATAAAGGTGATTTCTGAGATACTCAGTTATGCCGTTTGGATTCTTAAATAGTGATTACTTTGCTTGAGGAATTTCCAGTAGGTTGCTTCAAATTTAAGAAAGAAATCATCAATTACACAGAATAATTAAGTACTATTGAACATCAGGACTAGAGTTGTAAGTTTGGTGTGGTAACTCAACTGATGGCTCTAGTTCTCCTGTTTTTCAAGTTAATTTATTATCTGCTATTGGGGTTACTTATAGCTAAGTGAAAAAATAGTTGAGATAATCTTTTATAAACGGTAAAAGGGCTTTTTCTAATCATTACTAATTATTGAAAATGAAAGCTCCTTTTTACGATTTACGGGTTTGTTAAGACTAAAAAAGTATTTTATGGTTCTGTATGGATTTTGATTAATCTAAAGTAAATATGAGTTAATTTTATGTTGCAATCACAATTAAGATTCCACCTTATCCTCATGGGTACTTTAGTTTTATCAGGATGCGTAGATGAAAATGGAAATGTTAGTGTTGGAGTGAGTCTGGGGGGAACTGGGACTGGTAGTGGAATTCCGATCGGAACTCCAAACCCCACTCCAAATCCTCGACCAGATGTTGAACCAGATAGAATGGAAGATGATGCAGAATATGCTGTTGCTTATCCAGATCCTGTGGTGCAAAACTGTTATGGGGTTGAAAGAACGATACAGTTTATAGAACACTATAACGAAACCCCTGTTTTTGCTGGTGATAGGCAAGATTTGTTTGGGGTGAATAGCAAAACCTTACCGCCAATCAAATTTAAATTACGAGTGACTATAAAAAATACATTACCAACACGAGTCTATGAATATATCGATAGTTGTAAGGCTGCTTTTCAGCTAAGTGGTAGTAAAACAGTAAAAACCACACAAAGCGATTATTGTCTCAATGATGAAACGGTAAATGTATATCAGCCTAATGAGGAAAGAACATATTATTATGCTTTTAATTTACCGAATATTTTACAGACATGGACGGCAAGTTATCATGCAGAATATTCAACCGCTTTTTATTCAGATTCAGTACAACGAAATCAGTGTGAAACGTTAAGTACACAGTTGGTTGTAGATCCATATCCATCGTCAATGGATGGGGCTCCACCTGATAAAGATTCAGGAACAGCAAGTGTTAATACTGGATCGCAAAACTCTAATACTGATGACTCATCACAAAGTGGGTCTGATGAAAGTCCTATTTTTGGTGGGTTTGGCTTAGGTGATGAAC	NA	NA	NA	NA
AUX87934.1|2278805_2279615_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86474.1|2280017_2280200_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86475.1|2280391_2281243_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUX86476.1|2282414_2283490_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.0e-45
AUX86477.1|2283594_2293020_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86478.1|2293170_2294700_+	RND transporter	NA	NA	NA	NA	NA
AUX86479.1|2294696_2296826_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	23.7	4.8e-26
AUX86480.1|2296822_2298013_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUX86481.1|2298194_2298377_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86482.1|2298461_2299124_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	2579037	2586543	3795065		Acinetobacter_phage(62.5%)	10	NA	NA
AUX86699.1|2579037_2579460_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.9	1.2e-40
AUX86700.1|2579550_2579874_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.9	4.4e-24
AUX86701.1|2580078_2581128_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AUX86702.1|2581124_2581829_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.6	2.7e-87
AUX86703.1|2581884_2582439_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	7.7e-93
AUX86704.1|2582526_2583213_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	74.7	1.3e-86
AUX86705.1|2583727_2583979_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
AUX86706.1|2584090_2584897_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	88.8	3.0e-130
AUX86707.1|2584911_2585958_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	85.3	1.7e-165
AUX86708.1|2585958_2586543_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	95.4	1.7e-106
>prophage 5
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	2785700	2800637	3795065	integrase,terminase	Acinetobacter_phage(50.0%)	25	2781845:2781861	2812120:2812136
2781845:2781861	attL	CAATATGTTTAATCAAA	NA	NA	NA	NA
AUX87964.1|2785700_2786714_+|integrase	integrase	integrase	A0A0R6PHH4	Moraxella_phage	50.4	5.2e-87
AUX86883.1|2786725_2787013_-	DNA-binding protein	NA	NA	NA	NA	NA
AUX86884.1|2787012_2787297_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86885.1|2787283_2787664_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86886.1|2787796_2788114_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86887.1|2788101_2789613_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	34.6	1.5e-66
AUX86888.1|2789664_2790594_-	transcriptional regulator	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	65.4	1.0e-52
AUX86889.1|2790606_2791587_-	recombinase	NA	A0A2H4JA52	uncultured_Caudovirales_phage	36.5	1.7e-42
AUX86890.1|2791588_2791804_-	hypothetical protein	NA	A0A1S5SAD2	Streptococcus_phage	61.8	3.1e-18
AUX86891.1|2791800_2792178_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87965.1|2792170_2792623_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86892.1|2792720_2793593_-	hypothetical protein	NA	I6WAZ8	Burkholderia_virus	32.8	7.2e-29
AUX86893.1|2793652_2794027_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86894.1|2794218_2794527_-	hypothetical protein	NA	NA	NA	NA	NA
AUX86895.1|2794554_2795220_-	geranylgeranyl reductase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.2	1.2e-52
AUX86896.1|2795298_2795490_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	85.5	1.6e-18
AUX86897.1|2795486_2795762_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	87.5	1.6e-35
AUX86898.1|2795950_2796610_+	hypothetical protein	NA	A0A220NQL7	Acinetobacter_phage	38.3	2.8e-17
AUX86899.1|2796770_2796983_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86900.1|2796979_2797498_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86901.1|2797561_2798530_+	DUF1376 domain-containing protein	NA	A0A0D4DBT2	Acinetobacter_phage	57.9	7.3e-22
AUX86902.1|2798526_2799276_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	49.2	1.7e-55
AUX86903.1|2799268_2799697_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	71.2	1.5e-48
AUX86904.1|2799711_2799921_+	hypothetical protein	NA	NA	NA	NA	NA
AUX86905.1|2799920_2800637_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	47.7	5.1e-49
2812120:2812136	attR	CAATATGTTTAATCAAA	NA	NA	NA	NA
>prophage 6
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	2958130	2987519	3795065	capsid,terminase	Pseudomonas_phage(50.0%)	27	NA	NA
AUX87032.1|2958130_2959678_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	60.4	5.0e-134
AUX87033.1|2959674_2960580_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87034.1|2960576_2961320_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.1	2.5e-54
AUX87035.1|2961316_2961502_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87036.1|2961498_2961894_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87037.1|2961917_2962376_+	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	48.9	1.6e-32
AUX87038.1|2962447_2962663_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87039.1|2962787_2963453_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	51.9	6.0e-44
AUX87040.1|2963541_2965209_+|terminase	terminase	terminase	Q5QF75	Pseudomonas_virus	62.3	1.0e-212
AUX87041.1|2965218_2967507_+	hypothetical protein	NA	Q5QF74	Pseudomonas_virus	63.2	7.9e-285
AUX87042.1|2967590_2968406_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87043.1|2968406_2968844_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87044.1|2969097_2970141_+	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	43.2	5.4e-63
AUX87045.1|2970167_2971454_+|capsid	N4-gp56 family major capsid protein	capsid	L7TIC0	Pseudomonas_virus	61.3	1.3e-151
AUX87046.1|2971518_2971995_+	hypothetical protein	NA	A0A0U1W0G3	Pseudomonas_phage	42.9	9.4e-23
AUX87047.1|2972063_2972954_+	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	40.8	4.4e-50
AUX87048.1|2972953_2973628_+	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	56.8	4.4e-66
AUX87049.1|2973721_2973916_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87050.1|2973896_2974304_+	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	88.9	3.9e-62
AUX87051.1|2974319_2974634_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87052.1|2974644_2975295_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87053.1|2975294_2979245_+	hypothetical protein	NA	A0A2K8HKA1	Pseudomonas_phage	34.2	1.1e-140
AUX87054.1|2979246_2980470_+	hypothetical protein	NA	L7TKU2	Pseudomonas_virus	48.3	6.8e-110
AUX87055.1|2980499_2981075_+	hypothetical protein	NA	L7TIC9	Pseudomonas_virus	65.2	6.8e-60
AUX87056.1|2981078_2983670_+	hypothetical protein	NA	A0A2K8HNU9	Pseudomonas_phage	42.2	7.8e-196
AUX87057.1|2983666_2985007_+	hypothetical protein	NA	A0A0U1VZM6	Pseudomonas_phage	52.8	2.0e-46
AUX87058.1|2985008_2987519_+	hypothetical protein	NA	A0A0U1SZM6	Pseudomonas_phage	46.7	6.0e-44
>prophage 7
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	3009996	3018179	3795065	tRNA	Moumouvirus(14.29%)	10	NA	NA
AUX87079.1|3009996_3011418_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.6	2.1e-49
AUX87979.1|3011673_3012651_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	6.2e-37
AUX87080.1|3012654_3013194_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AUX87081.1|3013238_3013793_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUX87082.1|3013776_3014343_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AUX87083.1|3014342_3015089_+	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	1.2e-19
AUX87084.1|3015214_3015811_+	hypothetical protein	NA	A0A1X9I5T8	Streptococcus_phage	38.7	1.3e-21
AUX87085.1|3015803_3016421_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	49.2	6.9e-10
AUX87086.1|3016543_3017386_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	35.7	2.9e-35
AUX87087.1|3017513_3018179_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	41.0	5.3e-24
>prophage 8
CP026412	Acinetobacter sp. ACNIH2 chromosome, complete genome	3795065	3104150	3135653	3795065	transposase,tail,head,plate	Pseudomonas_phage(26.09%)	42	NA	NA
AUX87158.1|3104150_3104594_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	47.0	1.8e-23
AUX87159.1|3104593_3104800_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87160.1|3104796_3105510_-	hypothetical protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	40.5	1.6e-29
AUX87161.1|3105651_3105924_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	58.4	1.2e-19
AUX87162.1|3105959_3106463_-	hypothetical protein	NA	A0A2K9VGT9	Faecalibacterium_phage	32.3	1.9e-13
AUX87163.1|3106484_3106730_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87164.1|3106731_3106947_-	conjugal transfer protein TraR	NA	S4TRY6	Salmonella_phage	43.7	3.6e-06
AUX87165.1|3107036_3108224_-|transposase	transposase	transposase	Q6QIE1	Burkholderia_phage	48.3	2.1e-92
AUX87166.1|3108226_3109969_-|transposase	transposase	transposase	Q5ZR04	Pseudomonas_phage	35.0	3.8e-98
AUX87167.1|3109968_3110880_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87168.1|3110882_3111197_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	45.7	1.1e-14
AUX87169.1|3111372_3111594_-	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	41.8	1.4e-05
AUX87983.1|3111716_3112364_+	peptidase S24	NA	A0A2I7S9A5	Vibrio_phage	37.4	2.6e-31
AUX87170.1|3112377_3113049_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87171.1|3113127_3113628_+	hypothetical protein	NA	A0A0M3LSH2	Mannheimia_phage	64.6	1.8e-53
AUX87172.1|3113624_3114440_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87173.1|3114432_3114714_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AUX87174.1|3114720_3115014_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	50.5	1.7e-19
AUX87175.1|3115021_3115588_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87176.1|3115587_3117228_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	46.5	8.3e-119
AUX87177.1|3117224_3117986_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87178.1|3118017_3118692_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87179.1|3118779_3119163_-	hypothetical protein	NA	NA	NA	NA	NA
AUX87180.1|3119365_3120133_+	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	58.6	1.0e-87
AUX87984.1|3120351_3121989_+	DUF935 domain-containing protein	NA	H1ZZE2	Pseudomonas_virus	42.7	1.8e-110
AUX87181.1|3121988_3123299_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	39.0	1.4e-39
AUX87182.1|3123427_3123907_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	37.9	1.7e-16
AUX87183.1|3123969_3125064_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	35.0	3.7e-38
AUX87184.1|3125066_3125489_+	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	36.2	9.5e-11
AUX87185.1|3125488_3126415_+|head	head protein	head	A0A0U5LBW8	unidentified_phage	49.7	1.6e-71
AUX87186.1|3126426_3126855_+	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	31.4	9.7e-11
AUX87187.1|3126854_3127457_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87188.1|3127465_3128131_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87189.1|3128143_3128404_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87190.1|3128385_3128796_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87191.1|3128813_3129614_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUX87192.1|3129748_3130126_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87193.1|3130143_3130449_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87194.1|3130670_3132830_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87195.1|3132902_3134090_+	multidrug DMT transporter	NA	F6MIL2	Haemophilus_phage	21.2	3.3e-16
AUX87196.1|3134079_3135180_+	hypothetical protein	NA	NA	NA	NA	NA
AUX87197.1|3135176_3135653_+|plate	baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	39.3	2.6e-12
>prophage 1
CP026416	Acinetobacter sp. ACNIH2 plasmid pACI-3569, complete sequence	127843	7735	50227	127843	integrase,transposase,holin	uncultured_Caudovirales_phage(16.67%)	30	21235:21248	44306:44319
AUX88168.1|7735_8440_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	7.2e-120
AUX88267.1|8541_8730_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88169.1|8664_9924_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AUX88170.1|10216_10498_+	damage-inducible protein J	NA	NA	NA	NA	NA
AUX88171.1|10497_10818_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88172.1|11102_11720_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88173.1|11732_13793_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.9	5.0e-20
AUX88174.1|14338_14965_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AUX88175.1|14957_16430_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUX88176.1|16545_18210_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	32.5	3.0e-60
21235:21248	attL	TAAATTTGAATTTT	NA	NA	NA	NA
AUX88177.1|22224_22887_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUX88178.1|23030_23942_-	partitioning protein	NA	S5VSZ7	Leptospira_phage	29.0	2.9e-12
AUX88179.1|23953_24730_-	partitioning protein	NA	Q8JL10	Natrialba_phage	34.6	1.1e-12
AUX88180.1|25673_26852_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AUX88181.1|27307_27745_+	hypothetical protein	NA	W5R8L2	Staphylococcus_phage	32.3	1.3e-15
AUX88182.1|27745_27961_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88183.1|30700_31153_+	transporter	NA	NA	NA	NA	NA
AUX88184.1|31157_33452_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88185.1|35782_36205_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88186.1|36217_38557_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88187.1|38561_41762_+|integrase	integrase	integrase	NA	NA	NA	NA
AUX88188.1|42074_42293_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88189.1|42297_43593_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	51.3	2.0e-128
AUX88190.1|43607_44234_-	LexA family transcriptional regulator	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.6	4.1e-26
AUX88191.1|44345_44987_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	52.8	2.9e-51
44306:44319	attR	AAAATTCAAATTTA	NA	NA	NA	NA
AUX88192.1|45233_46340_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.5	8.3e-30
AUX88193.1|46352_47063_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88194.1|47191_47431_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88195.1|47920_48634_+	recombinase	NA	A0A0R6PHM5	Moraxella_phage	41.3	1.1e-40
AUX88196.1|49027_50227_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	29.5	3.4e-37
>prophage 1
CP026415	Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence	118501	0	94019	118501	transposase,integrase,protease	uncultured_Caudovirales_phage(38.89%)	75	17891:17911	31833:31853
AUX88061.1|881_1118_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88062.1|1151_1403_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88063.1|1410_1656_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88064.1|1680_1911_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88065.1|2282_2816_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AUX88066.1|2819_3170_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUX88067.1|3434_3815_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88068.1|3904_4384_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88069.1|4392_5463_-	competence protein ComEC	NA	NA	NA	NA	NA
AUX88070.1|5508_7764_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AUX88071.1|7760_8954_-	metallohydrolase	NA	NA	NA	NA	NA
AUX88072.1|9043_9946_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AUX88073.1|9952_10741_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88074.1|12381_17538_-	hypothetical protein	NA	NA	NA	NA	NA
17891:17911	attL	ACCAATTCGTTGTACGGTAGA	NA	NA	NA	NA
AUX88075.1|17992_21190_-|integrase	integrase	integrase	NA	NA	NA	NA
AUX88076.1|21194_23540_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88156.1|23546_23969_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88077.1|24284_24452_+	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
AUX88078.1|24464_25061_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUX88079.1|25410_25668_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88080.1|26588_26894_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUX88081.1|26893_28159_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AUX88082.1|28700_29936_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUX88083.1|29951_31550_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUX88084.1|36590_37529_-	initiator RepB protein	NA	A0A218MNI2	uncultured_virus	37.4	1.5e-43
31833:31853	attR	ACCAATTCGTTGTACGGTAGA	NA	NA	NA	NA
AUX88085.1|37933_38572_+	chromosome partitioning protein ParA	NA	Q2A085	Sodalis_phage	45.5	9.9e-44
AUX88086.1|38574_38862_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88087.1|39304_39556_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88088.1|40422_41127_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AUX88089.1|41275_41704_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88090.1|42002_42515_+	cytochrome b	NA	NA	NA	NA	NA
AUX88091.1|42669_43371_-	VIT family protein	NA	NA	NA	NA	NA
AUX88092.1|43838_44834_-	PAP2 family protein	NA	NA	NA	NA	NA
AUX88093.1|44940_45561_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88094.1|46046_46514_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUX88095.1|47042_48281_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUX88096.1|48291_51375_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	26.2	7.1e-87
AUX88097.1|51367_51694_+	DUF3240 domain-containing protein	NA	NA	NA	NA	NA
AUX88098.1|51690_52998_+	TolC family protein	NA	NA	NA	NA	NA
AUX88099.1|53237_53900_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	29.5	5.3e-24
AUX88100.1|53899_55255_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	6.4e-16
AUX88101.1|56104_56407_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUX88102.1|56399_56756_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUX88103.1|57473_57932_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88157.1|58450_59541_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUX88104.1|60481_60937_-	hypothetical protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	33.3	5.6e-09
AUX88105.1|60933_61500_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88106.1|61530_61992_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88107.1|62306_64346_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
AUX88108.1|64375_67000_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
AUX88109.1|66996_68934_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUX88110.1|68933_72428_-	SAM-dependent methyltransferase	NA	A0A2R2ZGH5	Clostridioides_phage	20.7	5.1e-09
AUX88111.1|72474_76155_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
AUX88112.1|76196_76772_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
AUX88113.1|76788_77400_-	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AUX88114.1|77410_78277_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AUX88115.1|78485_78815_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AUX88116.1|79086_80319_-	ATPase	NA	NA	NA	NA	NA
AUX88117.1|80989_81694_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
AUX88118.1|81664_81850_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88119.1|81827_82757_+	cation transporter	NA	A0A1V0SED0	Indivirus	25.8	2.2e-07
AUX88120.1|82837_83272_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	1.1e-46
AUX88121.1|83395_83683_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUX88122.1|83683_84703_+	permease	NA	NA	NA	NA	NA
AUX88123.1|84722_84962_+	thioredoxin family protein	NA	NA	NA	NA	NA
AUX88124.1|85068_85497_-	universal stress protein	NA	NA	NA	NA	NA
AUX88125.1|85684_86005_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	59.8	9.1e-22
AUX88126.1|86011_86482_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	54.5	1.4e-39
AUX88127.1|86493_87534_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AUX88128.1|87544_88249_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.5	2.4e-91
AUX88129.1|88268_89216_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	5.7e-64
AUX88130.1|89367_90426_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	57.4	1.5e-92
AUX88131.1|90739_91402_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUX88132.1|91801_93268_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	70.5	3.9e-184
AUX88133.1|93314_94019_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
>prophage 2
CP026415	Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence	118501	97593	98298	118501		Planktothrix_phage(100.0%)	1	NA	NA
AUX88137.1|97593_98298_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.5e-29
>prophage 3
CP026415	Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence	118501	109044	109788	118501		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUX88145.1|109044_109788_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	5.4e-17
>prophage 4
CP026415	Acinetobacter sp. ACNIH2 plasmid pACI-55cf, complete sequence	118501	114641	115805	118501	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AUX88153.1|114641_115805_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.3	4.6e-164
>prophage 1
CP026419	Acinetobacter sp. ACNIH2 plasmid pACI-6db8, complete sequence	41447	102	17040	41447	integrase,terminase	Acinetobacter_phage(37.5%)	26	27:38	35993:36004
27:38	attL	GCAATTGGTGCA	NA	NA	NA	NA
AUX88370.1|102_1116_+|integrase	integrase	integrase	A0A0R6PHH4	Moraxella_phage	50.4	5.2e-87
AUX88331.1|1127_1415_-	DNA-binding protein	NA	NA	NA	NA	NA
AUX88332.1|1414_1699_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88333.1|1685_2066_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88334.1|2198_2516_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88335.1|2503_4015_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	34.6	1.5e-66
AUX88336.1|4066_4996_-	transcriptional regulator	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	65.4	1.0e-52
AUX88337.1|5008_5989_-	recombinase	NA	A8ATY5	Listeria_phage	35.9	2.0e-43
AUX88338.1|5990_6206_-	hypothetical protein	NA	A0A1S5SAD2	Streptococcus_phage	61.8	3.1e-18
AUX88339.1|6202_6580_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88371.1|6572_7025_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88340.1|7122_7995_-	hypothetical protein	NA	I6WAZ8	Burkholderia_virus	32.8	7.2e-29
AUX88341.1|8054_8429_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	36.4	1.8e-05
AUX88342.1|8620_8929_-	hypothetical protein	NA	NA	NA	NA	NA
AUX88343.1|8956_9622_-	geranylgeranyl reductase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.2	1.2e-52
AUX88344.1|9700_9892_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	85.5	1.6e-18
AUX88345.1|9888_10164_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	87.5	1.6e-35
AUX88346.1|10352_11012_+	hypothetical protein	NA	A0A220NQL7	Acinetobacter_phage	38.3	2.8e-17
AUX88347.1|11172_11385_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88348.1|11381_11900_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88349.1|11963_12932_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	46.4	4.3e-22
AUX88350.1|12928_13678_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	49.2	1.7e-55
AUX88351.1|13670_14099_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	71.2	1.5e-48
AUX88352.1|14113_14323_+	hypothetical protein	NA	NA	NA	NA	NA
AUX88353.1|14322_15039_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	47.7	5.1e-49
AUX88354.1|15417_17040_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	60.0	3.4e-181
35993:36004	attR	GCAATTGGTGCA	NA	NA	NA	NA
>prophage 1
CP026418	Acinetobacter sp. ACNIH2 plasmid pKPC-8dee, complete sequence	43928	17972	29636	43928	transposase	Salmonella_phage(33.33%)	10	NA	NA
AUX88307.1|17972_18902_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	48.2	1.3e-73
AUX88308.1|18980_19499_+	DNA-binding protein	NA	NA	NA	NA	NA
AUX88309.1|19731_19968_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	52.1	6.3e-12
AUX88310.1|20025_22992_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AUX88311.1|22994_23555_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AUX88312.1|23978_24653_+	hypothetical protein	NA	A0A1V0SKJ1	Klosneuvirus	27.8	1.2e-10
AUX88313.1|24997_26317_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUX88314.1|26566_27448_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUX88315.1|27834_28614_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUX88316.1|28610_29636_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
