The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	0	30261	5277702	tail,head,terminase,portal,holin,capsid	Enterobacteria_phage(92.31%)	40	NA	NA
AUY00354.1|427_604_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AUY00355.1|606_1008_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	97.7	4.6e-71
AUY00356.1|967_1177_+	protein ninF	NA	G9L691	Escherichia_phage	95.7	2.2e-29
AUY00357.1|1169_1382_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	1.4e-34
AUY00358.1|1374_1665_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.2e-51
AUY00359.1|1661_1985_+	hypothetical protein	NA	A5VW85	Enterobacteria_phage	99.1	3.1e-54
AUY00360.1|2020_2209_+	protein ninH	NA	K7PH29	Enterobacteria_phage	98.4	9.4e-27
AUY00361.1|2205_2829_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AUY00362.1|3416_3626_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00363.1|3664_3943_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
AUY00364.1|3920_4487_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	100.0	1.9e-107
AUY00365.1|4486_5023_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	97.8	2.7e-79
AUY00366.1|5130_5376_+	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	100.0	2.4e-38
AUY00367.1|5435_5657_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	98.6	4.0e-37
AUY00368.1|6791_7337_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	100.0	1.1e-94
AUY00369.1|7311_9234_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	100.0	0.0e+00
AUY00370.1|9233_9440_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	100.0	4.5e-30
AUY00371.1|9436_11029_+|portal	phage portal protein	portal	K7PHD3	Enterobacteria_phage	100.0	1.0e-310
AUY00372.1|11009_12353_+|capsid	capsid assembly protein	capsid	K7PKQ1	Enterobacteria_phage	100.0	7.1e-217
AUY00373.1|12362_12695_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
AUY00374.1|12762_13788_+|capsid	minor capsid protein E	capsid	K7PGW9	Enterobacteria_phage	100.0	9.2e-193
AUY00375.1|13833_14268_+	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	93.8	1.1e-41
AUY00376.1|14278_14632_+|tail	phage tail protein	tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
AUY00377.1|14641_15196_+|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
AUY00378.1|15192_15591_+|tail	phage tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
AUY00379.1|15598_16336_+|tail	phage tail protein	tail	K7PGX1	Enterobacteria_phage	100.0	5.5e-131
AUY00380.1|16372_16795_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
AUY00381.1|16803_17124_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	100.0	2.1e-55
AUY00382.1|17101_19618_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	99.8	0.0e+00
AUY00383.1|19623_19971_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	100.0	6.3e-61
AUY00384.1|19967_20723_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	100.0	3.0e-148
AUY00385.1|20724_21456_+	peptidase P60	NA	K7PM21	Enterobacteria_phage	100.0	3.7e-151
AUY00386.1|21443_22034_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	100.0	3.5e-104
AUY00387.1|22086_25542_+	host specificity protein	NA	K7PKR4	Enterobacteria_phage	99.9	0.0e+00
AUY00388.1|25543_25846_+	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
AUY00389.1|25845_26520_+	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	100.0	5.1e-123
AUY00390.1|26631_26865_+	cor protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
AUY00391.1|26925_28200_+|tail	phage tail protein	tail	K7P6M1	Enterobacteria_phage	96.5	2.2e-228
AUY00392.1|28264_28663_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	100.0	4.2e-69
AUY00393.1|29094_30261_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 2
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	34603	36759	5277702		Klebsiella_phage(33.33%)	4	NA	NA
AUY00399.1|34603_34825_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AUY05238.1|34887_35334_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00400.1|35379_35859_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
AUY00401.1|35940_36759_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.6e-44
>prophage 3
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	55407	64858	5277702	transposase	Stx2-converting_phage(71.43%)	9	NA	NA
AUY00420.1|55407_56680_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	5.7e-176
AUY00421.1|56651_57110_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00422.1|57324_58860_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AUY00423.1|58909_59257_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUY00424.1|59253_59637_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
AUY00425.1|61155_61338_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05242.1|62551_62929_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	89.7	3.5e-57
AUY00426.1|62925_63273_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	2.2e-61
AUY00427.1|63322_64858_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.0	1.6e-265
>prophage 4
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	87925	112581	5277702		Bacillus_phage(40.0%)	8	NA	NA
AUY00447.1|87925_97417_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
AUY00448.1|97504_103612_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AUY00449.1|103802_104762_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUY00450.1|104928_106731_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
AUY00451.1|106717_108520_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AUY00452.1|108512_109793_+	MFS transporter	NA	NA	NA	NA	NA
AUY00453.1|109820_111125_+	salicylate synthase	NA	NA	NA	NA	NA
AUY00454.1|111318_112581_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
>prophage 5
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	117770	130361	5277702		Bacillus_phage(33.33%)	13	NA	NA
AUY05245.1|117770_118442_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AUY00459.1|118441_119800_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AUY00460.1|119907_120759_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AUY00461.1|121351_122566_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.7	4.0e-102
AUY00462.1|123132_123498_+	permease	NA	NA	NA	NA	NA
AUY00463.1|123537_124233_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
AUY00464.1|124299_125718_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	4.0e-101
AUY00465.1|125698_126169_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
AUY00466.1|126157_127078_-	EamA family transporter	NA	NA	NA	NA	NA
AUY00467.1|127250_128168_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AUY00468.1|128246_128429_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AUY05246.1|128557_128746_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00469.1|128666_130361_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 6
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	145545	146217	5277702		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUY00491.1|145545_146217_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.6e-81
>prophage 7
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	158436	159189	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY00505.1|158436_159189_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	1.3e-26
>prophage 8
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	171180	172695	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY00519.1|171180_172695_+	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 9
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	182781	188425	5277702		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AUY00530.1|182781_184443_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
AUY00531.1|184488_186090_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AUY00532.1|186108_186969_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AUY00533.1|186971_188021_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AUY00534.1|188035_188425_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 10
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	193678	195412	5277702	tRNA	Tupanvirus(100.0%)	1	NA	NA
AUY00540.1|193678_195412_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 11
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	202028	202772	5277702		Synechococcus_phage(100.0%)	1	NA	NA
AUY00546.1|202028_202772_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 12
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	215718	220818	5277702	tail	Salmonella_phage(33.33%)	4	NA	NA
AUY00561.1|215718_217785_+|tail	tail tape measure protein	tail	A0A0D4DAK9	Salmonella_phage	26.9	6.2e-55
AUY00562.1|217958_218732_+	hypothetical protein	NA	A0A0N9SLL3	Escherichia_phage	71.8	1.6e-72
AUY00563.1|218746_220270_-	recombinase family protein	NA	NA	NA	NA	NA
AUY00564.1|220323_220818_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.5e-71
>prophage 13
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	224836	231900	5277702		Bacillus_virus(50.0%)	9	NA	NA
AUY00569.1|224836_225358_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	1.2e-10
AUY00570.1|225359_225962_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05250.1|226032_226098_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00571.1|226236_226848_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUY00572.1|226856_227867_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AUY00573.1|228013_228799_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUY00574.1|228795_229551_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AUY05251.1|229629_230562_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY00575.1|230577_231900_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 14
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	239372	240500	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY00580.1|239372_240500_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 15
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	254067	255543	5277702		Cyanophage(100.0%)	1	NA	NA
AUY00591.1|254067_255543_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 16
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	263599	268069	5277702		Klebsiella_phage(33.33%)	7	NA	NA
AUY00599.1|263599_264262_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AUY00600.1|264285_264942_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUY00601.1|265043_265274_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AUY00602.1|265412_265787_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUY00603.1|265790_266663_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00604.1|266675_267017_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUY00605.1|267412_268069_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
>prophage 17
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	275565	277614	5277702	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AUY00611.1|275565_277614_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 18
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	282944	283154	5277702		Morganella_phage(100.0%)	1	NA	NA
AUY00619.1|282944_283154_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 19
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	288794	290351	5277702		Moraxella_phage(100.0%)	1	NA	NA
AUY00628.1|288794_290351_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 20
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	294213	302319	5277702	tRNA	Pandoravirus(33.33%)	8	NA	NA
AUY00632.1|294213_295575_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
AUY00633.1|295648_295828_+	YoaH family protein	NA	NA	NA	NA	NA
AUY00634.1|295947_296307_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AUY00635.1|296668_297013_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00636.1|297144_299055_+	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AUY00637.1|299112_299808_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUY00638.1|299847_300429_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05257.1|300633_302319_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 21
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	317073	321650	5277702		Bacillus_phage(100.0%)	3	NA	NA
AUY00656.1|317073_318564_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
AUY00657.1|318744_320220_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUY00658.1|320366_321650_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 22
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	324968	325823	5277702		Indivirus(100.0%)	1	NA	NA
AUY00661.1|324968_325823_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 23
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	338075	338717	5277702		Tupanvirus(100.0%)	1	NA	NA
AUY00671.1|338075_338717_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 24
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	343643	345605	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY00678.1|343643_345605_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	1.1e-40
>prophage 25
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	351203	351857	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY00685.1|351203_351857_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	1.4e-13
>prophage 26
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	357902	359123	5277702		Klosneuvirus(100.0%)	1	NA	NA
AUY00692.1|357902_359123_+	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 27
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	366599	367427	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY00698.1|366599_367427_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.0e-73
>prophage 28
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	373764	376026	5277702		Tupanvirus(100.0%)	1	NA	NA
AUY00706.1|373764_376026_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 29
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	387324	408064	5277702	transposase,tRNA	Tupanvirus(20.0%)	22	NA	NA
AUY00719.1|387324_389253_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AUY00720.1|389256_389799_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AUY00721.1|389895_390093_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUY00722.1|390145_390502_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUY05262.1|390624_390669_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AUY00723.1|390952_391936_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AUY00724.1|391950_394338_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUY00725.1|394342_394642_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AUY00726.1|394742_395723_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AUY00727.1|395785_396337_+	glutathione peroxidase	NA	NA	NA	NA	NA
AUY00728.1|396336_397086_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AUY00729.1|397163_397628_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AUY00730.1|397874_398345_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY05263.1|398272_398407_+	ABC transporter	NA	NA	NA	NA	NA
AUY00731.1|398445_399426_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUY00732.1|399850_401287_+	YdiU family protein	NA	NA	NA	NA	NA
AUY00733.1|401290_401482_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00734.1|401613_402660_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AUY00735.1|402816_403650_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AUY00736.1|403761_403929_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00737.1|403982_406361_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
AUY05264.1|406417_408064_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
>prophage 30
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	426713	431797	5277702		Lake_Baikal_phage(33.33%)	5	NA	NA
AUY00754.1|426713_427082_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	1.6e-14
AUY00755.1|427090_428578_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUY00756.1|428587_429334_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.9e-10
AUY00757.1|429308_430580_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AUY00758.1|430576_431797_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 31
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	440085	442352	5277702		Escherichia_phage(50.0%)	3	NA	NA
AUY00767.1|440085_440754_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
AUY00768.1|440750_441536_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AUY00769.1|441539_442352_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 32
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	447856	456737	5277702		Orpheovirus(20.0%)	10	NA	NA
AUY00774.1|447856_448498_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AUY00775.1|448537_449686_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
AUY00776.1|449976_451188_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AUY00777.1|451300_452233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY00778.1|452229_453255_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AUY00779.1|453242_453467_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00780.1|453553_453643_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AUY00781.1|453808_454978_+	MFS transporter	NA	NA	NA	NA	NA
AUY00782.1|455212_455794_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	47.0	4.0e-44
AUY00783.1|455921_456737_-	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 33
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	465539	467038	5277702		Indivirus(50.0%)	2	NA	NA
AUY00791.1|465539_466436_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
AUY05266.1|466516_467038_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 34
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	473949	475224	5277702	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AUY00799.1|473949_475224_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 35
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	486600	487763	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AUY00814.1|486600_487763_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 36
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	496370	498182	5277702		Vaccinia_virus(100.0%)	1	NA	NA
AUY00822.1|496370_498182_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 37
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	508077	509379	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY00830.1|508077_509379_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 38
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	519479	703183	5277702	protease,integrase,head,tail,terminase,transposase,plate,portal,holin,capsid	Vibrio_phage(21.15%)	215	686447:686461	706623:706637
AUY00843.1|519479_520301_-|protease	serine protease	protease	NA	NA	NA	NA
AUY00844.1|520400_520484_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00845.1|520576_520912_-	acid shock protein	NA	NA	NA	NA	NA
AUY00846.1|521308_522562_-	MFS transporter	NA	NA	NA	NA	NA
AUY00847.1|522668_523562_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY00848.1|523696_524917_+	protein mlc	NA	NA	NA	NA	NA
AUY00849.1|525041_525737_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AUY05269.1|525689_526982_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AUY00850.1|527140_527755_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	3.3e-28
AUY00851.1|527797_528652_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AUY00852.1|528653_529271_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AUY00853.1|529281_531708_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.7	4.0e-210
AUY00854.1|531906_532212_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUY05270.1|532319_533030_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUY00855.1|533032_533593_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AUY00856.1|533627_533969_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00857.1|534103_534430_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AUY00858.1|534466_534655_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00859.1|536005_537157_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUY00860.1|538305_539829_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.3e-44
AUY00861.1|540122_540494_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05271.1|542162_542306_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00862.1|542464_542677_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AUY00863.1|543135_543414_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
AUY00864.1|544477_545230_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AUY00865.1|545651_545864_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AUY00866.1|546164_546380_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUY00867.1|546792_548403_-|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY00868.1|548900_549128_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.2	2.9e-30
AUY00869.1|550208_550421_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUY00870.1|550431_550620_+	cold-shock protein	NA	NA	NA	NA	NA
AUY00871.1|550650_550923_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00872.1|551094_551268_+	protein GnsB	NA	NA	NA	NA	NA
AUY00873.1|551419_551830_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	9.4e-56
AUY00874.1|551887_552121_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AUY00875.1|552226_552370_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUY00876.1|552509_553055_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AUY00877.1|553029_554955_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AUY00878.1|554951_555158_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUY00879.1|555154_556756_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
AUY00880.1|556736_558056_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AUY00881.1|558065_558398_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AUY00882.1|558453_559479_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AUY00883.1|559520_559916_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.8e-57
AUY00884.1|559927_560281_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AUY00885.1|560292_560871_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
AUY00886.1|560867_561263_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AUY05272.1|561270_562011_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AUY00887.1|562026_562449_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
AUY00888.1|562430_562865_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUY00889.1|562857_565437_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
AUY00890.1|565433_565763_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUY00891.1|565762_566461_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
AUY00892.1|566466_567210_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
AUY00893.1|567742_568330_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00894.1|568436_568673_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	59.4	1.2e-15
AUY00895.1|568672_570655_+|transposase	transposase	transposase	A0A0C4UR24	Shigella_phage	51.1	8.3e-190
AUY00896.1|570750_571689_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	47.2	1.0e-73
AUY00897.1|571693_571933_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00898.1|571935_572226_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	46.0	3.1e-13
AUY00899.1|572240_572516_+	host nuclease inhibitor protein	NA	A0A1C6ZDJ8	Pseudomonas_phage	52.9	2.8e-11
AUY00900.1|572520_572772_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00901.1|572779_573307_+	host-nuclease inhibitor protein Gam	NA	A0A125RNF6	Pseudomonas_phage	57.3	6.7e-46
AUY00902.1|573396_574053_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	48.9	3.2e-13
AUY00903.1|574030_574558_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	2.2e-41
AUY00904.1|574554_574962_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.2	9.7e-37
AUY00905.1|574966_575290_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00906.1|575386_575977_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	45.7	7.0e-36
AUY00907.1|575978_576197_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	4.6e-25
AUY00908.1|576189_576597_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00909.1|576584_577193_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00910.1|577189_577396_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUY00911.1|577396_577702_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
AUY05273.1|577714_578002_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
AUY00912.1|578004_578379_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00913.1|578371_578650_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00914.1|578639_579218_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	54.5	4.8e-45
AUY00915.1|579214_580798_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	69.1	4.6e-199
AUY00916.1|580797_582366_+	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	56.2	5.1e-158
AUY00917.1|582358_583153_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.5	6.0e-91
AUY00918.1|583356_584313_+	peptidase	NA	M1Q578	Vibrio_phage	51.0	2.6e-80
AUY00919.1|584316_585210_+|head	phage head protein	head	M4MB71	Vibrio_phage	56.4	1.3e-94
AUY00920.1|585293_585887_+	hypothetical protein	NA	NA	NA	NA	NA
AUY00921.1|585886_586327_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
AUY00922.1|586326_586869_+	phage morphogenesis protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
AUY00923.1|586865_587489_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	2.2e-35
AUY00924.1|587469_587658_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUY00925.1|587657_589136_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	54.0	9.7e-151
AUY00926.1|589145_589502_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	44.6	2.0e-22
AUY00927.1|589505_589901_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	4.0e-19
AUY00928.1|589987_591907_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	34.5	1.6e-57
AUY00929.1|591906_593238_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	36.1	5.0e-74
AUY00930.1|593237_594329_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.3	4.1e-90
AUY00931.1|594319_594862_+|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.9	6.5e-28
AUY00932.1|594858_595311_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
AUY00933.1|595300_596377_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	1.0e-101
AUY00934.1|596361_596952_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	50.3	9.8e-54
AUY00935.1|596951_597620_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	76.8	6.0e-76
AUY00936.1|597772_599365_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
AUY00937.1|599395_599746_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
AUY00938.1|599742_600150_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
AUY00939.1|600517_601120_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	89.4	2.1e-96
AUY05274.1|601120_601633_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	58.0	8.8e-43
AUY00940.1|601683_602238_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.1e-86
AUY05275.1|602303_602612_+|tail	tail assembly protein	tail	A0A291AWV5	Escherichia_phage	80.8	1.6e-36
AUY00941.1|602672_606152_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AUY00942.1|606219_606819_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
AUY05276.1|606883_610234_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
AUY00943.1|610233_610809_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AUY00944.1|610906_611497_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AUY00945.1|611813_612047_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AUY00946.1|612831_614115_+	MFS transporter	NA	NA	NA	NA	NA
AUY00947.1|614203_615664_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	1.1e-42
AUY00948.1|615699_615903_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AUY00949.1|616079_616766_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY00950.1|616854_617601_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AUY00951.1|617612_617831_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05277.1|617737_619783_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AUY00952.1|619827_620346_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00953.1|620621_621014_+	TIGR00156 family protein	NA	NA	NA	NA	NA
AUY00954.1|621268_622159_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
AUY00955.1|622377_622473_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00956.1|622599_623787_-	transporter	NA	NA	NA	NA	NA
AUY00957.1|623981_624881_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AUY00958.1|624911_625130_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AUY00959.1|625161_625545_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AUY00960.1|625564_625999_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AUY00961.1|626217_626538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
AUY00962.1|626527_626812_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY00963.1|626932_627598_+	stress protection protein MarC	NA	NA	NA	NA	NA
AUY00964.1|627622_628813_-	sugar efflux transporter	NA	NA	NA	NA	NA
AUY00965.1|628962_630078_-	putative protein YneK	NA	NA	NA	NA	NA
AUY00966.1|630155_631037_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY00967.1|631137_632526_+	succinate semialdehyde dehydrogenase [NAD(P)+] Sad	NA	NA	NA	NA	NA
AUY00968.1|632589_633516_+	glutaminase 2	NA	NA	NA	NA	NA
AUY00969.1|633515_633875_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AUY05278.1|634484_635432_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.3e-18
AUY00970.1|635382_635514_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUY00971.1|635658_637110_+	altronate oxidoreductase	NA	NA	NA	NA	NA
AUY00972.1|637316_638231_+	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
AUY00973.1|638234_638993_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUY00974.1|639049_639340_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AUY00975.1|639363_640239_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase LsrF	NA	NA	NA	NA	NA
AUY00976.1|640265_641288_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY00977.1|641299_642292_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
AUY00978.1|642291_643320_-	autoinducer 2 import system permease LsrC	NA	NA	NA	NA	NA
AUY00979.1|643313_644849_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
AUY00980.1|645097_646051_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AUY00981.1|646129_647722_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
AUY00982.1|648252_653673_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	3.6e-142
AUY00983.1|653895_654162_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY00984.1|654161_655484_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUY00985.1|655774_656581_-	SecC motif-containing protein	NA	NA	NA	NA	NA
AUY00986.1|656598_657039_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00987.1|657191_658553_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AUY00988.1|658566_659370_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05279.1|659428_660775_-|transposase	ISNCY family transposase ISLad2	transposase	NA	NA	NA	NA
AUY00989.1|661104_661638_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUY00990.1|661634_662162_-	lysozyme	NA	H9C184	Pectobacterium_phage	78.4	6.0e-79
AUY00991.1|662151_662337_-|holin	holin	holin	I6R0S9	Salmonella_phage	55.1	8.7e-09
AUY00992.1|662337_662676_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00993.1|662675_663290_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00994.1|663371_663572_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00995.1|663572_665681_-|tail	tail tape measure protein	tail	W8VLG7	Pseudomonas_phage	32.8	1.9e-14
AUY00996.1|665808_666297_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00997.1|666296_666722_-	hypothetical protein	NA	NA	NA	NA	NA
AUY00998.1|666725_668084_-	hypothetical protein	NA	A0A142IDK3	Pseudomonas_phage	22.8	7.6e-09
AUY00999.1|668084_668873_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01000.1|668872_669226_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01001.1|669222_669696_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01002.1|669881_670079_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	9.2e-25
AUY01003.1|670136_670496_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01004.1|670505_670763_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01005.1|670766_671705_-	hypothetical protein	NA	E5AGA8	Erwinia_phage	29.7	3.3e-27
AUY01006.1|671722_672514_-	hypothetical protein	NA	A0A1S5R5Y7	Pseudomonas_phage	57.0	1.3e-13
AUY01007.1|672513_673530_-	hypothetical protein	NA	A0A291LCH5	Klebsiella_phage	29.5	8.2e-16
AUY01008.1|673501_674863_-|head	phage head morphogenesis protein	head	D6PSX3	Lactobacillus_phage	23.9	1.8e-10
AUY01009.1|674849_676232_-|portal	portal protein	portal	NA	NA	NA	NA
AUY01010.1|676228_677638_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	34.7	3.4e-60
AUY01011.1|677624_678173_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01012.1|678516_678672_-	protein hokG	NA	NA	NA	NA	NA
AUY01013.1|679141_680770_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01014.1|680787_681303_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	47.5	4.2e-37
AUY01015.1|681415_682705_+	hypothetical protein	NA	C3V1V7	Escherichia_virus	33.0	2.6e-27
AUY01016.1|682701_683133_+	hypothetical protein	NA	Q9MCR5	Enterobacteria_phage	50.6	4.0e-12
AUY01017.1|683147_683420_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	56.8	5.3e-23
AUY01018.1|683505_684138_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01019.1|684137_684374_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01020.1|684370_684604_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUY01021.1|684596_685352_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01022.1|685351_686761_-|plate	baseplate protein	plate	Q2NPA2	Xanthomonas_phage	27.3	6.2e-06
686447:686461	attL	GGTCTGCCCTGGCTG	NA	NA	NA	NA
AUY01023.1|686747_687095_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01024.1|687094_687313_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01025.1|687309_687687_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01026.1|687695_688406_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
AUY01027.1|688402_689356_-	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	24.4	1.1e-06
AUY01028.1|689911_690133_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01029.1|690436_690694_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01030.1|690690_691575_-|integrase	integrase	integrase	NA	NA	NA	NA
AUY01031.1|691564_691927_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01032.1|691926_692358_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01033.1|692354_692621_-	hypothetical protein	NA	A1YZS4	Burkholderia_virus	54.8	8.1e-16
AUY01034.1|692617_692986_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01035.1|692972_693251_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01036.1|693247_693517_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY01037.1|693527_694250_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01038.1|694252_694780_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01039.1|694790_695081_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01040.1|695162_695261_-	helicase subunit	NA	NA	NA	NA	NA
AUY05280.1|695816_696692_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUY01041.1|696675_698226_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUY01042.1|698222_700589_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01043.1|700588_700870_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01044.1|700871_701840_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUY01045.1|702157_703183_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
706623:706637	attR	CAGCCAGGGCAGACC	NA	NA	NA	NA
>prophage 39
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	709468	711697	5277702		Lactobacillus_phage(100.0%)	1	NA	NA
AUY05282.1|709468_711697_-	restriction endonuclease	NA	Q9T1H9	Lactobacillus_phage	25.8	3.0e-23
>prophage 40
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	715146	716419	5277702	transposase	Shigella_phage(100.0%)	1	NA	NA
AUY01051.1|715146_716419_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 41
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	733084	735880	5277702		Powai_lake_megavirus(100.0%)	1	NA	NA
AUY01061.1|733084_735880_+	peptidase M16	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 42
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	741250	744022	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY01065.1|741250_744022_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	29.3	2.5e-11
>prophage 43
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	748338	750244	5277702		Planktothrix_phage(100.0%)	2	NA	NA
AUY01070.1|748338_749325_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	5.0e-18
AUY01071.1|749317_750244_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 44
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	753517	754958	5277702		Tupanvirus(50.0%)	2	NA	NA
AUY01076.1|753517_754528_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
AUY01077.1|754673_754958_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 45
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	768341	769886	5277702		Escherichia_phage(100.0%)	1	NA	NA
AUY01084.1|768341_769886_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 46
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	783059	784844	5277702		Ralstonia_phage(100.0%)	1	NA	NA
AUY01095.1|783059_784844_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.4e-25
>prophage 47
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	789750	791853	5277702		Salmonella_phage(100.0%)	1	NA	NA
AUY01102.1|789750_791853_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	4.7e-135
>prophage 48
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	798984	809158	5277702	protease,transposase	Mycoplasma_phage(20.0%)	10	NA	NA
AUY01112.1|798984_799998_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AUY01113.1|800015_801161_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY01114.1|801405_802812_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUY05285.1|802890_803307_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AUY01115.1|803352_803529_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AUY01116.1|803750_803981_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AUY01117.1|804072_806034_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	1.6e-23
AUY01118.1|806106_806643_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY01119.1|806695_807910_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AUY01120.1|807949_809158_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	1.3e-206
>prophage 49
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	820965	821914	5277702		Moraxella_phage(50.0%)	2	NA	NA
AUY01133.1|820965_821139_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AUY01134.1|821383_821914_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 50
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	825853	829756	5277702		Klosneuvirus(100.0%)	1	NA	NA
AUY01138.1|825853_829756_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 51
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	868885	869875	5277702		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUY01166.1|868885_869875_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 52
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	874835	876544	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
AUY01171.1|874835_875969_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AUY01172.1|876109_876544_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
>prophage 53
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	881878	905616	5277702	holin,integrase,tRNA	Escherichia_phage(62.5%)	31	876631:876644	905635:905648
876631:876644	attL	CACTGTTTTTATAT	NA	NA	NA	NA
AUY01177.1|881878_883882_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AUY01178.1|884216_884639_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	6.3e-63
AUY01179.1|884654_885467_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.4e-114
AUY01180.1|885438_886185_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.7	1.5e-112
AUY01181.1|886191_886980_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AUY01182.1|887057_887480_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AUY01183.1|887476_887731_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AUY01184.1|887810_888230_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AUY01185.1|888266_888485_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01186.1|888472_888652_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01187.1|888662_888818_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AUY01188.1|888814_889303_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AUY01189.1|889337_889616_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01190.1|889744_889966_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AUY05290.1|889965_890136_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AUY01191.1|890210_890486_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AUY01192.1|890587_893188_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.4e-247
AUY01193.1|893180_893990_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AUY01194.1|894046_894241_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AUY01195.1|894233_894443_+	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AUY01196.1|894521_894737_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUY01197.1|894738_895974_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AUY01198.1|896025_896961_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AUY01199.1|897089_898463_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AUY01200.1|898492_898666_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01201.1|898940_899924_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUY01202.1|900178_901411_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AUY01203.1|901431_901995_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AUY01204.1|903873_904974_+|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	56.6	5.8e-116
AUY01205.1|905059_905377_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.1e-22
AUY01206.1|905376_905616_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	2.8e-15
905635:905648	attR	CACTGTTTTTATAT	NA	NA	NA	NA
>prophage 54
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	908860	947073	5277702	terminase,tail,head	Salmonella_phage(30.0%)	62	NA	NA
AUY01207.1|908860_909742_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	2.1e-28
AUY01208.1|909741_910515_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	54.4	2.6e-78
AUY01209.1|910511_911708_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.6	4.3e-157
AUY01210.1|911707_912061_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
AUY01211.1|912062_912716_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	51.0	7.0e-61
AUY01212.1|912778_913141_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01213.1|913144_913381_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01214.1|913377_913938_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05291.1|914075_914309_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	9.9e-18
AUY01215.1|914409_915441_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.8	1.9e-97
AUY01216.1|915443_915746_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	1.2e-26
AUY01217.1|915746_916346_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.1	1.1e-52
AUY01218.1|916345_918364_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	59.0	2.1e-217
AUY01219.1|918353_918506_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	1.7e-18
AUY01220.1|918547_918997_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	9.7e-38
AUY01221.1|919000_919441_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	9.5e-62
AUY01222.1|919451_920603_-	hypothetical protein	NA	A0A0M4RD26	Salmonella_phage	82.0	2.5e-178
AUY01223.1|920604_921156_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
AUY01224.1|921148_921553_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
AUY01225.1|921552_922059_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.8	4.8e-17
AUY01226.1|922055_922475_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	54.1	1.4e-35
AUY01227.1|922443_922725_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01228.1|922764_923703_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.9	1.0e-137
AUY01229.1|923714_924209_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	1.2e-49
AUY01230.1|924212_925415_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	53.9	1.3e-105
AUY05292.1|925464_926013_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AUY01231.1|926068_927520_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	9.4e-191
AUY01232.1|927757_929158_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
AUY01233.1|929108_929873_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	1.6e-11
AUY01234.1|929932_930631_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01235.1|930911_931301_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	43.7	9.4e-21
AUY01236.1|931297_931822_-	glycoside hydrolase	NA	Q71TF3	Escherichia_phage	53.6	8.4e-49
AUY01237.1|931805_932048_-	hypothetical protein	NA	O64361	Escherichia_phage	34.0	3.3e-08
AUY01238.1|932520_933099_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	58.3	2.2e-50
AUY01239.1|933095_933755_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	2.4e-101
AUY01240.1|933747_934056_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	56.5	1.6e-23
AUY01241.1|934290_934560_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	1.2e-35
AUY01242.1|934632_934947_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	37.5	1.8e-06
AUY01243.1|935719_935908_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	87.1	8.2e-23
AUY01244.1|935907_936375_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	43.4	8.3e-16
AUY05293.1|936371_936668_-	nucleoside 2-deoxyribosyltransferase	NA	A0A222YYT7	Escherichia_phage	64.1	9.3e-29
AUY01245.1|936670_937132_-	hypothetical protein	NA	H6WYJ9	Enterobacter_phage	54.5	5.2e-10
AUY01246.1|937128_937914_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	1.1e-60
AUY01247.1|937906_938128_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01248.1|938127_938523_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01249.1|938549_939644_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.3	2.5e-31
AUY01250.1|939640_939895_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01251.1|940098_940380_-	hypothetical protein	NA	A2SY75	Escherichia_phage	58.2	2.4e-18
AUY01252.1|940419_940638_-	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	52.2	2.8e-14
AUY01253.1|940746_941406_+	LexA family transcriptional repressor	NA	K7PGR7	Enterobacteria_phage	63.3	1.5e-71
AUY01254.1|941464_941668_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	67.2	2.9e-18
AUY01255.1|941901_942120_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01256.1|942085_942280_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01257.1|942758_943052_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01258.1|943353_943581_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	47.2	2.8e-09
AUY01259.1|943577_943802_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	52.7	4.4e-15
AUY01260.1|943798_944143_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01261.1|944135_944750_+	hypothetical protein	NA	R9VWB9	Serratia_phage	52.3	1.3e-56
AUY05294.1|944749_945316_+	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	60.9	3.6e-37
AUY01262.1|945312_945588_+	hypothetical protein	NA	A0A1U8QJU8	Salmonella_virus	58.3	9.2e-23
AUY01263.1|945707_945968_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
AUY01264.1|946557_947073_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 55
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	965236	966319	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY01282.1|965236_966319_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 56
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	976148	977300	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AUY01291.1|976148_977300_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
>prophage 57
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	981546	982812	5277702		Klosneuvirus(100.0%)	1	NA	NA
AUY01297.1|981546_982812_-	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 58
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	995727	1001384	5277702		Bacillus_virus(50.0%)	5	NA	NA
AUY01311.1|995727_996534_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AUY01312.1|996601_996955_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AUY01313.1|997322_998111_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AUY01314.1|998254_999382_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AUY01315.1|999449_1001384_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 59
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1009201	1009792	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY01325.1|1009201_1009792_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 60
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1014717	1020009	5277702	protease	Tupanvirus(33.33%)	5	NA	NA
AUY01331.1|1014717_1017315_-	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AUY01332.1|1017437_1017650_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01333.1|1017694_1017946_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01334.1|1017981_1019031_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AUY01335.1|1019250_1020009_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	2.0e-06
>prophage 61
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1026977	1029935	5277702		Acinetobacter_phage(100.0%)	2	NA	NA
AUY01342.1|1026977_1028573_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AUY05297.1|1028576_1029935_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 62
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1041593	1043608	5277702		Bacillus_virus(50.0%)	2	NA	NA
AUY01357.1|1041593_1042598_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AUY01358.1|1042594_1043608_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 63
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1052018	1063544	5277702	transposase	Citrobacter_phage(20.0%)	11	NA	NA
AUY01363.1|1052018_1052636_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.1e-52
AUY01364.1|1052792_1054065_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUY01365.1|1054575_1054989_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AUY01366.1|1055133_1056042_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AUY01367.1|1056243_1057257_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AUY01368.1|1057348_1058254_-	patatin family protein	NA	NA	NA	NA	NA
AUY01369.1|1058366_1058825_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01370.1|1058874_1059717_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AUY01371.1|1060621_1061299_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AUY01372.1|1061298_1062009_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AUY01373.1|1062005_1063544_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 64
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1074799	1081601	5277702		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
AUY01381.1|1074799_1075030_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
AUY01382.1|1075299_1076400_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AUY05301.1|1076804_1076912_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
AUY01383.1|1077312_1077447_+	toxin Ldr, type I toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AUY01384.1|1077593_1078448_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AUY01385.1|1078483_1079293_-	protein sirB1	NA	NA	NA	NA	NA
AUY01386.1|1079296_1079689_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01387.1|1079685_1080519_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUY01388.1|1080518_1081601_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 65
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1084737	1087489	5277702		Tupanvirus(50.0%)	2	NA	NA
AUY05302.1|1084737_1085685_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AUY01392.1|1085809_1087489_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	6.0e-24
>prophage 66
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1114156	1115844	5277702		Salmonella_phage(50.0%)	2	NA	NA
AUY01415.1|1114156_1115425_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.2	1.8e-209
AUY01416.1|1115424_1115844_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 67
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1123680	1125330	5277702		Escherichia_phage(100.0%)	1	NA	NA
AUY01430.1|1123680_1125330_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.2	1.6e-85
>prophage 68
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1131870	1135603	5277702		Enterobacteria_phage(66.67%)	4	NA	NA
AUY01439.1|1131870_1132602_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AUY01440.1|1132822_1133227_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AUY01441.1|1133926_1134250_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	2.6e-40
AUY01442.1|1134352_1135603_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	3.2e-22
>prophage 69
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1138739	1140110	5277702		Bodo_saltans_virus(100.0%)	1	NA	NA
AUY01446.1|1138739_1140110_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 70
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1145131	1147109	5277702		Mycoplasma_phage(100.0%)	2	NA	NA
AUY01451.1|1145131_1146268_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AUY01452.1|1146251_1147109_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 71
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1150366	1154107	5277702		Vibrio_phage(50.0%)	4	NA	NA
AUY01457.1|1150366_1151206_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
AUY01458.1|1151221_1152133_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUY01459.1|1152161_1153406_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AUY01460.1|1153405_1154107_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 72
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1161396	1161654	5277702		Erwinia_phage(100.0%)	1	NA	NA
AUY01465.1|1161396_1161654_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 73
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1173977	1175620	5277702		Streptococcus_virus(50.0%)	2	NA	NA
AUY01478.1|1173977_1174982_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	36.0	1.3e-05
AUY01479.1|1174978_1175620_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 74
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1178892	1180074	5277702		Ralstonia_phage(50.0%)	2	NA	NA
AUY01483.1|1178892_1179129_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AUY01484.1|1179339_1180074_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 75
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1185987	1187139	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AUY01493.1|1185987_1187139_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 76
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1193654	1194596	5277702		Brevibacillus_phage(100.0%)	1	NA	NA
AUY01498.1|1193654_1194596_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 77
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1210477	1210723	5277702		Salmonella_phage(100.0%)	1	NA	NA
AUY01518.1|1210477_1210723_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 78
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1215385	1216306	5277702		Morganella_phage(100.0%)	1	NA	NA
AUY01525.1|1215385_1216306_+	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 79
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1225614	1226148	5277702		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AUY01533.1|1225614_1226148_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	2.0e-26
>prophage 80
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1230283	1231117	5277702		Pelagibacter_phage(100.0%)	1	NA	NA
AUY01542.1|1230283_1231117_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 81
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1236592	1241533	5277702	transposase	Salmonella_phage(33.33%)	5	NA	NA
AUY01550.1|1236592_1237561_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUY01551.1|1237597_1238566_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01552.1|1238562_1238886_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AUY01553.1|1238971_1240133_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUY01554.1|1240174_1241533_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 82
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1248352	1249276	5277702		Cronobacter_phage(100.0%)	1	NA	NA
AUY01558.1|1248352_1249276_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
>prophage 83
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1264041	1266316	5277702		Enterobacteria_phage(100.0%)	3	NA	NA
AUY01571.1|1264041_1264536_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AUY01572.1|1264556_1265885_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	6.7e-236
AUY01573.1|1266142_1266316_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 84
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1270610	1282865	5277702		Klosneuvirus(20.0%)	13	NA	NA
AUY01579.1|1270610_1271531_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AUY05314.1|1271530_1271836_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AUY01580.1|1271928_1272528_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AUY01581.1|1272524_1275071_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
AUY01582.1|1275070_1276243_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AUY01583.1|1276372_1277065_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AUY01584.1|1277037_1278066_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AUY01585.1|1278148_1280893_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
AUY01586.1|1280964_1282038_+	electron transporter YccM	NA	NA	NA	NA	NA
AUY01587.1|1282085_1282259_-	protein GnsA	NA	NA	NA	NA	NA
AUY01588.1|1282248_1282479_-	cold-shock protein	NA	NA	NA	NA	NA
AUY05315.1|1282453_1282642_-	cold-shock protein	NA	NA	NA	NA	NA
AUY01589.1|1282652_1282865_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 85
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1304110	1304323	5277702		Stenotrophomonas_phage(100.0%)	1	NA	NA
AUY01608.1|1304110_1304323_+	DNA-binding protein	NA	B7SYF9	Stenotrophomonas_phage	44.7	7.9e-06
>prophage 86
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1307687	1311140	5277702	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
AUY01616.1|1307687_1308850_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUY01617.1|1309034_1309505_-	DUF4756 domain-containing protein	NA	NA	NA	NA	NA
AUY01618.1|1310405_1311140_-	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	41.6	1.7e-26
>prophage 87
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1329664	1331947	5277702	integrase	Ralstonia_phage(50.0%)	2	1329217:1329231	1331111:1331125
1329217:1329231	attL	CAAAAGAAAAAGGGG	NA	NA	NA	NA
AUY01637.1|1329664_1330903_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.9	1.8e-78
AUY01638.1|1331287_1331947_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1331111:1331125	attR	CCCCTTTTTCTTTTG	NA	NA	NA	NA
>prophage 88
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1336180	1338235	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY01646.1|1336180_1338235_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 89
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1350845	1352753	5277702		Tupanvirus(100.0%)	1	NA	NA
AUY01658.1|1350845_1352753_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 90
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1364635	1365787	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AUY01670.1|1364635_1365787_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 91
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1369896	1382632	5277702	transposase,tRNA	Bacillus_virus(20.0%)	10	NA	NA
AUY01675.1|1369896_1370664_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AUY01676.1|1370706_1373319_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
AUY01677.1|1373584_1374787_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUY01678.1|1374955_1376356_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AUY01679.1|1377244_1378855_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY01680.1|1378847_1379813_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	54.7	3.8e-87
AUY01681.1|1379828_1380011_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01682.1|1379997_1381188_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AUY01683.1|1381409_1382057_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUY05320.1|1382083_1382632_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 92
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1397337	1401878	5277702		Bacillus_phage(100.0%)	3	NA	NA
AUY01695.1|1397337_1399086_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AUY01696.1|1399122_1401387_-	ComEC family protein	NA	NA	NA	NA	NA
AUY01697.1|1401593_1401878_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 93
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1406964	1408053	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY01702.1|1406964_1408053_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 94
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1412150	1415365	5277702		Tetraselmis_virus(100.0%)	2	NA	NA
AUY01706.1|1412150_1414433_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AUY01707.1|1414624_1415365_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 95
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1421673	1512991	5277702	protease,integrase,head,tail,plate,tRNA,portal,capsid	Salmonella_phage(56.67%)	95	1417947:1417962	1515562:1515577
1417947:1417962	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AUY01714.1|1421673_1422291_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AUY01715.1|1422301_1424746_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
AUY01716.1|1424984_1426277_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AUY01717.1|1426367_1427711_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.6e-80
AUY01718.1|1427721_1428333_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUY01719.1|1428487_1432555_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AUY01720.1|1432689_1433184_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUY01721.1|1433727_1434693_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AUY01722.1|1434815_1436582_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AUY01723.1|1436582_1438304_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AUY01724.1|1438345_1439050_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUY01725.1|1439334_1439553_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUY01726.1|1440477_1442754_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AUY01727.1|1442784_1443105_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AUY01728.1|1443427_1443652_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUY01729.1|1443724_1445671_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AUY01730.1|1445667_1446783_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AUY01731.1|1446897_1447890_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUY01732.1|1447886_1449545_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUY01733.1|1449970_1450666_+	aquaporin	NA	NA	NA	NA	NA
AUY01734.1|1451160_1452060_+	transporter	NA	NA	NA	NA	NA
AUY01735.1|1452203_1453856_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AUY01736.1|1453867_1454836_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUY01737.1|1454968_1456687_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AUY01738.1|1456723_1457725_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUY01739.1|1457735_1459166_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUY05321.1|1459264_1460278_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01740.1|1460274_1461105_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AUY01741.1|1461101_1461425_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01742.1|1461550_1462066_+	lipoprotein	NA	NA	NA	NA	NA
AUY01743.1|1462283_1463012_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AUY01744.1|1463029_1463761_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY01745.1|1463767_1464484_+	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
AUY01746.1|1464483_1465152_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AUY01747.1|1465377_1466109_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY01748.1|1466307_1467435_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AUY01749.1|1467475_1467964_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUY01750.1|1468023_1468869_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUY01751.1|1468865_1469819_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUY01752.1|1469828_1470962_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AUY01753.1|1471056_1472169_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AUY01754.1|1472519_1472996_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUY01755.1|1473083_1473986_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AUY01756.1|1474046_1474769_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUY01757.1|1474752_1475040_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01758.1|1475199_1475457_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
AUY01759.1|1475486_1475864_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01760.1|1476133_1477819_+	transporter	NA	NA	NA	NA	NA
AUY01761.1|1478054_1478273_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AUY01762.1|1478363_1479464_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AUY01763.1|1479460_1479946_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AUY01764.1|1479942_1483020_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
AUY01765.1|1483012_1483132_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUY01766.1|1483146_1483449_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUY01767.1|1483503_1484019_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUY01768.1|1484028_1485201_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
AUY01769.1|1485343_1485910_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AUY05322.1|1486313_1486754_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	62.6	5.6e-46
AUY01770.1|1486725_1487328_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.5e-97
AUY01771.1|1487327_1488857_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	5.4e-197
AUY01772.1|1488853_1489459_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	6.4e-109
AUY01773.1|1489451_1490360_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
AUY01774.1|1490346_1490706_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AUY01775.1|1490702_1491281_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	82.8	9.1e-89
AUY01776.1|1491349_1491796_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	2.3e-63
AUY01777.1|1491788_1492220_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
AUY05323.1|1492182_1492428_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.3	5.3e-30
AUY01778.1|1492315_1492744_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	73.8	1.6e-45
AUY01779.1|1492740_1493118_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AUY05324.1|1493119_1493593_-	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
AUY01780.1|1493612_1493828_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUY01781.1|1493831_1494035_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AUY01782.1|1494034_1494499_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AUY01783.1|1494594_1495245_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	4.3e-111
AUY01784.1|1495248_1496307_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	9.3e-180
AUY01785.1|1496323_1497157_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
AUY01786.1|1497299_1499066_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AUY01787.1|1499065_1500100_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	5.1e-175
AUY01788.1|1500169_1500835_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01789.1|1500834_1501269_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01790.1|1501281_1502388_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01791.1|1503023_1503215_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01792.1|1504786_1505086_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05325.1|1505153_1505342_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AUY01793.1|1505495_1507910_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
AUY01794.1|1507906_1508764_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
AUY01795.1|1508760_1508988_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AUY01796.1|1508987_1509221_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AUY01797.1|1509288_1509630_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AUY01798.1|1509747_1510044_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AUY01799.1|1510051_1510561_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AUY01800.1|1510625_1510829_-	regulator	NA	NA	NA	NA	NA
AUY05326.1|1510974_1511544_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
AUY01801.1|1511559_1511775_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	4.5e-09
AUY01802.1|1511938_1512991_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.1e-105
1515562:1515577	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 96
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1519125	1520328	5277702		Stx2-converting_phage(100.0%)	1	NA	NA
AUY05327.1|1519125_1520328_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 97
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1531663	1533535	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY01818.1|1531663_1533535_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	6.8e-16
>prophage 98
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1536853	1545195	5277702		Synechococcus_phage(33.33%)	6	NA	NA
AUY01822.1|1536853_1537516_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
AUY01823.1|1537646_1538546_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AUY01824.1|1538551_1540984_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AUY01825.1|1541129_1541945_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AUY01826.1|1542096_1543362_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AUY01827.1|1543602_1545195_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 99
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1550192	1555417	5277702		Escherichia_phage(33.33%)	6	NA	NA
AUY01833.1|1550192_1550708_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AUY01834.1|1551060_1551948_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AUY01835.1|1552246_1552750_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AUY01836.1|1553035_1553227_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01837.1|1553153_1553900_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY01838.1|1554694_1555417_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 100
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1558957	1573913	5277702		Erwinia_phage(14.29%)	13	NA	NA
AUY01841.1|1558957_1559362_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	3.4e-05
AUY01842.1|1559626_1561909_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AUY01843.1|1561950_1562628_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AUY01844.1|1562701_1562968_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AUY01845.1|1563232_1563493_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUY01846.1|1563721_1564807_-	dehydrogenase	NA	NA	NA	NA	NA
AUY01847.1|1564947_1565910_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AUY01848.1|1565937_1568088_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AUY01849.1|1568207_1568690_+	Swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
AUY01850.1|1568921_1570286_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AUY05329.1|1570514_1571186_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY01851.1|1571185_1572184_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUY01852.1|1572176_1573913_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 101
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1584511	1585420	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY01866.1|1584511_1585420_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 102
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1591900	1593190	5277702		Klosneuvirus(100.0%)	1	NA	NA
AUY01872.1|1591900_1593190_+	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 103
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1603545	1610120	5277702		Planktothrix_phage(33.33%)	8	NA	NA
AUY01882.1|1603545_1604604_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	1.3e-19
AUY01883.1|1604606_1605296_-	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AUY01884.1|1605295_1606069_-	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AUY01885.1|1606090_1606300_-	hypothetical protein	NA	NA	NA	NA	NA
AUY01886.1|1606235_1606385_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AUY01887.1|1606513_1607302_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AUY01888.1|1607369_1608842_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	5.5e-13
AUY01889.1|1609103_1610120_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	4.7e-80
>prophage 104
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1614476	1617996	5277702		Klebsiella_phage(33.33%)	4	NA	NA
AUY01894.1|1614476_1615529_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.4	4.4e-81
AUY01895.1|1615844_1616225_+	hypothetical protein	NA	NA	NA	NA	NA
AUY01896.1|1616338_1617280_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
AUY01897.1|1617276_1617996_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 105
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1654006	1654798	5277702		Kaumoebavirus(100.0%)	1	NA	NA
AUY01927.1|1654006_1654798_-	endonuclease VII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 106
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1658176	1661226	5277702		Acinetobacter_phage(50.0%)	2	NA	NA
AUY01932.1|1658176_1659658_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
AUY01933.1|1659807_1661226_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	4.4e-60
>prophage 107
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1664465	1677192	5277702		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
AUY01938.1|1664465_1668665_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.2	2.8e-25
AUY01939.1|1668907_1669114_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AUY01940.1|1669426_1669516_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUY01941.1|1669515_1671189_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUY01942.1|1671211_1673260_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	6.4e-28
AUY01943.1|1673268_1673841_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUY01944.1|1673833_1676518_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
AUY01945.1|1676514_1677192_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.1	6.8e-27
>prophage 108
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1690584	1694463	5277702	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AUY01959.1|1690584_1692249_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AUY01960.1|1692516_1694463_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 109
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1699229	1700894	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUY01966.1|1699229_1700894_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
>prophage 110
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1704988	1706068	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
AUY01969.1|1704988_1706068_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 111
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1714013	1717546	5277702		Planktothrix_phage(50.0%)	3	NA	NA
AUY01977.1|1714013_1714739_+	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
AUY01978.1|1714856_1715792_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AUY01979.1|1715875_1717546_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
>prophage 112
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1724485	1727068	5277702	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AUY01987.1|1724485_1727068_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 113
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1734078	1736518	5277702		Synechococcus_phage(50.0%)	2	NA	NA
AUY01996.1|1734078_1735167_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AUY01997.1|1735306_1736518_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 114
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1741333	1741980	5277702		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AUY02006.1|1741333_1741717_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AUY02007.1|1741770_1741980_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 115
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1757405	1759520	5277702		Morganella_phage(50.0%)	2	NA	NA
AUY02024.1|1757405_1757834_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
AUY02025.1|1757954_1759520_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 116
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1762704	1764527	5277702		Streptococcus_phage(50.0%)	2	NA	NA
AUY02029.1|1762704_1763925_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	2.3e-57
AUY02030.1|1763897_1764527_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 117
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1778882	1784925	5277702		Klosneuvirus(50.0%)	3	NA	NA
AUY02044.1|1778882_1779698_+	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AUY02045.1|1779694_1780828_-	ferric enterobactin transporter FepE	NA	NA	NA	NA	NA
AUY02046.1|1781043_1784925_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 118
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1802151	1806911	5277702		Bacillus_phage(50.0%)	3	NA	NA
AUY02062.1|1802151_1802835_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AUY02063.1|1802824_1804273_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AUY02064.1|1805009_1806911_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
>prophage 119
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1820016	1823147	5277702	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AUY02073.1|1820016_1820883_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AUY02074.1|1820884_1821097_+	ribosome-associated protein	NA	NA	NA	NA	NA
AUY02075.1|1821204_1821726_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUY02076.1|1821761_1823147_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 120
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1834625	1835771	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY02088.1|1834625_1835771_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 121
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1841961	1843743	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUY02094.1|1841961_1843743_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
>prophage 122
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1850650	1851337	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY02100.1|1850650_1851337_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	2.5e-32
>prophage 123
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1854473	1855151	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY02104.1|1854473_1855151_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 124
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1859690	1862751	5277702		uncultured_virus(50.0%)	2	NA	NA
AUY02110.1|1859690_1862195_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	8.5e-115
AUY02111.1|1862409_1862751_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 125
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1870942	1879503	5277702		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AUY02120.1|1870942_1871902_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.0	8.5e-15
AUY02121.1|1871898_1872861_-	ferrochelatase	NA	NA	NA	NA	NA
AUY02122.1|1873096_1873741_-	adenylate kinase	NA	NA	NA	NA	NA
AUY02123.1|1873920_1875795_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AUY02124.1|1875904_1876510_-	recombination protein RecR	NA	NA	NA	NA	NA
AUY02125.1|1876509_1876839_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUY02126.1|1876891_1878823_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AUY02127.1|1878951_1879503_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 126
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1884699	1890884	5277702	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
AUY02134.1|1884699_1885851_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUY02135.1|1886518_1887712_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUY02136.1|1887734_1890884_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	S5VTK5	Leptospira_phage	23.8	1.4e-53
>prophage 127
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1899720	1903267	5277702		Bacillus_phage(100.0%)	2	NA	NA
AUY02147.1|1899720_1901502_-	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	27.1	5.2e-42
AUY02148.1|1901494_1903267_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 128
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1906590	1907286	5277702		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUY02152.1|1906590_1907286_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	1.2e-87
>prophage 129
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1910426	1915473	5277702	protease	Bacillus_phage(25.0%)	4	NA	NA
AUY02156.1|1910426_1910699_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AUY02157.1|1910907_1913262_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AUY02158.1|1913449_1914724_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AUY02159.1|1914849_1915473_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 130
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1937035	1946016	5277702	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AUY02184.1|1937035_1937506_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AUY02185.1|1937594_1938698_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	3.4e-52
AUY02186.1|1938701_1939151_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUY02187.1|1939301_1939841_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AUY02188.1|1940139_1941024_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AUY02189.1|1941200_1941548_-	HNH endonuclease	NA	NA	NA	NA	NA
AUY02190.1|1941676_1942648_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AUY02191.1|1942658_1944506_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AUY02192.1|1944533_1944866_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AUY02193.1|1944888_1946016_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 131
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1952968	1962940	5277702		Bacillus_phage(60.0%)	7	NA	NA
AUY02199.1|1952968_1954264_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
AUY02200.1|1954321_1955011_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AUY02201.1|1955200_1956403_+	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AUY02202.1|1956399_1959543_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AUY05337.1|1959668_1960853_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AUY02203.1|1960995_1961904_-	fructokinase	NA	NA	NA	NA	NA
AUY05338.1|1962028_1962940_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 132
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1967229	1968345	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY02212.1|1967229_1968345_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 133
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1977527	1982401	5277702	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AUY02225.1|1977527_1978685_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
AUY02226.1|1978685_1979309_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
AUY05339.1|1979396_1981100_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUY02227.1|1981128_1982401_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 134
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1987061	1987829	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY02232.1|1987061_1987829_-	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 135
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1993126	1994236	5277702		Prochlorococcus_phage(100.0%)	1	NA	NA
AUY02239.1|1993126_1994236_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 136
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1997514	1999475	5277702		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
AUY02243.1|1997514_1998528_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
AUY02244.1|1998524_1999475_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 137
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2004885	2009165	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
AUY02250.1|2004885_2005968_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	98.6	3.5e-190
AUY02251.1|2006090_2009165_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
>prophage 138
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2013703	2014603	5277702		Lactobacillus_phage(100.0%)	1	NA	NA
AUY02255.1|2013703_2014603_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
>prophage 139
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2017611	2019498	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY02258.1|2017611_2019498_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 140
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2028179	2029229	5277702		Tupanvirus(100.0%)	1	NA	NA
AUY02267.1|2028179_2029229_-	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	9.8e-73
>prophage 141
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2040615	2164847	5277702	protease,integrase,lysis,tail,head,terminase,transposase,plate,portal,holin,capsid	Shigella_phage(38.96%)	137	2095570:2095616	2179905:2179951
AUY02279.1|2040615_2042649_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.7	2.6e-21
AUY05342.1|2042645_2042861_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02280.1|2042777_2043365_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY02281.1|2043378_2044851_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUY02282.1|2044864_2046535_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AUY02283.1|2046747_2047341_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	96.2	1.5e-06
AUY05343.1|2048116_2048302_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY02284.1|2048573_2049200_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUY05344.1|2049290_2050022_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02285.1|2051234_2051390_-	aldehyde dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	96.3	5.2e-07
AUY02286.1|2051675_2052722_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AUY02287.1|2052830_2053763_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUY05345.1|2053749_2055153_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AUY02288.1|2055427_2056639_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AUY02289.1|2056708_2057722_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
AUY02290.1|2057718_2058669_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	4.0e-33
AUY02291.1|2058665_2059475_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUY02292.1|2059484_2060351_-	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase	NA	NA	NA	NA	NA
AUY02293.1|2060379_2061333_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
AUY02294.1|2063071_2063509_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02295.1|2063802_2065326_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUY02296.1|2065867_2066944_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUY02297.1|2067166_2068465_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
AUY05346.1|2069561_2069843_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY02298.1|2069877_2070447_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUY02299.1|2070552_2073435_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.2	1.2e-128
AUY02300.1|2073434_2073626_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02301.1|2073686_2075414_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	4.4e-86
AUY02302.1|2075501_2075960_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUY02303.1|2075982_2076897_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02304.1|2076999_2077887_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02305.1|2077976_2078588_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AUY02306.1|2078667_2079813_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02307.1|2079802_2080243_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
AUY02308.1|2080246_2081962_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AUY02309.1|2081958_2082456_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AUY02310.1|2082433_2083399_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AUY02311.1|2083423_2084575_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
AUY02312.1|2086490_2087354_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02313.1|2087445_2088267_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
AUY02314.1|2088483_2089185_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AUY02315.1|2089225_2089462_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02316.1|2089461_2089905_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02317.1|2089927_2090395_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02318.1|2090471_2090711_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUY02319.1|2090808_2091267_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	9.0e-15
AUY02320.1|2091282_2091759_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02321.1|2091767_2091989_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUY02322.1|2092007_2092325_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUY02323.1|2092345_2092687_+	toxin	NA	NA	NA	NA	NA
AUY02324.1|2092855_2094448_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
AUY02325.1|2094478_2094829_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
AUY02326.1|2094825_2095233_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
AUY02327.1|2095226_2095409_+	hypothetical protein	NA	NA	NA	NA	NA
2095570:2095616	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUY02328.1|2095681_2095834_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02329.1|2096009_2097476_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02330.1|2097791_2098211_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02331.1|2098715_2099489_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
AUY02332.1|2099549_2100104_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
AUY05347.1|2100264_2100504_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02333.1|2100503_2100947_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
AUY02334.1|2100918_2101512_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
AUY02335.1|2102334_2102919_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	7.0e-113
AUY02336.1|2102909_2103968_-|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
AUY02337.1|2103954_2104383_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	4.0e-81
AUY02338.1|2104379_2104928_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	96.2	5.2e-94
AUY02339.1|2104927_2106007_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	7.7e-206
AUY02340.1|2106003_2107332_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.5	3.9e-244
AUY02341.1|2107393_2107924_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02342.1|2108015_2109848_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.5	4.8e-301
AUY02343.1|2109840_2110023_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02344.1|2109989_2110259_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
AUY02345.1|2110258_2110615_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AUY02346.1|2110614_2112111_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.0	3.4e-276
AUY02347.1|2112094_2112265_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	6.1e-25
AUY02348.1|2112273_2112834_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.8	4.4e-104
AUY02349.1|2112830_2113337_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
AUY02350.1|2113311_2113722_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	95.6	5.5e-72
AUY02351.1|2113718_2114042_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	96.3	4.8e-55
AUY02352.1|2114016_2114244_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.3	1.5e-23
AUY02353.1|2114293_2115499_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	98.5	1.5e-221
AUY02354.1|2115513_2116200_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AUY02355.1|2116141_2117383_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AUY02356.1|2117382_2117565_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AUY02357.1|2117576_2119310_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.7	0.0e+00
AUY02358.1|2119306_2119810_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.0e-88
AUY02359.1|2119926_2120277_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
AUY02360.1|2120443_2120668_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02361.1|2120935_2121397_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	90.8	1.3e-69
AUY02362.1|2121380_2121857_-	lysozyme	NA	S5FV07	Shigella_phage	96.8	3.2e-87
AUY02363.1|2121843_2122149_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
AUY02364.1|2122300_2122636_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02365.1|2122821_2123574_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	9.0e-137
AUY02366.1|2123587_2124577_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
AUY02367.1|2124584_2125382_-	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
AUY02368.1|2125401_2125791_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AUY02369.1|2125787_2126114_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
AUY02370.1|2126110_2126764_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.5	4.3e-127
AUY02371.1|2126763_2127258_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	6.2e-86
AUY02372.1|2127254_2128196_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
AUY02373.1|2128185_2128365_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	1.6e-15
AUY02374.1|2128540_2129098_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
AUY02375.1|2129141_2129342_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AUY02376.1|2129432_2130107_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AUY02377.1|2130596_2131193_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02378.1|2131615_2132152_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	88.2	3.9e-86
AUY02379.1|2132142_2132490_+	hypothetical protein	NA	U5P092	Shigella_phage	95.5	1.1e-57
AUY02380.1|2132590_2134201_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY02381.1|2134271_2134577_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	6.4e-49
AUY02382.1|2134576_2134927_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AUY05348.1|2135028_2135967_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.0	3.9e-182
AUY02383.1|2136213_2137533_+	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
AUY02384.1|2138069_2138291_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY02385.1|2138413_2139178_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02386.1|2139260_2139437_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUY02387.1|2139639_2140260_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUY02388.1|2140315_2140972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
AUY02389.1|2141000_2141309_-	maltose acetyltransferase	NA	NA	NA	NA	NA
AUY02390.1|2141636_2141819_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02391.1|2141818_2141989_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY02392.1|2142217_2143141_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUY02393.1|2143306_2144824_+	porin	NA	NA	NA	NA	NA
AUY02394.1|2144961_2146332_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AUY02395.1|2146331_2147732_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
AUY02396.1|2147761_2148766_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUY02397.1|2149199_2150723_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUY02398.1|2151016_2151448_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02399.1|2151815_2152967_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUY02400.1|2152923_2153292_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	7.2e-39
AUY02401.1|2154586_2155438_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	8.3e-46
AUY02402.1|2155957_2157493_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AUY02403.1|2157542_2157890_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUY02404.1|2157886_2158270_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
AUY02405.1|2158934_2159828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY02406.1|2162153_2162405_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	55.8	7.6e-08
AUY02407.1|2162558_2163584_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUY02408.1|2163878_2164847_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	93.5	8.2e-175
2179905:2179951	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
>prophage 142
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2178454	2183807	5277702		Streptococcus_phage(50.0%)	4	NA	NA
AUY02417.1|2178454_2179441_-	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.6	4.8e-13
AUY02418.1|2180095_2181349_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AUY02419.1|2181360_2182464_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUY02420.1|2182751_2183807_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 143
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2193687	2197000	5277702		Clostridioides_phage(50.0%)	4	NA	NA
AUY02431.1|2193687_2194446_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.1e-20
AUY02432.1|2194737_2195478_+	transpeptidase	NA	NA	NA	NA	NA
AUY02433.1|2195448_2196216_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUY02434.1|2196421_2197000_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 144
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2202463	2210317	5277702		Bradyrhizobium_phage(25.0%)	9	NA	NA
AUY05350.1|2202463_2203195_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
AUY02439.1|2203259_2203727_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AUY02440.1|2203723_2204446_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUY02441.1|2204479_2205235_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUY02442.1|2205306_2206665_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AUY02443.1|2206713_2207484_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUY02444.1|2207561_2208362_-	EEP domain-containing protein	NA	NA	NA	NA	NA
AUY02445.1|2208602_2209517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY02446.1|2209513_2210317_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
>prophage 145
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2216827	2217859	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY02448.1|2216827_2217859_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 146
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2230817	2234933	5277702		Saccharomonospora_phage(50.0%)	2	NA	NA
AUY02463.1|2230817_2234300_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AUY02464.1|2234336_2234933_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	5.1e-26
>prophage 147
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2243761	2244520	5277702		Flavobacterium_phage(100.0%)	1	NA	NA
AUY02473.1|2243761_2244520_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 148
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2257118	2258543	5277702	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUY02486.1|2257118_2258543_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 149
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2262472	2262817	5277702		Lake_Baikal_phage(100.0%)	1	NA	NA
AUY02491.1|2262472_2262817_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 150
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2268851	2269649	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY02496.1|2268851_2269649_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 151
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2274892	2281698	5277702	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AUY02500.1|2274892_2277322_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.0e-40
AUY02501.1|2277395_2277926_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AUY02502.1|2277940_2278645_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AUY02503.1|2278822_2279278_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AUY02504.1|2279314_2280241_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AUY02505.1|2280279_2281698_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 152
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2291580	2292483	5277702	transposase	Sodalis_phage(100.0%)	1	NA	NA
AUY02515.1|2291580_2292483_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.2	2.8e-60
>prophage 153
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2295745	2302368	5277702		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AUY02522.1|2295745_2296672_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AUY02523.1|2296780_2297443_+	carbonic anhydrase	NA	NA	NA	NA	NA
AUY02524.1|2297483_2298020_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AUY02525.1|2298225_2300616_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUY02526.1|2300817_2302368_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	1.6e-18
>prophage 154
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2310114	2311539	5277702		Erysipelothrix_phage(100.0%)	1	NA	NA
AUY02534.1|2310114_2311539_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 155
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2320049	2320601	5277702		Sphingobium_phage(100.0%)	1	NA	NA
AUY02540.1|2320049_2320601_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 156
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2324846	2325890	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUY02545.1|2324846_2325890_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 157
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2351979	2353704	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AUY02572.1|2351979_2353704_-	acetolactate synthase isozyme 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 158
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2366388	2367087	5277702		Planktothrix_phage(100.0%)	1	NA	NA
AUY02584.1|2366388_2367087_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 159
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2373535	2378958	5277702		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AUY02589.1|2373535_2375887_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
AUY02590.1|2376051_2378958_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 160
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2386702	2388663	5277702		Microcystis_phage(50.0%)	4	NA	NA
AUY02598.1|2386702_2387551_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
AUY02599.1|2387547_2387862_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUY02600.1|2387864_2388098_-	antitoxin	NA	NA	NA	NA	NA
AUY02601.1|2388183_2388663_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	45.7	1.2e-28
>prophage 161
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2396560	2402221	5277702		Vibrio_phage(50.0%)	4	NA	NA
AUY02609.1|2396560_2398075_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
AUY02610.1|2398105_2399248_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUY02611.1|2399376_2400594_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AUY02612.1|2400667_2402221_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 162
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2407814	2408963	5277702		Halovirus(100.0%)	1	NA	NA
AUY02618.1|2407814_2408963_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 163
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2413406	2416223	5277702	tRNA	Tupanvirus(100.0%)	1	NA	NA
AUY02624.1|2413406_2416223_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 164
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2423277	2432345	5277702		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
AUY02630.1|2423277_2424444_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
AUY05355.1|2424972_2425182_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	3.0e-18
AUY02631.1|2425285_2426416_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.4	7.9e-28
AUY02632.1|2426504_2428421_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AUY02633.1|2428797_2429202_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02634.1|2429227_2429941_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02635.1|2430089_2430656_+	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AUY02636.1|2430689_2431277_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AUY02637.1|2431391_2432345_-	transaldolase 1	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 165
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2444119	2446233	5277702		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AUY02648.1|2444119_2445544_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
AUY02649.1|2445543_2446233_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 166
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2449459	2454815	5277702		Bacillus_phage(33.33%)	4	NA	NA
AUY02654.1|2449459_2451397_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AUY05358.1|2451505_2451634_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AUY02655.1|2451607_2453275_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AUY02656.1|2453582_2454815_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 167
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2461558	2462881	5277702		Geobacillus_virus(100.0%)	1	NA	NA
AUY02663.1|2461558_2462881_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 168
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2468920	2471796	5277702		Salmonella_phage(50.0%)	3	NA	NA
AUY02670.1|2468920_2469100_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AUY02671.1|2469208_2469814_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUY02672.1|2470206_2471796_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 169
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2479707	2480987	5277702		Salmonella_phage(50.0%)	2	NA	NA
AUY02683.1|2479707_2480247_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AUY02684.1|2480249_2480987_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 170
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2484214	2489578	5277702		Tupanvirus(50.0%)	4	NA	NA
AUY02686.1|2484214_2485237_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
AUY02687.1|2485375_2486290_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AUY02688.1|2486503_2487865_+	MFS transporter	NA	NA	NA	NA	NA
AUY02689.1|2487913_2489578_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 171
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2502179	2502734	5277702		Clostridioides_phage(100.0%)	1	NA	NA
AUY02701.1|2502179_2502734_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 172
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2509257	2510718	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUY02710.1|2509257_2510718_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 173
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2520922	2522598	5277702	integrase	Escherichia_phage(100.0%)	2	2518446:2518458	2522963:2522975
2518446:2518458	attL	ATATGACATTATT	NA	NA	NA	NA
AUY02722.1|2520922_2521519_-	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AUY02723.1|2521995_2522598_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
2522963:2522975	attR	ATATGACATTATT	NA	NA	NA	NA
>prophage 174
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2531390	2544839	5277702	tRNA	Aeromonas_phage(20.0%)	11	NA	NA
AUY05363.1|2531390_2531957_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
AUY02727.1|2531999_2532245_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02728.1|2532926_2533841_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02729.1|2533989_2534175_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02730.1|2534634_2535654_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AUY02731.1|2535783_2537286_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.1e-84
AUY02732.1|2537446_2538529_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUY02733.1|2538528_2539629_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUY02734.1|2539895_2541407_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AUY02735.1|2541540_2541984_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUY02736.1|2541983_2544839_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
>prophage 175
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2553175	2559632	5277702	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
AUY02746.1|2553175_2554111_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AUY02747.1|2554123_2554585_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUY02748.1|2554657_2555044_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUY02749.1|2555109_2555565_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY02750.1|2555609_2558306_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	2.0e-45
AUY05365.1|2558446_2558500_-	MgtA leader peptide	NA	NA	NA	NA	NA
AUY02751.1|2558684_2559632_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 176
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2563270	2566053	5277702		Vibrio_phage(50.0%)	2	NA	NA
AUY02754.1|2563270_2565409_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AUY02755.1|2565588_2566053_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
>prophage 177
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2570296	2576782	5277702		Klosneuvirus(33.33%)	6	NA	NA
AUY02760.1|2570296_2571295_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AUY02761.1|2571327_2572323_-	ABC transporter permease	NA	NA	NA	NA	NA
AUY02762.1|2572309_2573335_-	ABC transporter permease	NA	NA	NA	NA	NA
AUY02763.1|2573345_2574848_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
AUY02764.1|2574985_2575942_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY02765.1|2576251_2576782_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 178
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2621163	2622327	5277702		Ralstonia_phage(100.0%)	1	NA	NA
AUY02812.1|2621163_2622327_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.8e-80
>prophage 179
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2629646	2697469	5277702	protease,transposase,tRNA,capsid	Vibrio_phage(11.76%)	59	NA	NA
AUY02820.1|2629646_2630919_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUY02821.1|2630953_2631733_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUY02822.1|2631809_2632541_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUY02823.1|2632720_2635162_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
AUY02824.1|2635200_2635626_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AUY02825.1|2635830_2637129_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AUY02826.1|2637232_2637430_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AUY02827.1|2637511_2638516_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AUY02828.1|2638518_2639778_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AUY02829.1|2639863_2641144_-	GTPase HflX	NA	NA	NA	NA	NA
AUY02830.1|2641220_2641529_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUY02831.1|2641614_2642565_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUY02832.1|2642557_2644405_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AUY02833.1|2644414_2645752_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AUY02834.1|2645770_2646232_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AUY02835.1|2646203_2647751_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUY02836.1|2647749_2648889_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AUY05367.1|2648871_2648925_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02837.1|2649788_2650334_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AUY02838.1|2650428_2651481_+	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AUY02839.1|2651577_2652546_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AUY02840.1|2652567_2655891_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AUY02841.1|2656041_2657544_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AUY02842.1|2657762_2658740_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
AUY02843.1|2659064_2660873_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AUY02844.1|2660865_2661600_+	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUY02845.1|2661610_2662006_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
AUY02846.1|2662016_2662376_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AUY02847.1|2662438_2663572_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AUY02848.1|2663660_2664194_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
AUY02849.1|2664190_2664508_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AUY02850.1|2664683_2664830_-	entericidin B	NA	NA	NA	NA	NA
AUY02851.1|2664940_2665066_-	entericidin A	NA	NA	NA	NA	NA
AUY02852.1|2665117_2665684_-	elongation factor P	NA	NA	NA	NA	NA
AUY02853.1|2665725_2666754_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AUY02854.1|2667148_2668018_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02855.1|2668210_2668564_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AUY02856.1|2668701_2670348_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AUY02857.1|2670391_2670685_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AUY02858.1|2670960_2672217_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AUY02859.1|2672232_2672709_-	membrane protein FxsA	NA	NA	NA	NA	NA
AUY02860.1|2673045_2674482_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AUY02861.1|2674599_2675901_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
AUY02862.1|2676016_2676355_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AUY02863.1|2676330_2678028_+	thiol:disulfide interchange protein DsbD	NA	NA	NA	NA	NA
AUY02864.1|2678064_2678640_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY05368.1|2679019_2680282_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
AUY02865.1|2681826_2682063_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02866.1|2682078_2682351_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02867.1|2682381_2682591_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02868.1|2682687_2683725_-|capsid	minor capsid protein E	capsid	K4F6Z8	Cronobacter_phage	24.4	1.4e-07
AUY02869.1|2683749_2684094_-	hypothetical protein	NA	NA	NA	NA	NA
AUY02870.1|2684583_2685660_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUY02871.1|2686201_2687725_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.3e-44
AUY02872.1|2688018_2688390_+	hypothetical protein	NA	NA	NA	NA	NA
AUY02873.1|2689206_2689716_+	HNH endonuclease	NA	NA	NA	NA	NA
AUY02874.1|2690008_2690335_+	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	2.5e-11
AUY02875.1|2693159_2696309_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.1	1.4e-101
AUY02876.1|2696488_2697469_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	97.8	8.3e-183
>prophage 180
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2702216	2702984	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY02881.1|2702216_2702984_-	taurine transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	39.6	1.2e-40
>prophage 181
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2708542	2710327	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY02886.1|2708542_2710327_+	HAMP domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.2e-16
>prophage 182
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2714181	2714640	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
AUY02893.1|2714181_2714640_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	9.0e-15
>prophage 183
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2724067	2727279	5277702	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AUY02905.1|2724067_2725525_+	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
AUY02906.1|2725761_2727279_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 184
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2748621	2750124	5277702		Burkholderia_virus(100.0%)	1	NA	NA
AUY02926.1|2748621_2750124_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 185
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2755061	2755850	5277702		Cedratvirus(100.0%)	1	NA	NA
AUY02930.1|2755061_2755850_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 186
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2761454	2763004	5277702		Bacillus_virus(50.0%)	2	NA	NA
AUY02937.1|2761454_2762213_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
AUY02938.1|2762323_2763004_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 187
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2766989	2768975	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
AUY02945.1|2766989_2768975_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	2.1e-148
>prophage 188
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2774220	2776368	5277702		Escherichia_phage(100.0%)	1	NA	NA
AUY02949.1|2774220_2776368_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	2.0e-32
>prophage 189
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2785651	2787610	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY02959.1|2785651_2787610_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 190
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2793195	2794545	5277702		Moraxella_phage(100.0%)	1	NA	NA
AUY02964.1|2793195_2794545_-	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 191
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2798362	2801975	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
AUY02973.1|2798362_2798899_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AUY02974.1|2799152_2801975_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 192
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2806183	2808731	5277702		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AUY02979.1|2806183_2807263_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AUY02980.1|2807315_2808731_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 193
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2815321	2815930	5277702		Lactococcus_phage(100.0%)	1	NA	NA
AUY02988.1|2815321_2815930_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 194
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2826912	2828028	5277702		Mycoplasma_phage(100.0%)	1	NA	NA
AUY02996.1|2826912_2828028_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 195
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2847300	2850984	5277702		Dickeya_phage(100.0%)	1	NA	NA
AUY03014.1|2847300_2850984_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 196
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2866356	2867946	5277702		Prochlorococcus_phage(100.0%)	1	NA	NA
AUY03021.1|2866356_2867946_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 197
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2873308	2875072	5277702		Bacillus_phage(50.0%)	3	NA	NA
AUY03027.1|2873308_2873581_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AUY03028.1|2873767_2874358_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AUY03029.1|2874400_2875072_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 198
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2884289	2892618	5277702		Vibrio_phage(50.0%)	2	NA	NA
AUY03040.1|2884289_2888513_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.9e-66
AUY03041.1|2888589_2892618_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 199
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2896734	2899787	5277702		Tupanvirus(50.0%)	4	NA	NA
AUY03048.1|2896734_2897919_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AUY03049.1|2898494_2898650_+	hypothetical protein	NA	NA	NA	NA	NA
AUY03050.1|2898659_2898854_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03051.1|2898836_2899787_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	6.7e-28
>prophage 200
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2908125	2909970	5277702		Acinetobacter_phage(100.0%)	1	NA	NA
AUY03055.1|2908125_2909970_-	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 201
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2927071	2934318	5277702		Serratia_phage(33.33%)	5	NA	NA
AUY03070.1|2927071_2929369_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AUY03071.1|2929419_2929740_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AUY03072.1|2929754_2930834_-	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AUY03073.1|2931142_2933644_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AUY03074.1|2933655_2934318_+	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
>prophage 202
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2947308	2951493	5277702		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUY03086.1|2947308_2951493_-	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
>prophage 203
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2957132	2961635	5277702		Erwinia_phage(50.0%)	5	NA	NA
AUY03091.1|2957132_2958464_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AUY03092.1|2958530_2959457_+	prenyltransferase	NA	NA	NA	NA	NA
AUY03093.1|2959549_2960035_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AUY03094.1|2960119_2960365_-	cell division protein ZapB	NA	NA	NA	NA	NA
AUY03095.1|2960789_2961635_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 204
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2972696	3010017	5277702	integrase,tail,terminase,plate,portal,holin,capsid	Salmonella_phage(72.5%)	50	2992761:2992775	3007655:3007669
AUY03108.1|2972696_2973419_+	hypothetical protein	NA	Q37850	Escherichia_phage	45.0	9.8e-48
AUY03109.1|2973462_2973705_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05380.1|2973751_2974879_-	hypothetical protein	NA	A0A0M4REC6	Salmonella_phage	87.8	2.9e-171
AUY03110.1|2975040_2976237_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	93.0	1.2e-212
AUY03111.1|2976249_2976765_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	90.1	7.6e-87
AUY03112.1|2976779_2977118_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	80.6	2.1e-40
AUY03113.1|2977126_2977243_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	91.9	6.2e-13
AUY03114.1|2977243_2980174_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	64.5	2.9e-239
AUY03115.1|2980185_2980635_+	oxidoreductase	NA	A0A1J0I2L5	Salmonella_phage	77.7	1.0e-63
AUY03116.1|2980763_2981267_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	56.1	1.8e-40
AUY03117.1|2981266_2981869_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.0e-98
AUY05381.1|2981840_2982281_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	62.6	5.6e-46
AUY03118.1|2982283_2983444_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	59.8	4.2e-117
AUY03119.1|2983433_2984051_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	85.2	3.5e-94
AUY03120.1|2984043_2984955_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	84.2	2.6e-138
AUY03121.1|2984951_2985317_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	68.9	2.9e-40
AUY05382.1|2985313_2985949_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	57.1	3.6e-62
AUY03122.1|2986129_2986762_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	79.6	1.8e-90
AUY03123.1|2986762_2987230_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	77.0	3.1e-63
AUY03124.1|2987232_2987769_-	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	72.5	4.8e-07
AUY03125.1|2987765_2988155_-	peptidase M15	NA	A0A060DAL8	Salmonella_phage	86.8	7.6e-63
AUY03126.1|2988147_2988477_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	90.8	1.7e-47
AUY03127.1|2988486_2988690_-|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	73.1	9.8e-22
AUY03128.1|2988689_2989178_-|capsid	capsid assembly protein	capsid	A0A0M4QWR7	Salmonella_phage	88.8	1.4e-77
AUY03129.1|2989277_2990123_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	65.4	3.1e-77
AUY03130.1|2990167_2991214_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	90.8	6.1e-184
AUY03131.1|2991253_2992093_-|capsid	capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	61.7	7.5e-92
AUY03132.1|2992239_2993955_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	73.9	3.5e-237
2992761:2992775	attL	GTCAGCCAGCCGCGC	NA	NA	NA	NA
AUY03133.1|2993957_2995004_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	75.5	3.0e-154
AUY03134.1|2995414_2995720_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03135.1|2995926_2996436_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03136.1|2999008_2999317_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	65.9	1.1e-27
AUY03137.1|2999316_2999526_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	57.6	8.6e-13
AUY03138.1|2999528_2999765_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03139.1|2999764_3000706_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	63.8	2.0e-109
AUY05383.1|3000775_3001129_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03140.1|3001253_3001436_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AUY03141.1|3001435_3001867_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	89.6	6.9e-65
AUY03142.1|3001953_3002181_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.0	9.6e-26
AUY03143.1|3002356_3002560_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	66.2	1.9e-17
AUY03144.1|3002572_3002854_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	96.8	3.4e-49
AUY03145.1|3002974_3003283_+	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.0	8.5e-17
AUY03146.1|3003349_3004330_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	95.7	3.5e-181
AUY05384.1|3004506_3005007_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
AUY03147.1|3005156_3005855_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUY03148.1|3005851_3007225_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	2.9e-16
AUY03149.1|3007330_3008005_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
3007655:3007669	attR	GCGCGGCTGGCTGAC	NA	NA	NA	NA
AUY03150.1|3008153_3009137_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUY03151.1|3009114_3009222_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AUY03152.1|3009396_3010017_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 205
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3035163	3037943	5277702		Escherichia_phage(50.0%)	3	NA	NA
AUY03177.1|3035163_3035949_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AUY03178.1|3035982_3036879_-	ribokinase	NA	NA	NA	NA	NA
AUY03179.1|3037046_3037943_+	3-sulfolactaldehyde reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 206
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3054166	3056637	5277702		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AUY03190.1|3054166_3055216_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
AUY05388.1|3055227_3056637_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 207
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3060715	3063502	5277702		uncultured_virus(100.0%)	1	NA	NA
AUY03195.1|3060715_3063502_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 208
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3077190	3077805	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY03205.1|3077190_3077805_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 209
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3086686	3089973	5277702		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AUY03213.1|3086686_3087463_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	8.7e-26
AUY03214.1|3087465_3087981_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AUY03215.1|3087984_3088254_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AUY03216.1|3088332_3089973_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 210
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3102386	3104216	5277702		Catovirus(100.0%)	1	NA	NA
AUY05389.1|3102386_3104216_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 211
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3111643	3115502	5277702		Bacillus_phage(100.0%)	3	NA	NA
AUY03239.1|3111643_3113806_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AUY03240.1|3113889_3114606_-	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AUY03241.1|3114605_3115502_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 212
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3133997	3140141	5277702		Enterobacteria_phage(40.0%)	6	NA	NA
AUY03258.1|3133997_3135128_-	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
AUY03259.1|3135132_3135807_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AUY03260.1|3135784_3136666_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AUY03261.1|3136684_3137752_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
AUY03262.1|3137751_3139014_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AUY03263.1|3139010_3140141_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.4	6.7e-27
>prophage 213
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3144183	3149597	5277702		Indivirus(33.33%)	5	NA	NA
AUY03269.1|3144183_3144513_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AUY03270.1|3144643_3145909_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AUY03271.1|3145916_3146039_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUY03272.1|3146044_3147529_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AUY03273.1|3147575_3149597_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 214
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3158012	3159659	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AUY03282.1|3158012_3159659_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	4.8e-66
>prophage 215
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3173050	3178903	5277702		Enterobacteria_phage(33.33%)	5	NA	NA
AUY03290.1|3173050_3173941_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AUY03291.1|3173965_3174931_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AUY03292.1|3174935_3176441_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AUY03293.1|3176448_3176868_-	D-ribose pyranase	NA	NA	NA	NA	NA
AUY03294.1|3177034_3178903_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 216
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3182071	3183064	5277702		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AUY03297.1|3182071_3183064_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 217
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3195018	3198380	5277702		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AUY03311.1|3195018_3196389_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
AUY03312.1|3196550_3198380_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 218
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3203911	3207844	5277702		Cyanophage(50.0%)	4	NA	NA
AUY03317.1|3203911_3204952_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AUY03318.1|3205038_3205998_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AUY03319.1|3205997_3206888_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUY03320.1|3207070_3207844_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 219
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3218832	3220170	5277702		Moraxella_phage(100.0%)	1	NA	NA
AUY03331.1|3218832_3220170_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 220
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3230369	3237738	5277702		Staphylococcus_phage(33.33%)	7	NA	NA
AUY03340.1|3230369_3230627_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AUY03341.1|3230590_3230950_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AUY03342.1|3230966_3231107_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUY03343.1|3231713_3233117_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AUY03344.1|3233121_3234222_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AUY03345.1|3234221_3235295_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AUY03346.1|3235323_3237738_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 221
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3242444	3243593	5277702		Oenococcus_phage(100.0%)	1	NA	NA
AUY03352.1|3242444_3243593_+	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 222
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3248020	3248974	5277702		Cyanophage(50.0%)	2	NA	NA
AUY03356.1|3248020_3248434_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AUY03357.1|3248545_3248974_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 223
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3255755	3264777	5277702		Aeromonas_phage(25.0%)	14	NA	NA
AUY03362.1|3255755_3257471_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
AUY03363.1|3257467_3258961_+	hypothetical protein	NA	A0A2K9L1A5	Tupanvirus	26.2	5.9e-31
AUY03364.1|3259007_3259457_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03365.1|3259565_3259913_+	hypothetical protein	NA	NA	NA	NA	NA
AUY03366.1|3259902_3260265_+	hypothetical protein	NA	NA	NA	NA	NA
AUY03367.1|3260261_3260759_+	radical SAM protein	NA	NA	NA	NA	NA
AUY03368.1|3260766_3261951_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AUY03369.1|3261990_3262173_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03370.1|3262230_3262320_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AUY03371.1|3262316_3262430_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AUY03372.1|3262452_3262611_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03373.1|3262607_3262898_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03374.1|3262884_3262983_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AUY03375.1|3263088_3264777_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	6.0e-56
>prophage 224
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3272081	3273416	5277702		Moraxella_phage(100.0%)	1	NA	NA
AUY05395.1|3272081_3273416_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 225
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3279817	3280980	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AUY03390.1|3279817_3280980_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 226
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3288508	3289900	5277702		environmental_Halophage(100.0%)	1	NA	NA
AUY03393.1|3288508_3289900_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 227
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3294333	3301083	5277702		Bordetella_phage(25.0%)	6	NA	NA
AUY03397.1|3294333_3296442_-	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AUY03398.1|3296460_3296736_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUY03399.1|3296790_3297414_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AUY03400.1|3297671_3299354_+	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AUY03401.1|3299350_3299968_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AUY03402.1|3300258_3301083_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
>prophage 228
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3305727	3316398	5277702	transposase,integrase	Morganella_phage(50.0%)	14	3313180:3313193	3321274:3321287
AUY03411.1|3305727_3308169_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.7	2.6e-137
AUY03412.1|3308161_3308503_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	63.3	1.2e-35
AUY03413.1|3308512_3309139_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	1.0e-24
AUY03414.1|3309135_3309357_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03415.1|3309353_3309533_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03416.1|3309529_3309727_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	45.3	3.2e-09
AUY03417.1|3309723_3310554_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03418.1|3310540_3310723_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUY03419.1|3310715_3311549_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	1.2e-20
AUY03420.1|3311561_3311993_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
AUY03421.1|3311992_3312196_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUY03422.1|3312395_3314006_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
3313180:3313193	attL	TCGGTCATGGCTAC	NA	NA	NA	NA
AUY03423.1|3314077_3315043_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.9e-07
AUY03424.1|3315138_3316398_-|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	1.1e-192
3321274:3321287	attR	TCGGTCATGGCTAC	NA	NA	NA	NA
>prophage 229
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3319738	3324301	5277702		Xanthomonas_phage(25.0%)	7	NA	NA
AUY05398.1|3319738_3320194_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AUY03429.1|3320174_3321395_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
AUY03430.1|3321566_3322235_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AUY03431.1|3322451_3322688_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUY03432.1|3322708_3322876_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUY03433.1|3322973_3323783_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AUY03434.1|3323821_3324301_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 230
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3331739	3333833	5277702		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AUY03442.1|3331739_3332765_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
AUY03443.1|3332849_3333833_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 231
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3337232	3346739	5277702		Synechococcus_phage(16.67%)	9	NA	NA
AUY03447.1|3337232_3338165_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	5.0e-36
AUY03448.1|3338378_3339575_+	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AUY03449.1|3339584_3340610_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
AUY03450.1|3340848_3341883_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AUY03451.1|3341869_3342829_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AUY03452.1|3342832_3344116_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AUY03453.1|3344125_3345670_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AUY03454.1|3345914_3346346_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AUY03455.1|3346487_3346739_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	1.7e-15
>prophage 232
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3369101	3379251	5277702	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
AUY03476.1|3369101_3370040_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
AUY03477.1|3370087_3370930_-	lyase	NA	NA	NA	NA	NA
AUY03478.1|3370950_3375084_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.7e-25
AUY03479.1|3375312_3375921_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUY03480.1|3376018_3377410_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
AUY03481.1|3377406_3379251_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 233
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3408451	3409993	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY03508.1|3408451_3409993_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	5.6e-16
>prophage 234
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3415311	3416307	5277702		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AUY03514.1|3415311_3416307_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 235
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3420165	3422186	5277702	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AUY03518.1|3420165_3421513_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.7e-107
AUY03519.1|3421576_3421789_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AUY03520.1|3421973_3422186_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 236
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3425840	3428174	5277702		Escherichia_phage(100.0%)	1	NA	NA
AUY03525.1|3425840_3428174_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 237
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3438063	3440048	5277702		Planktothrix_phage(50.0%)	2	NA	NA
AUY03533.1|3438063_3439047_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
AUY03534.1|3439043_3440048_+	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 238
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3488235	3488883	5277702		Bacillus_virus(100.0%)	1	NA	NA
AUY05405.1|3488235_3488883_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 239
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3492276	3494411	5277702		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AUY03579.1|3492276_3492702_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AUY03580.1|3492714_3494004_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AUY03581.1|3494057_3494411_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 240
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3497756	3499799	5277702		Indivirus(100.0%)	1	NA	NA
AUY03586.1|3497756_3499799_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 241
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3513383	3514907	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
AUY03598.1|3513383_3514907_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.1e-44
>prophage 242
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3520597	3523926	5277702		Bacillus_phage(66.67%)	4	NA	NA
AUY03602.1|3520597_3520948_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
AUY03603.1|3521095_3521527_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUY03604.1|3521771_3523253_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AUY03605.1|3523245_3523926_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.7e-31
>prophage 243
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3531098	3534555	5277702		uncultured_virus(50.0%)	3	NA	NA
AUY03611.1|3531098_3533546_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	2.9e-83
AUY03612.1|3533586_3533784_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUY03613.1|3533817_3534555_-	peptidase M23	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 244
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3539635	3545899	5277702	transposase	Bacillus_phage(40.0%)	6	NA	NA
AUY03619.1|3539635_3540316_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUY03620.1|3540312_3541713_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AUY03621.1|3541930_3542365_+	copper-binding protein	NA	NA	NA	NA	NA
AUY03622.1|3543586_3545122_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AUY03623.1|3545171_3545519_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUY03624.1|3545515_3545899_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 245
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3552623	3558520	5277702		Staphylococcus_phage(33.33%)	6	NA	NA
AUY03627.1|3552623_3555359_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
AUY03628.1|3555358_3556483_+	ABC transporter permease	NA	NA	NA	NA	NA
AUY03629.1|3556555_3556831_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
AUY03630.1|3556827_3557187_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUY03631.1|3557306_3557708_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AUY03632.1|3557713_3558520_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 246
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3566413	3570545	5277702		Dickeya_phage(50.0%)	4	NA	NA
AUY03641.1|3566413_3567079_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
AUY03642.1|3567299_3567545_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AUY03643.1|3567646_3569845_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	1.5e-118
AUY03644.1|3569918_3570545_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 247
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3573548	3576367	5277702		Staphylococcus_phage(50.0%)	3	NA	NA
AUY03649.1|3573548_3574217_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AUY03650.1|3574209_3575268_+	ABC transporter permease	NA	NA	NA	NA	NA
AUY03651.1|3575512_3576367_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 248
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3582100	3583583	5277702		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AUY03658.1|3582100_3582868_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AUY03659.1|3582869_3583583_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.4	2.0e-13
>prophage 249
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3587124	3588935	5277702		Planktothrix_phage(50.0%)	2	NA	NA
AUY03663.1|3587124_3588195_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AUY03664.1|3588191_3588935_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 250
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3608946	3611394	5277702		Dickeya_phage(100.0%)	1	NA	NA
AUY03681.1|3608946_3611394_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 251
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3620621	3621848	5277702		Ralstonia_phage(100.0%)	1	NA	NA
AUY03691.1|3620621_3621848_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	4.4e-133
>prophage 252
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3626227	3628621	5277702		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AUY03693.1|3626227_3628621_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 253
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3634654	3635533	5277702	transposase	Sodalis_phage(100.0%)	1	NA	NA
AUY03699.1|3634654_3635533_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.0	1.4e-67
>prophage 254
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3642096	3646607	5277702		Bacillus_phage(66.67%)	5	NA	NA
AUY03707.1|3642096_3642816_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AUY03708.1|3642812_3644165_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AUY03709.1|3644195_3644492_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY03710.1|3644550_3644868_-	toxin HigB-2	NA	NA	NA	NA	NA
AUY03711.1|3644984_3646607_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 255
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3663510	3664347	5277702		Vibrio_phage(100.0%)	1	NA	NA
AUY03728.1|3663510_3664347_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 256
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3688537	3698077	5277702		Acinetobacter_phage(25.0%)	10	NA	NA
AUY03755.1|3688537_3689101_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
AUY03756.1|3689186_3690407_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUY03757.1|3690472_3692575_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AUY03758.1|3692613_3693246_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AUY03759.1|3693252_3693468_-	hypothetical protein	NA	NA	NA	NA	NA
AUY03760.1|3693547_3693952_+	OsmC family protein	NA	NA	NA	NA	NA
AUY03761.1|3694006_3694876_-	phosphoribulokinase	NA	NA	NA	NA	NA
AUY03762.1|3694929_3695148_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AUY03763.1|3695141_3696164_-	hydrolase	NA	NA	NA	NA	NA
AUY03764.1|3696163_3698077_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 257
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3703647	3712206	5277702		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
AUY03773.1|3703647_3704034_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
AUY03774.1|3704033_3704393_+	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AUY03775.1|3704400_3704688_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AUY03776.1|3704813_3705188_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AUY03777.1|3705284_3705755_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AUY03778.1|3705851_3707966_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AUY03779.1|3708036_3709221_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AUY03780.1|3709512_3712206_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 258
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3721036	3722989	5277702		Vibrio_phage(100.0%)	1	NA	NA
AUY05410.1|3721036_3722989_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	5.4e-32
>prophage 259
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3744204	3745676	5277702	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AUY03830.1|3744204_3745152_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AUY03831.1|3745166_3745676_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 260
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3756170	3760324	5277702		Bacillus_virus(50.0%)	4	NA	NA
AUY03838.1|3756170_3756929_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
AUY03839.1|3756936_3758040_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUY03840.1|3758049_3759231_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUY03841.1|3759298_3760324_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 261
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3766786	3767671	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AUY03846.1|3766786_3767671_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	4.2e-24
>prophage 262
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3778236	3779280	5277702		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUY03858.1|3778236_3779280_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 263
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3795775	3798300	5277702	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
AUY03873.1|3795775_3796843_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AUY03874.1|3796932_3798300_-|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 264
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3802266	3802764	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
AUY03881.1|3802266_3802764_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 265
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3806402	3807893	5277702		Burkholderia_virus(100.0%)	1	NA	NA
AUY03884.1|3806402_3807893_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 266
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3817589	3832384	5277702		Staphylococcus_phage(25.0%)	17	NA	NA
AUY05413.1|3817589_3818519_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AUY03893.1|3818614_3820951_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AUY03894.1|3821180_3821834_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AUY03895.1|3821830_3822559_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUY03896.1|3822555_3823188_-	protein YrbL	NA	NA	NA	NA	NA
AUY03897.1|3823401_3823674_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AUY03898.1|3823670_3824525_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AUY03899.1|3824570_3825062_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUY03900.1|3825179_3825467_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AUY03901.1|3825489_3826923_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUY03902.1|3826970_3827696_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AUY03903.1|3827702_3828260_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUY03904.1|3828228_3828804_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUY03905.1|3828800_3829367_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
AUY03906.1|3829387_3830374_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	3.3e-38
AUY03907.1|3830387_3831365_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUY03908.1|3831574_3832384_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 267
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3836452	3837929	5277702		Vibrio_phage(50.0%)	2	NA	NA
AUY03913.1|3836452_3836731_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AUY03914.1|3836957_3837929_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 268
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3844703	3847576	5277702	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AUY03923.1|3844703_3846638_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AUY03924.1|3846727_3847576_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 269
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3851658	3858297	5277702		Dickeya_phage(50.0%)	4	NA	NA
AUY03928.1|3851658_3853002_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AUY03929.1|3853632_3854085_+	ribosome maturation factor	NA	NA	NA	NA	NA
AUY03930.1|3854112_3855600_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AUY03931.1|3855624_3858297_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 270
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3863778	3865668	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUY03938.1|3863778_3865668_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 271
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3871370	3879164	5277702		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AUY03945.1|3871370_3871673_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AUY03946.1|3871723_3872167_+	hypothetical protein	NA	NA	NA	NA	NA
AUY03947.1|3872146_3872665_-	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AUY03948.1|3872792_3873428_+	hypothetical protein	NA	NA	NA	NA	NA
AUY03949.1|3873500_3874541_+	permease	NA	NA	NA	NA	NA
AUY03950.1|3874654_3875230_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AUY03951.1|3875239_3875830_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AUY03952.1|3875849_3876245_-	YraN family protein	NA	NA	NA	NA	NA
AUY03953.1|3876202_3878239_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUY03954.1|3878303_3879164_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 272
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3883522	3884685	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AUY03958.1|3883522_3884685_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 273
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3903723	3904869	5277702		Streptococcus_phage(100.0%)	1	NA	NA
AUY03978.1|3903723_3904869_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 274
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3912970	3915265	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
AUY03987.1|3912970_3915265_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 275
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3935987	3936953	5277702		Escherichia_phage(100.0%)	1	NA	NA
AUY04011.1|3935987_3936953_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 276
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3949900	3966096	5277702	tRNA	Herpes_simplex_virus(16.67%)	16	NA	NA
AUY04023.1|3949900_3952993_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
AUY04024.1|3953176_3954160_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AUY04025.1|3954089_3954272_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04026.1|3954378_3954711_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUY05419.1|3954752_3956132_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AUY05420.1|3956067_3956274_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04027.1|3956549_3958070_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
AUY04028.1|3958223_3958847_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUY04029.1|3959134_3959899_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUY04030.1|3960152_3960659_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AUY04031.1|3960737_3962579_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AUY04032.1|3962637_3962760_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUY04033.1|3962773_3964519_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AUY04034.1|3964629_3964845_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUY04035.1|3964843_3965074_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04036.1|3965082_3966096_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 277
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3972496	3973735	5277702	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AUY04044.1|3972496_3973735_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 278
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3978872	3980306	5277702		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUY04048.1|3978872_3980306_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	2.0e-39
>prophage 279
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3983984	3985258	5277702	transposase	Shigella_phage(100.0%)	1	NA	NA
AUY04054.1|3983984_3985258_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 280
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3991156	4002119	5277702		Staphylococcus_phage(20.0%)	13	NA	NA
AUY04061.1|3991156_3991810_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
AUY04062.1|3992071_3992242_+	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AUY04063.1|3992299_3993073_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AUY04064.1|3993215_3994004_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AUY04065.1|3994041_3995202_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AUY04066.1|3995207_3995879_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AUY04067.1|3995766_3996027_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04068.1|3996026_3997508_-	outer membrane protein TolC	NA	NA	NA	NA	NA
AUY04069.1|3997712_3998342_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
AUY04070.1|3998342_3998765_+	dehydrogenase	NA	NA	NA	NA	NA
AUY04071.1|3998789_3999617_+	phosphodiesterase	NA	NA	NA	NA	NA
AUY04072.1|3999616_4000198_+	esterase YqiA	NA	NA	NA	NA	NA
AUY04073.1|4000226_4002119_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 281
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4007076	4007469	5277702		Stx_converting_phage(100.0%)	1	NA	NA
AUY04079.1|4007076_4007469_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 282
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4010779	4020130	5277702		Bacillus_virus(33.33%)	7	NA	NA
AUY04085.1|4010779_4013038_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
AUY04086.1|4013271_4014009_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUY04087.1|4014083_4015496_+	cell division protein FtsP	NA	NA	NA	NA	NA
AUY04088.1|4015606_4017826_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AUY04089.1|4017868_4018126_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04090.1|4018176_4019103_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AUY04091.1|4019302_4020130_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 283
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4026206	4027091	5277702		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AUY04099.1|4026206_4027091_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 284
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4049307	4050480	5277702		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AUY04124.1|4049307_4050480_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	9.4e-40
>prophage 285
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4068542	4072322	5277702	transposase,integrase	Pseudomonas_phage(33.33%)	5	4066689:4066702	4080561:4080574
4066689:4066702	attL	GTTGCCGGATGCAA	NA	NA	NA	NA
AUY04141.1|4068542_4069001_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AUY04142.1|4069098_4069338_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUY04143.1|4069432_4070137_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY04144.1|4070127_4071090_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04145.1|4071134_4072322_-|integrase	integrase	integrase	A0A221SAN4	Ralstonia_phage	30.7	2.8e-31
4080561:4080574	attR	TTGCATCCGGCAAC	NA	NA	NA	NA
>prophage 286
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4097070	4098225	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY04173.1|4097070_4098225_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 287
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4126473	4127706	5277702		Catovirus(100.0%)	1	NA	NA
AUY04200.1|4126473_4127706_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 288
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4135841	4141225	5277702		Prochlorococcus_phage(50.0%)	2	NA	NA
AUY04210.1|4135841_4138715_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
AUY04211.1|4139785_4141225_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
>prophage 289
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4145143	4160535	5277702	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
AUY04218.1|4145143_4146040_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AUY04219.1|4146064_4146775_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AUY04220.1|4146780_4148514_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
AUY04221.1|4148604_4149702_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AUY04222.1|4149712_4151230_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.2e-87
AUY04223.1|4151272_4151821_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AUY04224.1|4151943_4152069_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04225.1|4152070_4153519_-	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AUY04226.1|4153565_4153682_-	purine permease YgfU	NA	NA	NA	NA	NA
AUY04227.1|4153954_4155874_+	oxidoreductase Fe-S binding subunit	NA	NA	NA	NA	NA
AUY04228.1|4156397_4157765_-	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AUY04229.1|4157800_4159120_-	guanine deaminase	NA	NA	NA	NA	NA
AUY04230.1|4159134_4160535_-	xanthine permease XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 290
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4184814	4185570	5277702		Clostridium_phage(100.0%)	1	NA	NA
AUY04248.1|4184814_4185570_+	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 291
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4205976	4208471	5277702		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AUY04266.1|4205976_4206738_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AUY05428.1|4207052_4208471_+	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 292
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4218102	4224875	5277702		Moraxella_phage(33.33%)	6	NA	NA
AUY04275.1|4218102_4218816_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AUY04276.1|4218884_4219574_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AUY04277.1|4220258_4220789_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUY04278.1|4220801_4223048_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AUY04279.1|4223198_4224074_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUY04280.1|4224080_4224875_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 293
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4230352	4245900	5277702	tRNA	Bacillus_phage(33.33%)	9	NA	NA
AUY04286.1|4230352_4233241_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
AUY04287.1|4233233_4236776_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
AUY04288.1|4236775_4238602_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	5.9e-25
AUY04289.1|4238663_4239995_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AUY04290.1|4240226_4241480_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	29.0	5.9e-16
AUY04291.1|4242058_4243156_+	murein transglycosylase A	NA	NA	NA	NA	NA
AUY04292.1|4243394_4244201_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AUY04293.1|4244251_4244695_-	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AUY04294.1|4244694_4245900_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	6.0e-74
>prophage 294
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4257426	4258182	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY04306.1|4257426_4258182_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 295
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4263040	4263889	5277702		Vibrio_phage(100.0%)	1	NA	NA
AUY04310.1|4263040_4263889_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	1.2e-41
>prophage 296
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4271423	4275538	5277702		Hokovirus(50.0%)	2	NA	NA
AUY04318.1|4271423_4274180_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	8.3e-55
AUY04319.1|4274236_4275538_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 297
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4279570	4285266	5277702		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
AUY04324.1|4279570_4281208_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AUY04325.1|4281295_4282594_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	4.4e-131
AUY04326.1|4284315_4284456_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04327.1|4284594_4285266_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 298
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4289983	4290769	5277702		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUY04330.1|4289983_4290769_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 299
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4315474	4317507	5277702		Hokovirus(50.0%)	2	NA	NA
AUY04354.1|4315474_4316902_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
AUY04355.1|4316901_4317507_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 300
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4320619	4333802	5277702		Escherichia_phage(50.0%)	12	NA	NA
AUY04361.1|4320619_4321381_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUY04362.1|4321374_4322001_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUY04363.1|4322140_4323280_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUY04364.1|4323342_4324335_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUY04365.1|4324428_4325793_-	GntP family transporter	NA	NA	NA	NA	NA
AUY04366.1|4325881_4326658_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04367.1|4326662_4327301_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUY04368.1|4327297_4328560_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUY04369.1|4328556_4329465_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUY04370.1|4329660_4330428_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AUY04371.1|4330478_4331135_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
AUY04372.1|4331240_4333802_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 301
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4353272	4354283	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
AUY05431.1|4353272_4354283_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 302
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4361759	4362725	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
AUY04397.1|4361759_4362725_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 303
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4368192	4373752	5277702	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AUY04405.1|4368192_4368690_+	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	7.5e-31
AUY04406.1|4368769_4369831_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AUY04407.1|4370073_4370574_+	regulatory protein RecX	NA	NA	NA	NA	NA
AUY04408.1|4370701_4373332_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AUY04409.1|4373566_4373752_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 304
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4386802	4392098	5277702		Bacillus_virus(20.0%)	5	NA	NA
AUY04423.1|4386802_4388005_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
AUY04424.1|4388359_4389319_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AUY04425.1|4389328_4391473_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.2e-196
AUY04426.1|4391445_4391856_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AUY04427.1|4391852_4392098_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 305
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4396034	4400086	5277702		Clostridium_phage(50.0%)	4	NA	NA
AUY04435.1|4396034_4396484_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AUY04436.1|4396484_4397147_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY04437.1|4397167_4398568_-	GABA permease	NA	NA	NA	NA	NA
AUY04438.1|4398805_4400086_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
>prophage 306
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4404071	4492300	5277702	integrase,lysis,tail,terminase,transposase,tRNA,portal	Enterobacteria_phage(35.71%)	101	4416200:4416222	4481036:4481058
AUY04442.1|4404071_4405094_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUY05432.1|4405534_4406542_-	alpha amylase	NA	NA	NA	NA	NA
AUY04443.1|4406583_4407435_-	alpha-mannosidase	NA	NA	NA	NA	NA
AUY04444.1|4407462_4407786_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04445.1|4409171_4409654_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04446.1|4409753_4410545_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05433.1|4410775_4410973_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04447.1|4410908_4411118_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
AUY04448.1|4411172_4411331_+	glyoxalase	NA	NA	NA	NA	NA
4416200:4416222	attL	GCTGGCGGGAGTTGAACCCGCGT	NA	NA	NA	NA
AUY04449.1|4416350_4416974_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AUY04450.1|4416977_4417667_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04451.1|4417699_4418869_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	2.3e-147
AUY04452.1|4418829_4419036_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AUY04453.1|4419095_4419311_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AUY04454.1|4419307_4419670_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
AUY04455.1|4419660_4420197_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
AUY04456.1|4420324_4421149_-	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
AUY04457.1|4421213_4421576_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUY04458.1|4421648_4421873_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	6.4e-14
AUY04459.1|4422013_4422259_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04460.1|4422176_4422473_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
AUY04461.1|4422658_4423285_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
AUY04462.1|4423382_4423583_+	cell division protein	NA	NA	NA	NA	NA
AUY05434.1|4423620_4424178_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
AUY04463.1|4424353_4424533_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUY04464.1|4424522_4425464_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
AUY04465.1|4425460_4425955_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.6e-86
AUY04466.1|4425954_4426608_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AUY04467.1|4426604_4426931_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AUY04468.1|4426927_4427317_+	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
AUY04469.1|4427336_4428146_+	DNA-binding protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
AUY04470.1|4428153_4429143_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.1e-193
AUY04471.1|4429160_4429502_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AUY04472.1|4429514_4430063_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04473.1|4430049_4430976_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04474.1|4431240_4431444_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AUY04475.1|4431594_4432647_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
AUY04476.1|4432714_4432930_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUY04477.1|4432929_4433427_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AUY04478.1|4433423_4433891_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.7	6.5e-77
AUY04479.1|4433878_4434031_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
AUY04480.1|4434347_4434548_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	97.0	7.9e-32
AUY04481.1|4434706_4435201_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AUY04482.1|4435200_4437303_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
AUY04483.1|4437299_4437512_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUY04484.1|4437511_4439020_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
AUY04485.1|4438964_4440992_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.8	0.0e+00
AUY04486.1|4441033_4441402_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUY04487.1|4441394_4441670_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUY04488.1|4441681_4442260_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AUY05436.1|4442256_4442658_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AUY04489.1|4442668_4443412_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
AUY05435.1|4443472_4443859_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AUY04490.1|4443867_4444197_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUY04491.1|4444168_4447234_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
AUY04492.1|4447233_4447563_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AUY04493.1|4447572_4448271_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	3.6e-132
AUY04494.1|4448276_4449020_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	3.0e-145
AUY04495.1|4448917_4449565_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AUY04496.1|4449625_4453123_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	96.7	0.0e+00
AUY04497.1|4453193_4453793_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
AUY05437.1|4453857_4456818_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
AUY04498.1|4456817_4457402_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.0e-104
AUY04499.1|4457471_4458245_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
AUY04500.1|4458651_4460085_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AUY04501.1|4460119_4461328_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AUY04502.1|4461854_4462700_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04503.1|4462980_4463187_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
AUY04504.1|4463207_4463507_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04505.1|4463801_4465004_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUY04506.1|4464996_4466301_+|integrase	integrase	integrase	NA	NA	NA	NA
AUY04507.1|4466297_4468172_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY04508.1|4468186_4468573_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04509.1|4468669_4469095_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04510.1|4469145_4469460_-	cell wall-binding protein	NA	NA	NA	NA	NA
AUY04511.1|4469479_4469866_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04512.1|4469907_4470180_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04513.1|4470404_4471577_-	relaxase	NA	NA	NA	NA	NA
AUY04514.1|4471545_4471986_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04515.1|4472090_4473449_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04516.1|4473540_4473753_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04517.1|4473759_4474185_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04518.1|4474219_4474426_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04519.1|4474429_4475383_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05438.1|4475653_4477798_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUY04520.1|4477800_4479552_+	ATP-dependent helicase	NA	H9C0J4	Bdellovibrio_phage	25.2	4.8e-08
AUY04521.1|4479633_4480905_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.7	4.0e-214
AUY04522.1|4481605_4482088_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4481036:4481058	attR	GCTGGCGGGAGTTGAACCCGCGT	NA	NA	NA	NA
AUY04523.1|4482219_4482696_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUY04524.1|4482685_4482976_+	RnfH family protein	NA	NA	NA	NA	NA
AUY04525.1|4483037_4483379_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUY04526.1|4483527_4485189_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUY04527.1|4485274_4486153_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUY05439.1|4486084_4486279_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUY04528.1|4486275_4486869_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUY05440.1|4486923_4488165_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUY05441.1|4488230_4489022_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUY04529.1|4489188_4490550_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUY04530.1|4490686_4490935_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUY04531.1|4490953_4491502_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUY04532.1|4491532_4492300_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 307
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4495721	4496792	5277702		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AUY04538.1|4495721_4496792_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 308
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4502698	4505272	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
AUY04546.1|4502698_4505272_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 309
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4511137	4512436	5277702		Burkholderia_virus(100.0%)	1	NA	NA
AUY04547.1|4511137_4512436_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 310
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4517729	4523812	5277702		Achromobacter_phage(25.0%)	8	NA	NA
AUY04551.1|4517729_4518149_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AUY04552.1|4518162_4518366_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04553.1|4518355_4519393_+	methyltransferase	NA	NA	NA	NA	NA
AUY04554.1|4519440_4520130_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
AUY04555.1|4520434_4520818_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AUY04556.1|4520873_4521461_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AUY04557.1|4521563_4522445_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUY04558.1|4522477_4523812_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 311
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4529583	4533326	5277702		Tupanvirus(50.0%)	4	NA	NA
AUY04565.1|4529583_4531383_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AUY04566.1|4531398_4532373_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUY04567.1|4532423_4532702_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04568.1|4532645_4533326_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	3.3e-21
>prophage 312
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4536785	4537046	5277702		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUY04575.1|4536785_4537046_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 313
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4541165	4552455	5277702		Bacillus_phage(50.0%)	7	NA	NA
AUY04581.1|4541165_4545053_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
AUY04582.1|4545610_4547038_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AUY04583.1|4547202_4547916_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AUY04584.1|4547905_4549240_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.3	3.3e-09
AUY04585.1|4549300_4549639_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AUY04586.1|4549683_4550874_-	flavohemoprotein	NA	NA	NA	NA	NA
AUY04587.1|4551201_4552455_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 314
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4558347	4559859	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
AUY04591.1|4558347_4559859_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.3e-13
>prophage 315
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4574994	4581451	5277702		Faustovirus(20.0%)	8	NA	NA
AUY04607.1|4574994_4576209_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AUY04608.1|4576236_4576623_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AUY04609.1|4576639_4576963_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AUY04610.1|4577058_4577574_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AUY04611.1|4577590_4579441_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AUY04612.1|4579442_4579778_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUY04613.1|4579789_4579990_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUY04614.1|4580167_4581451_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
>prophage 316
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4591337	4591769	5277702		Powai_lake_megavirus(100.0%)	1	NA	NA
AUY04619.1|4591337_4591769_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 317
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4600599	4610726	5277702	transposase	Escherichia_phage(44.44%)	11	NA	NA
AUY04628.1|4600599_4601970_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.8	4.0e-42
AUY04629.1|4602131_4603598_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AUY04630.1|4603666_4605244_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AUY04631.1|4605336_4605876_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AUY04632.1|4605891_4606410_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AUY04633.1|4606512_4606659_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AUY04634.1|4606720_4606912_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AUY04635.1|4606929_4607082_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AUY04636.1|4608419_4609955_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.0	1.6e-265
AUY04637.1|4610004_4610352_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	2.2e-61
AUY05445.1|4610348_4610726_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	89.7	3.5e-57
>prophage 318
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4615776	4619778	5277702		Prochlorococcus_phage(33.33%)	5	NA	NA
AUY04640.1|4615776_4616415_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AUY04641.1|4616414_4617452_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AUY04642.1|4617470_4617656_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04643.1|4617776_4618403_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUY04644.1|4618488_4619778_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 319
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4641076	4641790	5277702		Synechococcus_phage(100.0%)	1	NA	NA
AUY04663.1|4641076_4641790_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 320
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4659078	4660029	5277702		Cyanophage(100.0%)	1	NA	NA
AUY04676.1|4659078_4660029_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 321
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4673634	4674328	5277702	transposase	Escherichia_phage(100.0%)	1	NA	NA
AUY04690.1|4673634_4674328_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.4e-128
>prophage 322
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4678353	4679877	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
AUY04695.1|4678353_4679877_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.3e-44
>prophage 323
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4683618	4684158	5277702		Acinetobacter_phage(100.0%)	1	NA	NA
AUY04702.1|4683618_4684158_-	DUF4102 domain-containing protein	NA	A0A0D4DBR3	Acinetobacter_phage	41.1	3.0e-25
>prophage 324
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4689804	4694742	5277702		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
AUY04709.1|4689804_4690674_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
AUY04710.1|4690887_4691313_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
AUY04711.1|4691299_4691749_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AUY04712.1|4691809_4692385_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AUY04713.1|4692480_4693380_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AUY04714.1|4693437_4694742_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	24.2	1.2e-08
>prophage 325
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4698220	4699012	5277702		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUY04718.1|4698220_4699012_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 326
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4702029	4759591	5277702	transposase	Bacillus_phage(18.75%)	48	NA	NA
AUY04723.1|4702029_4703127_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AUY04724.1|4703260_4704172_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	8.5e-57
AUY04725.1|4704360_4705095_-	WGR domain-containing protein	NA	NA	NA	NA	NA
AUY04726.1|4705127_4705502_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04727.1|4706434_4707277_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY04728.1|4707263_4709387_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY04729.1|4710064_4711033_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
AUY04730.1|4711327_4712353_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUY04731.1|4712594_4714397_+	allophanate hydrolase	NA	NA	NA	NA	NA
AUY04732.1|4714389_4718004_+	urea carboxylase	NA	NA	NA	NA	NA
AUY05447.1|4718016_4718715_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUY04733.1|4718780_4720052_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY04734.1|4720145_4721720_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
AUY04735.1|4721719_4722796_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AUY04736.1|4722788_4723580_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	7.3e-12
AUY04737.1|4723582_4724281_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	4.4e-13
AUY04738.1|4724526_4724982_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUY04739.1|4725053_4725449_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AUY04740.1|4725464_4725740_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUY04741.1|4725767_4726193_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUY04742.1|4726231_4727917_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AUY04743.1|4727934_4728300_+	transcriptional regulator	NA	NA	NA	NA	NA
AUY04744.1|4728296_4728533_+	mercury resistance protein	NA	NA	NA	NA	NA
AUY05448.1|4728516_4728636_-	mercury resistance protein	NA	NA	NA	NA	NA
AUY04745.1|4728598_4728811_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUY04746.1|4728940_4729498_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
AUY04747.1|4733332_4733623_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUY04748.1|4733619_4734021_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUY04749.1|4734010_4734367_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUY04750.1|4734621_4734936_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04751.1|4735108_4735642_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUY04752.1|4735641_4736637_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUY04753.1|4736678_4737839_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AUY04754.1|4738352_4739375_-|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUY04755.1|4740981_4741332_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	2.3e-18
AUY04756.1|4741478_4741910_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUY04757.1|4742160_4743636_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	6.1e-28
AUY04758.1|4743628_4744309_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
AUY04759.1|4744498_4745884_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04760.1|4745911_4746265_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY04761.1|4746378_4747671_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUY04762.1|4750912_4751353_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04763.1|4751480_4753925_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	5.2e-85
AUY04764.1|4753965_4754163_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUY04765.1|4755573_4755981_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
AUY04766.1|4755977_4756328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
AUY04767.1|4756358_4757951_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
AUY04768.1|4758988_4759591_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	29.6	1.3e-13
>prophage 327
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4763203	4770848	5277702		Hokovirus(33.33%)	6	NA	NA
AUY04773.1|4763203_4764931_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AUY04774.1|4764975_4765233_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUY04775.1|4765616_4766588_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AUY04776.1|4766772_4767534_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AUY04777.1|4767763_4768762_+	cell division protein ZipA	NA	NA	NA	NA	NA
AUY04778.1|4768832_4770848_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 328
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4792391	4793126	5277702		Clostridioides_phage(100.0%)	1	NA	NA
AUY04797.1|4792391_4793126_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 329
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4796943	4797864	5277702		Morganella_phage(100.0%)	1	NA	NA
AUY04800.1|4796943_4797864_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 330
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4801051	4808628	5277702		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AUY04803.1|4801051_4802746_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
AUY04804.1|4802815_4803760_+	transporter YfdV	NA	NA	NA	NA	NA
AUY04805.1|4803833_4804979_+	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AUY04806.1|4805034_4808628_-	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	6.6e-36
>prophage 331
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4816046	4817480	5277702		Bacillus_phage(100.0%)	1	NA	NA
AUY04810.1|4816046_4817480_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 332
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4820519	4821452	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
AUY04813.1|4820519_4821452_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 333
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4839331	4840417	5277702		Pandoravirus(100.0%)	1	NA	NA
AUY04832.1|4839331_4840417_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 334
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4848981	4850118	5277702		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUY04841.1|4848981_4850118_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 335
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4856594	4858112	5277702		Mollivirus(100.0%)	1	NA	NA
AUY04849.1|4856594_4858112_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 336
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4862323	4863097	5277702		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUY04855.1|4862323_4863097_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 337
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4874743	4877971	5277702		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AUY04867.1|4874743_4875394_+	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
AUY04868.1|4875480_4877313_+	transporter	NA	NA	NA	NA	NA
AUY04869.1|4877371_4877971_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 338
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4912384	4917388	5277702		Tupanvirus(50.0%)	4	NA	NA
AUY04899.1|4912384_4914367_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
AUY04900.1|4914366_4915335_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AUY04901.1|4915338_4916478_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	31.7	1.2e-31
AUY04902.1|4916785_4917388_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 339
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4920992	4925503	5277702		Oenococcus_phage(50.0%)	5	NA	NA
AUY04907.1|4920992_4922198_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
AUY04908.1|4922254_4923544_+	MFS transporter	NA	NA	NA	NA	NA
AUY04909.1|4923561_4924365_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AUY04910.1|4924405_4924591_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04911.1|4924603_4925503_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	55.2	5.6e-69
>prophage 340
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4931396	4945611	5277702		Pseudomonas_phage(33.33%)	9	NA	NA
AUY04916.1|4931396_4932473_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AUY04917.1|4932514_4932721_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04918.1|4932935_4933586_+	protein InaA	NA	NA	NA	NA	NA
AUY04919.1|4933639_4933894_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AUY05456.1|4933893_4935024_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AUY04920.1|4935258_4937544_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
AUY04921.1|4938239_4941974_+	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	26.1	3.3e-22
AUY04922.1|4942114_4942837_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AUY04923.1|4942983_4945611_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 341
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4960533	4965376	5277702		Bacillus_phage(50.0%)	2	NA	NA
AUY04933.1|4960533_4962360_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
AUY04934.1|4962526_4965376_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.9e-41
>prophage 342
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4969653	4975434	5277702		Enterobacteria_phage(25.0%)	5	NA	NA
AUY04939.1|4969653_4970760_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.4	1.2e-118
AUY04940.1|4970871_4971927_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUY04941.1|4972000_4973065_+	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AUY04942.1|4973064_4973715_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AUY04943.1|4973790_4975434_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 343
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4980231	5072804	5277702	protease,lysis,head,tail,terminase,transposase,plate,portal,capsid	Salmonella_phage(18.75%)	100	NA	NA
AUY04950.1|4980231_4981236_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUY04951.1|4983474_4984170_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AUY04952.1|4984156_4985020_+	ferredoxin-type protein NapH	NA	NA	NA	NA	NA
AUY04953.1|4985016_4985466_+	nitrate reductase	NA	NA	NA	NA	NA
AUY04954.1|4985475_4986078_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AUY04955.1|4986090_4986714_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AUY04956.1|4986710_4987373_+	heme exporter protein B	NA	NA	NA	NA	NA
AUY04957.1|4987414_4988152_+	heme exporter protein C	NA	NA	NA	NA	NA
AUY04958.1|4988148_4988358_+	heme exporter protein D	NA	NA	NA	NA	NA
AUY04959.1|4988354_4988834_+	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AUY04960.1|4988830_4990774_+	cytochrome c-type biogenesis protein CcmF	NA	NA	NA	NA	NA
AUY04961.1|4990770_4991328_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUY04962.1|4991324_4992377_+	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AUY04963.1|4992411_4993059_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUY04964.1|4993090_4993348_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04965.1|4993599_4994873_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUY04966.1|4997749_4998109_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY04967.1|4999017_5000199_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
AUY04968.1|5000201_5000411_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04969.1|5000455_5001028_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.9	1.0e-92
AUY04970.1|5001206_5001446_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	59.4	2.3e-14
AUY04971.1|5001870_5002140_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04972.1|5002132_5002489_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04973.1|5002485_5002803_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	2.3e-33
AUY04974.1|5002799_5003054_-	hypothetical protein	NA	NA	NA	NA	NA
AUY04975.1|5003214_5003754_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.3	5.9e-66
AUY04976.1|5003882_5004710_-	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	92.0	2.7e-142
AUY04977.1|5004766_5005138_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
AUY05457.1|5005471_5005837_-|protease	Clp protease	protease	A0A1C9IHZ4	Salmonella_phage	51.6	9.7e-12
AUY04978.1|5006081_5006801_-	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
AUY04979.1|5006870_5007128_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
AUY04980.1|5007159_5007723_+	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	6.5e-07
AUY04981.1|5007898_5008078_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	7.3e-13
AUY04982.1|5008067_5008952_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.6e-55
AUY04983.1|5008948_5010283_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.8	7.5e-118
AUY04984.1|5012226_5012919_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.1	3.1e-59
AUY04985.1|5012915_5013977_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.9	1.0e-109
AUY04986.1|5013998_5014691_+	antitermination protein	NA	NA	NA	NA	NA
AUY04987.1|5015160_5015916_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04988.1|5015915_5016320_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04989.1|5016529_5017582_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.4	7.6e-174
AUY04990.1|5017650_5017953_+	hypothetical protein	NA	O64361	Escherichia_phage	66.3	5.4e-32
AUY04991.1|5017952_5018486_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	2.5e-88
AUY04992.1|5018485_5018947_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	63.8	3.9e-42
AUY04993.1|5018979_5019384_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AUY04994.1|5019460_5020102_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	8.2e-06
AUY04995.1|5020340_5020910_+	hypothetical protein	NA	NA	NA	NA	NA
AUY04996.1|5020851_5022975_+|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
AUY04997.1|5022983_5023247_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AUY04998.1|5023246_5024884_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
AUY04999.1|5024880_5025747_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
AUY05000.1|5025748_5026339_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05001.1|5026338_5026743_+|head	head decoration protein	head	NA	NA	NA	NA
AUY05002.1|5026840_5027890_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
AUY05003.1|5027861_5028272_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05004.1|5028276_5028636_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05005.1|5028632_5029178_+	ATP-binding protein	NA	NA	NA	NA	NA
AUY05006.1|5029181_5029379_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUY05007.1|5029375_5030878_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.3	1.2e-100
AUY05008.1|5030881_5031253_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUY05009.1|5031254_5031533_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AUY05010.1|5031674_5033603_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	43.2	5.1e-19
AUY05011.1|5033946_5035350_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05012.1|5035346_5036432_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	9.9e-44
AUY05013.1|5036470_5037013_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
AUY05014.1|5037009_5037447_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
AUY05015.1|5037448_5038591_+|plate	phage baseplate protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	6.2e-12
AUY05016.1|5038587_5039181_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AUY05458.1|5039520_5039976_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	69.6	6.8e-55
AUY05017.1|5039975_5040578_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	7.8e-99
AUY05018.1|5040549_5041017_-|tail	phage tail protein	tail	U5P083	Shigella_phage	96.1	1.8e-79
AUY05019.1|5041401_5041962_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	82.7	1.6e-82
AUY05020.1|5042005_5042272_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	2.3e-39
AUY05021.1|5042611_5042932_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	74.5	4.6e-42
AUY05022.1|5043188_5044949_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AUY05023.1|5044968_5045196_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05024.1|5045377_5046385_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
AUY05025.1|5046523_5046808_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUY05026.1|5046932_5048693_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
AUY05027.1|5048842_5049538_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AUY05028.1|5049565_5050756_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AUY05029.1|5051088_5051433_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05030.1|5051436_5053026_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
AUY05031.1|5053027_5054053_-	microcin ABC transporter permease	NA	NA	NA	NA	NA
AUY05032.1|5054052_5055147_-	ABC transporter permease	NA	NA	NA	NA	NA
AUY05033.1|5055147_5056962_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY05034.1|5057043_5058600_-	phage resistance protein	NA	NA	NA	NA	NA
AUY05035.1|5058780_5059347_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AUY05036.1|5059758_5060472_-	lipid A 1-diphosphate synthase	NA	NA	NA	NA	NA
AUY05037.1|5060510_5061497_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05038.1|5061614_5063081_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
AUY05039.1|5063303_5063876_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AUY05040.1|5064030_5064285_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AUY05041.1|5065415_5066906_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUY05042.1|5066940_5067798_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
AUY05043.1|5067888_5068221_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUY05044.1|5068338_5068959_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	37.1	1.7e-24
AUY05045.1|5069128_5069389_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUY05046.1|5069388_5069700_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY05047.1|5069723_5072804_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 344
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5085556	5086414	5277702		Catovirus(100.0%)	1	NA	NA
AUY05059.1|5085556_5086414_-	endonuclease IV with intrinsic 3''-5'' exonuclease activity	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 345
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5090484	5094270	5277702	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AUY05064.1|5090484_5092476_+	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
AUY05065.1|5092507_5093344_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AUY05066.1|5093271_5093448_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05067.1|5093504_5093618_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AUY05068.1|5093601_5094270_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 346
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5097964	5099485	5277702		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUY05073.1|5097964_5099485_+	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 347
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5119735	5129177	5277702		Enterobacteria_phage(85.71%)	10	NA	NA
AUY05092.1|5119735_5120662_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUY05093.1|5120666_5121398_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUY05094.1|5121378_5121486_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05095.1|5121545_5122277_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUY05096.1|5122498_5124184_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUY05097.1|5124180_5124900_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUY05098.1|5124946_5125417_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUY05099.1|5125457_5125919_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUY05100.1|5126043_5128044_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AUY05101.1|5128040_5129177_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	5.5e-162
>prophage 348
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5140810	5142844	5277702	tRNA	Indivirus(100.0%)	1	NA	NA
AUY05107.1|5140810_5142844_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 349
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5156037	5159594	5277702		Paenibacillus_phage(50.0%)	4	NA	NA
AUY05119.1|5156037_5156856_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
AUY05120.1|5156907_5157654_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUY05121.1|5157627_5158593_-	sugar kinase	NA	NA	NA	NA	NA
AUY05122.1|5158589_5159594_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 350
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5168813	5175686	5277702		Bacillus_phage(50.0%)	9	NA	NA
AUY05132.1|5168813_5169713_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AUY05133.1|5170126_5170444_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05134.1|5170431_5170611_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05135.1|5170773_5172135_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	3.2e-217
AUY05136.1|5172237_5172534_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY05137.1|5172535_5172832_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AUY05138.1|5173040_5173373_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AUY05139.1|5173563_5174286_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	2.4e-30
AUY05140.1|5174282_5175686_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 351
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5189118	5190471	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUY05148.1|5189118_5190471_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	3.5e-06
>prophage 352
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5195196	5206921	5277702		Catovirus(16.67%)	9	NA	NA
AUY05152.1|5195196_5195838_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AUY05153.1|5195929_5196511_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AUY05154.1|5196532_5198386_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AUY05155.1|5198438_5198729_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
AUY05156.1|5199908_5201492_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AUY05157.1|5202150_5203290_+	lipoprotein	NA	NA	NA	NA	NA
AUY05158.1|5203295_5203739_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AUY05159.1|5203741_5205904_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AUY05160.1|5206081_5206921_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 353
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5211164	5217958	5277702		Synechococcus_phage(25.0%)	6	NA	NA
AUY05166.1|5211164_5212286_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AUY05167.1|5212288_5213257_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.5	9.3e-86
AUY05168.1|5213256_5213736_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AUY05169.1|5213732_5214956_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AUY05170.1|5214958_5216395_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.4	3.9e-48
AUY05171.1|5216587_5217958_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
>prophage 354
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5223573	5231647	5277702	transposase	Enterobacteria_phage(40.0%)	6	NA	NA
AUY05176.1|5223573_5224968_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
AUY05177.1|5225142_5226036_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUY05178.1|5226408_5227494_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
AUY05179.1|5227493_5228393_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
AUY05180.1|5228766_5230377_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY05181.1|5231101_5231647_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 355
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5237676	5243765	5277702		Shigella_phage(33.33%)	5	NA	NA
AUY05185.1|5237676_5238051_+	translocase	NA	U5P0S6	Shigella_phage	46.0	1.6e-17
AUY05186.1|5238113_5239040_+	protein rfbJ	NA	NA	NA	NA	NA
AUY05187.1|5240478_5240838_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05188.1|5240946_5242353_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
AUY05189.1|5242598_5243765_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.0e-110
>prophage 356
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5252884	5253784	5277702		Cellulophaga_phage(100.0%)	1	NA	NA
AUY05199.1|5252884_5253784_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 357
CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5261398	5277609	5277702	protease,transposase	Enterobacteria_phage(55.56%)	29	NA	NA
AUY05208.1|5261398_5262577_+	DUF4102 domain-containing protein	NA	A0A0P0ZDN8	Stx2-converting_phage	99.5	2.6e-231
AUY05209.1|5262557_5262749_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AUY05210.1|5262826_5263171_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.7e-58
AUY05211.1|5263278_5263539_-	eaa protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
AUY05212.1|5263535_5264333_-	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	54.6	3.0e-74
AUY05213.1|5264335_5264617_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	77.3	1.6e-30
AUY05214.1|5264618_5265032_-	hypothetical protein	NA	K7P6V8	Enterobacteria_phage	47.3	8.7e-09
AUY05215.1|5265028_5265301_-	antitoxin	NA	NA	NA	NA	NA
AUY05216.1|5265297_5265795_-	hNH endonuclease	NA	K7PJM1	Enterobacteria_phage	60.0	8.8e-40
AUY05217.1|5265791_5265956_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	1.9e-23
AUY05218.1|5265966_5266263_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	86.7	3.1e-40
AUY05219.1|5266276_5266783_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
AUY05220.1|5266779_5267247_-	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
AUY05221.1|5267247_5267955_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	1.0e-137
AUY05222.1|5268148_5268352_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	95.5	8.3e-29
AUY05223.1|5268254_5268401_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A2D1GLZ1	Escherichia_phage	100.0	3.8e-20
AUY05224.1|5268424_5269393_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
AUY05225.1|5269528_5271139_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY05226.1|5271303_5271774_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AUY05227.1|5271856_5272045_-	hypothetical protein	NA	K7PKZ0	Enterobacterial_phage	100.0	3.9e-33
AUY05228.1|5272048_5272381_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	100.0	1.1e-54
AUY05229.1|5272858_5273155_-	hypothetical protein	NA	K7PL18	Enterobacteria_phage	96.9	8.9e-48
AUY05230.1|5273169_5273856_-	phage repressor protein	NA	K7PK07	Enterobacteria_phage	98.2	4.1e-128
AUY05231.1|5273964_5274195_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	100.0	1.1e-37
AUY05232.1|5274314_5274593_+	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	98.9	1.1e-42
AUY05233.1|5274627_5274774_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	97.9	2.8e-18
AUY05234.1|5274766_5275666_+	DNA replication protein	NA	K7PH26	Enterobacteria_phage	100.0	1.2e-164
AUY05235.1|5275640_5277092_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.6	1.9e-276
AUY05236.1|5277150_5277609_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	3.6e-80
>prophage 1
CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	0	1995	60248		Hokovirus(100.0%)	1	NA	NA
AUY05467.1|579_1995_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	3.1e-53
>prophage 2
CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	5122	58632	60248	transposase,integrase,coat,tRNA	uncultured_Caudovirales_phage(18.18%)	55	17479:17492	53483:53496
AUY05471.1|5122_5392_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AUY05472.1|5440_5896_-	DNA-binding protein	NA	NA	NA	NA	NA
AUY05522.1|5914_6121_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AUY05473.1|6123_8445_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.6	4.1e-39
AUY05474.1|8446_9103_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05475.1|9105_9762_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05476.1|9773_10547_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05477.1|10561_11032_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	40.0	1.6e-19
AUY05478.1|11028_11364_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05479.1|11369_11573_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05523.1|11641_11851_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05480.1|11984_12380_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUY05481.1|12376_14218_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUY05482.1|15091_16582_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUY05483.1|16616_17474_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
17479:17492	attL	TATTGATATTGCAC	NA	NA	NA	NA
AUY05484.1|17564_17897_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUY05485.1|18014_18635_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
AUY05486.1|18804_19065_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUY05487.1|19064_19376_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY05488.1|19399_22480_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUY05489.1|23213_24425_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
AUY05490.1|24421_25351_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUY05491.1|25355_26084_-	pilus assembly protein	NA	NA	NA	NA	NA
AUY05492.1|26323_27379_-	pilus assembly protein	NA	NA	NA	NA	NA
AUY05493.1|27390_27648_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05494.1|27657_28404_-	pilus assembly protein	NA	NA	NA	NA	NA
AUY05495.1|28414_31174_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUY05496.1|31195_31519_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05497.1|31469_32114_-	transglycosylase	NA	NA	NA	NA	NA
AUY05498.1|32159_32387_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05499.1|32337_32829_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AUY05500.1|33184_34345_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AUY05524.1|34347_34896_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AUY05501.1|35223_35481_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05502.1|35723_36065_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05503.1|36392_36659_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05504.1|36670_37213_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05505.1|37256_37772_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUY05506.1|37962_38181_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05507.1|40213_40657_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05508.1|40830_41187_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AUY05509.1|41183_42161_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05510.1|42185_42467_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUY05511.1|42563_43226_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.1	6.5e-06
AUY05525.1|43562_44210_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	6.1e-09
AUY05512.1|45415_46420_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUY05513.1|46754_47777_-|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUY05514.1|48159_49164_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUY05515.1|49345_49495_-|integrase	integrase	integrase	NA	NA	NA	NA
AUY05516.1|49831_49942_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	4.5e-13
AUY05517.1|50000_51122_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUY05526.1|51131_52277_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUY05518.1|52340_55982_-	mannosyltransferase	NA	A0A218MKE2	uncultured_virus	29.6	1.5e-22
53483:53496	attR	GTGCAATATCAATA	NA	NA	NA	NA
AUY05519.1|55984_57418_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUY05520.1|57417_58632_-	O8 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	2.4e-14
>prophage 1
CP026404	Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence	127217	0	66747	127217	protease,transposase	Escherichia_phage(43.48%)	59	NA	NA
AUY05689.1|839_2462_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY05690.1|3332_3596_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05691.1|3823_4105_+	DNA-binding protein	NA	NA	NA	NA	NA
AUY05692.1|4140_4710_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUY05693.1|4807_7657_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.3	1.2e-128
AUY05791.1|7673_9104_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUY05694.1|9131_10961_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	5.3e-106
AUY05695.1|11039_11498_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUY05696.1|11519_12428_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05697.1|12530_13418_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05698.1|13514_14126_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AUY05699.1|14205_15351_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05700.1|15340_15781_+	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	2.6e-11
AUY05701.1|15784_17500_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AUY05702.1|17496_17994_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AUY05703.1|17971_18937_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AUY05704.1|18961_20113_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
AUY05705.1|20957_21953_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	2.4e-20
AUY05706.1|21886_22069_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05707.1|22059_22764_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05708.1|23385_24090_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05709.1|27305_27617_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
AUY05710.1|27613_28033_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
AUY05792.1|28069_28279_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05711.1|29018_29723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
AUY05712.1|31618_31954_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05713.1|31962_32154_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUY05714.1|32229_33255_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUY05715.1|33549_34518_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	6.9e-182
AUY05716.1|34563_35241_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUY05717.1|35472_36297_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUY05718.1|36293_37556_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUY05719.1|37709_38510_-	histidine utilization repressor	NA	NA	NA	NA	NA
AUY05720.1|38751_40125_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUY05721.1|40121_40718_+	HutD family protein	NA	NA	NA	NA	NA
AUY05722.1|40956_41943_+	ABC transporter permease	NA	NA	NA	NA	NA
AUY05723.1|41954_42836_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
AUY05724.1|42835_43621_+	sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
AUY05725.1|43735_45286_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
AUY05726.1|45329_47012_+	urocanate hydratase	NA	NA	NA	NA	NA
AUY05727.1|47070_48237_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
AUY05728.1|48233_49391_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AUY05729.1|49424_50510_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUY05730.1|50964_51945_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
AUY05731.1|51983_52151_-	ABC transporter	NA	NA	NA	NA	NA
AUY05793.1|52092_53049_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05794.1|53446_53533_+	ABC transporter	NA	NA	NA	NA	NA
AUY05732.1|53571_54552_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUY05733.1|54829_55111_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUY05734.1|55091_55421_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AUY05735.1|56117_57500_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	9.4e-15
AUY05736.1|58223_58928_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05737.1|59155_59416_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUY05738.1|59415_59727_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY05739.1|59750_62831_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUY05740.1|63131_63596_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AUY05741.1|63592_63697_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05742.1|64918_65623_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05743.1|66042_66747_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP026403	Escherichia coli strain ECONIH4 plasmid pECO-816c, complete sequence	103161	18666	26451	103161	integrase	Escherichia_phage(28.57%)	10	10252:10266	32414:32428
10252:10266	attL	CTGGTCCGGTATCTG	NA	NA	NA	NA
AUY05582.1|18666_19458_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
AUY05583.1|19595_19871_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUY05584.1|19864_20509_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AUY05585.1|20737_21709_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AUY05586.1|21677_22106_+	plasmid stability protein	NA	NA	NA	NA	NA
AUY05587.1|22110_23382_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
AUY05588.1|23381_23819_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.2	1.9e-25
AUY05589.1|23815_24064_-	DinI family protein	NA	Q2A098	Sodalis_phage	48.0	3.2e-14
AUY05678.1|24174_24444_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05590.1|25767_26451_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.9e-29
32414:32428	attR	CTGGTCCGGTATCTG	NA	NA	NA	NA
>prophage 1
CP026405	Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence	186884	34417	82646	186884	integrase,transposase	Escherichia_phage(33.33%)	51	54497:54513	81559:81575
AUY05848.1|34417_37498_-|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUY05849.1|37521_37833_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUY05850.1|37832_38093_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUY05851.1|38184_38418_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05852.1|38529_39234_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05853.1|39762_40614_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
AUY05854.1|40543_40723_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05855.1|40741_41242_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUY05856.1|41366_42977_-|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY06021.1|43184_43967_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AUY05857.1|43956_45480_-|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AUY05858.1|45602_47147_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AUY05859.1|47197_48058_-|transposase	transposase	transposase	NA	NA	NA	NA
AUY05860.1|48060_49776_-|transposase	transposase	transposase	NA	NA	NA	NA
AUY05861.1|49814_50522_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AUY05862.1|50518_50755_-	mercury resistance protein	NA	NA	NA	NA	NA
AUY05863.1|50751_51114_-	transcriptional regulator	NA	NA	NA	NA	NA
AUY05864.1|51131_52826_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AUY05865.1|52864_53290_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUY05866.1|53317_53593_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUY05867.1|53608_53974_-	mercuric transport protein	NA	NA	NA	NA	NA
AUY05868.1|54045_54501_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
54497:54513	attL	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
AUY05869.1|55847_56120_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05870.1|56378_56714_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05871.1|56880_57333_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05872.1|57348_57951_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05873.1|58173_58494_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05874.1|58512_58800_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05875.1|58792_59329_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05876.1|59331_60342_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AUY05877.1|60346_61216_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AUY05878.1|61212_61704_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05879.1|62030_62906_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AUY05880.1|63252_63957_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05881.1|64067_65678_-|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUY05882.1|65774_66692_-	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUY05883.1|66747_68223_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUY05884.1|68636_69341_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY05885.1|69517_70282_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUY05886.1|70347_70527_+	hypothetical protein	NA	NA	NA	NA	NA
AUY05887.1|70456_71296_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUY05888.1|71495_72152_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AUY05889.1|72484_74026_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUY05890.1|74430_75270_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUY05891.1|75263_75611_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUY06022.1|75774_76566_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUY05892.1|76711_77725_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUY05893.1|77669_77993_+|transposase	transposase	transposase	NA	NA	NA	NA
AUY05894.1|78030_78588_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUY05895.1|78590_81563_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUY05896.1|81641_82646_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
81559:81575	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 2
CP026405	Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence	186884	149151	183952	186884	head,tail,transposase	Acidithiobacillus_phage(26.67%)	51	NA	NA
AUY05965.1|149151_149769_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AUY05966.1|149862_150081_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05967.1|150286_150943_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05968.1|150942_152370_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AUY05969.1|152373_152874_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AUY05970.1|152882_153215_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06025.1|153199_153631_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05971.1|153698_154373_-	thymidylate kinase	NA	NA	NA	NA	NA
AUY05972.1|154347_154629_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05973.1|154621_154999_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AUY05974.1|155552_156188_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AUY05975.1|156240_156513_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05976.1|156561_157743_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AUY05977.1|157746_158532_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AUY05978.1|158705_159017_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05979.1|158998_159448_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05980.1|159461_160496_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
AUY05981.1|160740_162282_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
AUY05982.1|162296_163052_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
AUY05983.1|163111_163324_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05984.1|163316_163679_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05985.1|163681_163924_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05986.1|163923_164175_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05987.1|164161_164359_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05988.1|164358_165297_-	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
AUY05989.1|165413_165959_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05990.1|165961_166531_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05991.1|166542_166761_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05992.1|166825_167107_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05993.1|167099_167528_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05994.1|167524_167872_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05995.1|168095_168932_-|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUY05996.1|169678_170254_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AUY06026.1|170380_170629_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AUY05997.1|171350_172298_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUY05998.1|172341_172530_-	hypothetical protein	NA	NA	NA	NA	NA
AUY05999.1|172460_172820_-	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
AUY06000.1|172846_173641_-	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
AUY06001.1|173654_173969_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06002.1|174206_175043_+|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUY06003.1|175050_176049_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06004.1|176042_176237_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06005.1|176285_176678_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06006.1|176682_177012_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06007.1|177167_178631_-	ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
AUY06008.1|178704_179637_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06009.1|179831_180095_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06010.1|180198_180696_-	hypothetical protein	NA	NA	NA	NA	NA
AUY06011.1|180698_181160_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AUY06012.1|181656_182397_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	45.8	1.4e-52
AUY06013.1|182386_183952_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	36.6	1.1e-83
