The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	389333	457332	5246201	plate,tRNA,protease,integrase	Vibrio_phage(40.0%)	60	409776:409794	438101:438119
AUZ63277.1|389333_389834_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AUZ63278.1|389925_390633_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AUZ63279.1|390712_391444_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUZ63280.1|391456_392404_+	glutathione synthase	NA	NA	NA	NA	NA
AUZ63281.1|392578_393142_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AUZ63282.1|393141_393558_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUZ63283.1|393571_394552_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUZ63284.1|394569_395274_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUZ63285.1|395292_395859_+	YggT family protein	NA	NA	NA	NA	NA
AUZ63286.1|395855_396146_+	YggU family protein	NA	NA	NA	NA	NA
AUZ63287.1|396153_396747_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AUZ63288.1|396739_397876_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUZ63289.1|397907_398915_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
AUZ63290.1|399048_400095_-	L-asparaginase 2	NA	NA	NA	NA	NA
AUZ63291.1|400284_401004_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AUZ63292.1|401056_401383_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUZ63293.1|401382_402102_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUZ63294.1|402164_402311_+	adenine glycosylase	NA	NA	NA	NA	NA
AUZ63295.1|402264_403317_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AUZ63296.1|403344_403620_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AUZ63297.1|403693_404776_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AUZ63298.1|404988_406245_+	nucleoside permease	NA	NA	NA	NA	NA
AUZ63299.1|406340_408476_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AUZ63300.1|408903_409611_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
409776:409794	attL	TCCGAGTCCGGGCACCACT	NA	NA	NA	NA
AUZ63301.1|409974_411246_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	36.3	5.3e-73
AUZ63302.1|411254_411578_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ63303.1|411618_413097_-	relaxase	NA	NA	NA	NA	NA
AUZ63304.1|413093_413465_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUZ63305.1|413451_413712_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63306.1|414257_414962_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ63307.1|415101_415281_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63308.1|415911_416115_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.6	8.0e-08
AUZ63309.1|416645_417905_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	43.6	1.9e-83
AUZ63310.1|418078_418984_-	DNA-binding protein	NA	NA	NA	NA	NA
AUZ63311.1|419362_419596_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63312.1|419623_419809_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63313.1|419843_420065_-	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	62.7	6.1e-17
AUZ63314.1|420061_420523_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63315.1|420964_422935_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUZ63316.1|423089_423707_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ63317.1|423706_424774_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AUZ63318.1|424957_427285_+	ATPase	NA	NA	NA	NA	NA
AUZ63319.1|427288_428605_+	ATP-binding protein	NA	NA	NA	NA	NA
AUZ63320.1|428601_430800_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUZ63321.1|430811_435506_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ67670.1|437404_437734_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ63322.1|438565_438901_-	hypothetical protein	NA	NA	NA	NA	NA
438101:438119	attR	TCCGAGTCCGGGCACCACT	NA	NA	NA	NA
AUZ63323.1|438903_439767_-	flagellar biosynthesis protein FlgJ	NA	NA	NA	NA	NA
AUZ63324.1|439798_440278_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUZ63325.1|441650_445112_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUZ63326.1|445187_446615_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUZ63327.1|446618_447362_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUZ63328.1|447358_450049_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.0	4.4e-85
AUZ67671.1|450059_450800_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63329.1|450882_452226_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUZ67672.1|452228_452735_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUZ63330.1|452758_454057_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUZ63331.1|454061_455105_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUZ63332.1|455071_456904_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUZ63333.1|456909_457332_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	703248	710927	5246201		Pseudoalteromonas_phage(16.67%)	10	NA	NA
AUZ63552.1|703248_704226_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.3	4.3e-06
AUZ63553.1|704240_705227_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	5.1e-39
AUZ63554.1|705247_705814_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	5.0e-55
AUZ63555.1|705810_706386_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUZ63556.1|706354_706909_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUZ63557.1|706915_707641_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.9e-22
AUZ63558.1|707688_709122_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUZ63559.1|709144_709432_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
AUZ63560.1|709547_710039_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUZ63561.1|710072_710927_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 3
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	984740	994433	5246201	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
AUZ63823.1|984740_987479_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.3e-20
AUZ63824.1|987475_988543_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ63825.1|988901_989309_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
AUZ63826.1|989305_989656_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
AUZ63827.1|989686_991279_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
AUZ63828.1|991703_992138_-	copper-binding protein	NA	NA	NA	NA	NA
AUZ63829.1|992355_993756_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AUZ63830.1|993752_994433_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 4
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	1729020	1748230	5246201	tRNA,transposase,integrase,holin	Bacteriophage(25.0%)	20	1724153:1724167	1752539:1752553
1724153:1724167	attL	GGCGCTGGCACGTAA	NA	NA	NA	NA
AUZ64446.1|1729020_1730430_-	hypothetical protein	NA	Q3LZN8	Bacteriophage	74.7	2.0e-214
AUZ64447.1|1730556_1730859_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.5e-26
AUZ64448.1|1730863_1731052_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ64449.1|1731048_1731339_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ64450.1|1731331_1731550_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ64451.1|1731555_1732542_-	hypothetical protein	NA	B6SD65	Bacteriophage	68.9	1.3e-130
AUZ64452.1|1733277_1734801_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUZ64453.1|1735094_1735505_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ64454.1|1735896_1737048_-|transposase	IS30-like element IS30H family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.7e-41
AUZ64455.1|1737004_1737361_-	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	2.6e-33
AUZ64456.1|1738881_1739361_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ64457.1|1740186_1741563_-	hypothetical protein	NA	A0A1R3Y5Q6	Salmonella_virus	45.5	6.6e-85
AUZ64458.1|1741783_1742014_+|holin	holin	holin	A5LH82	Enterobacteria_phage	65.2	3.3e-18
AUZ64459.1|1741994_1742525_+	lysozyme	NA	H6WRZ4	Salmonella_phage	80.9	8.4e-81
AUZ64460.1|1742521_1742896_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.2	6.7e-16
AUZ64461.1|1742988_1744077_-|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	70.3	1.3e-147
AUZ64462.1|1744167_1745205_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUZ64463.1|1745338_1745581_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AUZ64464.1|1745766_1746750_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AUZ64465.1|1746814_1748230_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	77.5	1.6e-198
1752539:1752553	attR	TTACGTGCCAGCGCC	NA	NA	NA	NA
>prophage 5
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	2398376	2407967	5246201	transposase	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
AUZ65045.1|2398376_2399138_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	9.0e-60
AUZ65046.1|2399131_2399758_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.3	1.5e-36
AUZ65047.1|2399896_2401024_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.9e-06
AUZ65048.1|2401902_2404911_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.0	0.0e+00
AUZ65049.1|2405074_2405641_+	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
AUZ65050.1|2405668_2406376_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65051.1|2406416_2407031_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65052.1|2407199_2407967_+	DUF1883 domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	41.9	1.6e-27
>prophage 6
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	2978236	3027935	5246201	transposase,integrase,holin,capsid,tail,terminase,portal,head	Cronobacter_phage(67.5%)	60	2975601:2975615	3018331:3018345
2975601:2975615	attL	CAGTTCTTTTGCTAC	NA	NA	NA	NA
AUZ65522.1|2978236_2978752_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	36.0	8.3e-17
AUZ65523.1|2978816_2980403_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUZ65524.1|2980680_2980809_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
AUZ65525.1|2980976_2982017_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	62.9	8.1e-120
AUZ65526.1|2982018_2982597_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	40.1	2.8e-29
AUZ65527.1|2982716_2982938_+	regulator	NA	NA	NA	NA	NA
AUZ65528.1|2982968_2983472_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.1e-58
AUZ65529.1|2983481_2983709_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65530.1|2983698_2984127_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	53.3	3.3e-27
AUZ65531.1|2984126_2984528_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	67.7	7.6e-50
AUZ65532.1|2984595_2984829_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65533.1|2984819_2985416_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	76.2	8.6e-82
AUZ65534.1|2985412_2985742_+	hypothetical protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
AUZ65535.1|2985731_2986592_+	adenine methylase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
AUZ65536.1|2986588_2988610_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	73.9	4.4e-295
AUZ65537.1|2988729_2989950_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AUZ65538.1|2990053_2990260_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65539.1|2990233_2990557_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	1.4e-49
AUZ65540.1|2990553_2991615_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.5	3.8e-165
AUZ65541.1|2991611_2993387_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	84.3	1.9e-294
AUZ65542.1|2993547_2994351_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.2	4.2e-76
AUZ65543.1|2994412_2995435_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	82.1	2.1e-160
AUZ65544.1|2995436_2996138_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	68.5	3.8e-89
AUZ67781.1|2996233_2996686_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	80.7	9.7e-62
AUZ65545.1|2996682_2997189_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.7	9.5e-66
AUZ65546.1|2997185_2997893_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	2.3e-102
AUZ65547.1|2997889_2999017_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	80.8	3.8e-171
AUZ65548.1|2999013_2999469_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	70.2	1.9e-57
AUZ65549.1|2999478_2999775_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	1.8e-16
AUZ65550.1|2999771_3000113_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	92.1	9.9e-51
AUZ65551.1|3000112_3000451_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	62.3	2.4e-28
AUZ65552.1|3000422_3000611_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	75.8	5.9e-21
AUZ65553.1|3000597_3000855_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AUZ65554.1|3001042_3003010_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.5	1.5e-271
AUZ65555.1|3003006_3003336_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	71.6	1.4e-38
AUZ65556.1|3003332_3004517_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.1	2.4e-176
AUZ65557.1|3004503_3005097_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	83.1	7.7e-91
AUZ65558.1|3005107_3006685_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.7	3.7e-132
AUZ65559.1|3006684_3007272_+|tail	phage tail protein	tail	E5G6P1	Salmonella_phage	56.0	9.4e-57
AUZ65560.1|3007261_3007987_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	52.7	1.5e-59
AUZ65561.1|3007958_3008504_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.7	5.3e-62
AUZ65562.1|3008506_3010207_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.2	5.8e-224
AUZ67782.1|3010340_3010541_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65563.1|3011699_3012173_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
AUZ65564.1|3012169_3013279_+	anion transporter	NA	NA	NA	NA	NA
AUZ65565.1|3013344_3014265_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AUZ65566.1|3014672_3014960_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65567.1|3014950_3015655_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ65568.1|3015600_3015873_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65569.1|3015877_3016294_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67783.1|3016584_3017235_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65570.1|3017241_3018357_+	tellurium resistance protein	NA	NA	NA	NA	NA
3018331:3018345	attR	GTAGCAAAAGAACTG	NA	NA	NA	NA
AUZ65571.1|3018380_3019355_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65572.1|3020161_3021287_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
AUZ65573.1|3021530_3022235_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ65574.1|3022478_3023624_+	ABC transporter permease	NA	NA	NA	NA	NA
AUZ67784.1|3023620_3024421_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
AUZ65575.1|3024422_3025361_+	MCE family protein	NA	NA	NA	NA	NA
AUZ65576.1|3025360_3026002_+	ABC transporter	NA	NA	NA	NA	NA
AUZ65577.1|3027230_3027935_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	3042570	3154649	5246201	transposase,integrase,holin,capsid,tail,terminase,portal,protease,head	Cronobacter_phage(50.0%)	117	3055130:3055150	3124680:3124700
AUZ65600.1|3042570_3043275_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ65601.1|3043413_3043875_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65602.1|3043934_3044087_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	82.0	8.7e-15
AUZ65603.1|3044829_3045408_+	resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	36.2	1.6e-16
AUZ65604.1|3045892_3046072_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65605.1|3046255_3046978_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65606.1|3047088_3047793_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ65607.1|3048863_3049793_-	glycosyltransferase	NA	U5P087	Shigella_phage	86.5	7.7e-154
AUZ65608.1|3049789_3050152_-	translocase	NA	F1C5B1	Cronobacter_phage	70.8	3.6e-43
AUZ65609.1|3051380_3051749_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65610.1|3051738_3052584_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65611.1|3053081_3054569_-	recombinase family protein	NA	NA	NA	NA	NA
AUZ65612.1|3054603_3056199_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.5e-60
3055130:3055150	attL	TTCTGCTGCTCGACGAACCGA	NA	NA	NA	NA
AUZ65613.1|3056224_3056446_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65614.1|3056380_3058759_-	alpha-glucosidase	NA	NA	NA	NA	NA
AUZ65615.1|3058761_3060063_-	MFS transporter	NA	NA	NA	NA	NA
AUZ65616.1|3060348_3061422_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUZ65617.1|3061418_3062681_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AUZ65618.1|3062829_3063645_-	sugar-phosphatase	NA	NA	NA	NA	NA
AUZ65619.1|3063791_3066224_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
AUZ65620.1|3066228_3067128_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AUZ65621.1|3067259_3067922_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.4	2.5e-26
AUZ65622.1|3068010_3068769_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AUZ65623.1|3068768_3070004_-	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AUZ65624.1|3070188_3071154_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUZ65625.1|3071140_3073012_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.0	4.4e-15
AUZ65626.1|3073040_3074579_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUZ65627.1|3074596_3075517_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUZ65628.1|3075519_3076431_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUZ65629.1|3076518_3077844_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AUZ65630.1|3078074_3078458_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ65631.1|3078563_3079679_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AUZ65632.1|3079684_3080311_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AUZ67787.1|3080558_3081761_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	9.1e-99
AUZ65633.1|3081809_3082568_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.1	1.1e-12
AUZ65634.1|3082639_3083248_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AUZ65635.1|3083541_3084774_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AUZ65636.1|3084870_3085683_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUZ65637.1|3085683_3086892_-	MFS transporter	NA	NA	NA	NA	NA
AUZ65638.1|3086973_3087513_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUZ65639.1|3087738_3088788_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.7e-104
AUZ65640.1|3088864_3089485_-	CI repressor	NA	A0A1S6KZZ7	Salmonella_phage	35.4	1.3e-29
AUZ65641.1|3089620_3089842_+	regulator	NA	NA	NA	NA	NA
AUZ65642.1|3089874_3090378_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	64.7	1.2e-52
AUZ65643.1|3090387_3090615_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65644.1|3090604_3091045_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	48.4	1.1e-22
AUZ65645.1|3091041_3091443_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	65.2	1.5e-45
AUZ65646.1|3091507_3091741_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ67788.1|3091879_3092209_+	hypothetical protein	NA	C9E2N9	Enterococcus_phage	46.8	2.0e-11
AUZ65647.1|3092198_3093002_+	adenine methylase	NA	F1BUN1	Cronobacter_phage	65.6	3.1e-95
AUZ65648.1|3092998_3095023_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	72.2	4.0e-288
AUZ65649.1|3095142_3095361_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65650.1|3095334_3095658_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	84.6	5.3e-46
AUZ65651.1|3095654_3096704_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.3	3.6e-160
AUZ65652.1|3096700_3098476_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	89.5	1.9e-294
AUZ65653.1|3098648_3099449_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	53.4	2.0e-65
AUZ65654.1|3099509_3100532_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	84.1	3.2e-161
AUZ65655.1|3100535_3101237_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	65.1	5.3e-83
AUZ65656.1|3101334_3101787_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	80.7	4.4e-62
AUZ65657.1|3101783_3102296_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	64.8	3.5e-60
AUZ65658.1|3102292_3103000_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	2.2e-100
AUZ65659.1|3102996_3104124_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	79.5	9.3e-170
AUZ65660.1|3104120_3104576_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	3.3e-57
AUZ65661.1|3104585_3104879_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	55.8	7.8e-20
AUZ65662.1|3104875_3105217_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	92.1	1.5e-51
AUZ65663.1|3105216_3105549_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	73.6	2.7e-37
AUZ67789.1|3105475_3105709_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	87.0	3.7e-33
AUZ65664.1|3105695_3105953_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	65.9	2.5e-22
AUZ65665.1|3106140_3108021_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	65.5	2.4e-247
AUZ65666.1|3108020_3108350_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.5	1.2e-37
AUZ65667.1|3108346_3109531_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	75.1	4.8e-169
AUZ65668.1|3109523_3110111_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	76.9	5.1e-87
AUZ65669.1|3110120_3111722_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	74.4	8.1e-127
AUZ67790.1|3111724_3112165_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.7	2.1e-24
AUZ65670.1|3112154_3112880_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	55.6	6.1e-66
AUZ65671.1|3112851_3113397_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.3	2.4e-59
AUZ65672.1|3113399_3115079_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	68.0	2.4e-198
AUZ67791.1|3115242_3115461_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65673.1|3115603_3116101_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65674.1|3116243_3117020_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65675.1|3117266_3118952_-	transporter	NA	NA	NA	NA	NA
AUZ65676.1|3119220_3119598_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65677.1|3119637_3119901_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	3.5e-27
AUZ65678.1|3120073_3120361_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65679.1|3120344_3121067_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUZ65680.1|3121127_3122030_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.4e-37
AUZ65681.1|3122120_3122597_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUZ65682.1|3122961_3124074_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AUZ65683.1|3124171_3125305_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
3124680:3124700	attR	TTCTGCTGCTCGACGAACCGA	NA	NA	NA	NA
AUZ65684.1|3125314_3126268_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUZ65685.1|3126264_3127110_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUZ65686.1|3127169_3127658_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUZ65687.1|3127698_3128844_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.7	7.3e-29
AUZ65688.1|3128938_3129670_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ65689.1|3129839_3130508_-	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
AUZ65690.1|3130507_3131224_-	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
AUZ65691.1|3131230_3131962_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ65692.1|3131978_3132707_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.9	5.1e-28
AUZ65693.1|3132936_3133452_-	lipoprotein	NA	NA	NA	NA	NA
AUZ65694.1|3133580_3133904_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65695.1|3133900_3134731_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.8	6.7e-08
AUZ65696.1|3134727_3135741_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUZ65697.1|3135833_3137270_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AUZ65698.1|3137280_3138282_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUZ65699.1|3138320_3140039_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	9.9e-30
AUZ65700.1|3140190_3140625_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ65701.1|3140657_3141626_-	NADH oxidoreductase	NA	NA	NA	NA	NA
AUZ65702.1|3141636_3143289_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AUZ65703.1|3143432_3144332_-	DUF340 domain-containing protein	NA	NA	NA	NA	NA
AUZ67792.1|3144478_3145174_-	aquaporin Z	NA	NA	NA	NA	NA
AUZ65704.1|3145587_3147246_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUZ67793.1|3147242_3148193_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUZ67794.1|3148344_3149457_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
AUZ65705.1|3149453_3151400_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.3	5.9e-39
AUZ65706.1|3151475_3151697_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AUZ65707.1|3152020_3152341_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
AUZ65708.1|3152372_3154649_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	1.1e-166
>prophage 8
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	3188456	3301290	5246201	transposase,tRNA,holin,integrase,capsid,tail,terminase,portal,protease,head	Enterobacteria_phage(31.15%)	119	3294671:3294730	3308973:3309039
AUZ65732.1|3188456_3189218_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUZ65733.1|3189390_3190074_+	cytidylate kinase	NA	NA	NA	NA	NA
AUZ65734.1|3190187_3191861_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUZ65735.1|3192008_3192293_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	7.1e-10
AUZ65736.1|3192497_3194762_+	ComEC family protein	NA	NA	NA	NA	NA
AUZ65737.1|3194798_3196547_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	6.4e-61
AUZ65738.1|3196543_3197521_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUZ65739.1|3197562_3198795_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUZ65740.1|3198846_3199029_+	protein YcaR	NA	NA	NA	NA	NA
AUZ65741.1|3199025_3199772_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUZ65742.1|3199924_3200818_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65743.1|3200794_3201574_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AUZ65744.1|3201709_3202489_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUZ65745.1|3202492_3203815_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUZ65746.1|3203795_3204500_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AUZ65747.1|3204499_3208960_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUZ65748.1|3209132_3210983_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUZ65749.1|3211159_3211708_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	4.1e-06
AUZ65750.1|3211727_3212375_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65751.1|3212424_3213615_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUZ65752.1|3215507_3216917_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	2.4e-82
AUZ65753.1|3217079_3218282_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUZ65754.1|3218476_3219769_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	94.4	2.8e-239
AUZ65755.1|3219813_3220062_-	excisionase	NA	S4TND0	Salmonella_phage	83.8	3.2e-35
AUZ65756.1|3220208_3220571_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65757.1|3220570_3221032_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	52.2	1.9e-44
AUZ65758.1|3221028_3221253_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	66.7	3.3e-18
AUZ65759.1|3221249_3222080_-	DNA-binding protein	NA	A0A2L1IV39	Escherichia_phage	68.7	2.3e-32
AUZ65760.1|3222091_3222670_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	60.5	7.8e-64
AUZ65761.1|3222666_3223074_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	52.9	2.2e-28
AUZ65762.1|3223518_3223875_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	7.0e-23
AUZ65763.1|3223864_3224065_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65764.1|3224252_3224675_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	54.1	1.5e-08
AUZ65765.1|3224671_3224875_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65766.1|3225247_3225955_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.5	3.3e-96
AUZ65767.1|3226068_3226287_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65768.1|3226411_3226732_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65769.1|3227072_3227930_+	hypothetical protein	NA	Q8W644	Enterobacteria_phage	70.7	7.5e-63
AUZ65770.1|3227926_3228742_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	66.3	1.2e-89
AUZ65771.1|3228756_3229638_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	61.6	2.6e-79
AUZ65772.1|3229634_3231017_+	helicase	NA	Q8W640	Enterobacteria_phage	68.4	3.4e-174
AUZ65773.1|3231003_3231369_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.3	1.8e-37
AUZ65774.1|3231368_3232184_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.1	5.2e-114
AUZ65775.1|3232339_3232597_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	76.5	1.9e-30
AUZ65776.1|3232514_3232961_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65777.1|3233181_3233505_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	84.5	3.6e-42
AUZ65778.1|3233488_3233938_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	3.2e-65
AUZ65779.1|3233934_3234465_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.0	8.0e-07
AUZ65780.1|3234819_3235020_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	8.4e-18
AUZ65781.1|3235079_3235415_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	64.0	1.6e-37
AUZ65782.1|3235550_3236102_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	41.5	5.2e-33
AUZ65783.1|3236115_3236643_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	54.7	4.0e-06
AUZ65784.1|3236658_3236886_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65785.1|3236905_3238363_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	82.9	2.8e-243
AUZ65786.1|3238347_3238935_+	hypothetical protein	NA	S4TR53	Salmonella_phage	77.8	1.1e-89
AUZ65787.1|3238934_3239291_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.1	1.7e-48
AUZ65788.1|3239419_3239956_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65789.1|3240111_3240609_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	84.8	4.2e-74
AUZ65790.1|3240608_3242345_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
AUZ65791.1|3242344_3243649_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.0	2.5e-235
AUZ65792.1|3243662_3244511_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	91.8	1.8e-138
AUZ65793.1|3244520_3245729_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.2	6.2e-196
AUZ65794.1|3245771_3246098_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	88.9	6.6e-52
AUZ65795.1|3246161_3246374_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	62.9	9.6e-12
AUZ65796.1|3246375_3246708_+|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	93.6	6.5e-55
AUZ65797.1|3246700_3247240_+	hypothetical protein	NA	K7PM60	Enterobacteria_phage	91.1	5.2e-86
AUZ65798.1|3247236_3247602_+	hypothetical protein	NA	A0A286S1R1	Klebsiella_phage	71.9	7.6e-49
AUZ65799.1|3247660_3248158_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	71.9	1.1e-63
AUZ65800.1|3248210_3248591_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	77.1	4.5e-44
AUZ65801.1|3248575_3248878_+|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	62.2	7.2e-29
AUZ65802.1|3248945_3249233_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65803.1|3250171_3251152_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUZ65804.1|3252950_3253544_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	86.8	1.1e-100
AUZ65805.1|3253543_3254128_+	hypothetical protein	NA	S4TND4	Salmonella_phage	88.1	1.2e-96
AUZ65806.1|3254134_3254533_+	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	2.1e-60
AUZ65807.1|3254532_3257244_+|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	84.9	0.0e+00
AUZ65808.1|3257251_3258208_+	hypothetical protein	NA	I6S634	Salmonella_phage	61.9	1.4e-105
AUZ65809.1|3259116_3259734_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUZ65810.1|3259863_3260103_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	88.6	1.9e-32
AUZ65811.1|3260531_3263144_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.7	5.3e-19
AUZ65812.1|3263249_3264017_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.4e-30
AUZ65813.1|3264013_3264805_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AUZ65814.1|3264816_3265962_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AUZ65815.1|3265958_3266933_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ65816.1|3266925_3267501_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUZ65817.1|3267744_3268755_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUZ65818.1|3268934_3269477_+	cell division protein ZapC	NA	NA	NA	NA	NA
AUZ65819.1|3269473_3270583_-	MOSC domain-containing protein	NA	E3SNZ1	Prochlorococcus_phage	36.0	1.9e-05
AUZ65820.1|3270680_3272789_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AUZ65821.1|3272801_3274709_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	2.9e-54
AUZ65822.1|3274723_3275977_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUZ65823.1|3275981_3277622_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUZ65824.1|3277618_3278182_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65825.1|3278439_3278607_+	ribosome modulation factor	NA	NA	NA	NA	NA
AUZ65826.1|3278702_3279221_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AUZ65827.1|3279289_3281050_-|protease	Lon protease	protease	NA	NA	NA	NA
AUZ65828.1|3281235_3281688_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AUZ65829.1|3281764_3282877_-	porin OmpA	NA	NA	NA	NA	NA
AUZ65830.1|3283175_3283685_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AUZ65831.1|3283902_3284532_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUZ65832.1|3284485_3286648_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AUZ65833.1|3286654_3287113_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AUZ65834.1|3287236_3289291_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	3.2e-19
AUZ65835.1|3289322_3289781_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUZ65836.1|3289873_3290536_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AUZ65837.1|3290708_3291122_+	CoA-binding protein	NA	NA	NA	NA	NA
AUZ65838.1|3291190_3291508_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AUZ65839.1|3291565_3292756_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AUZ65840.1|3292850_3293132_+	acylphosphatase	NA	NA	NA	NA	NA
AUZ65841.1|3293128_3293458_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AUZ65842.1|3293708_3294368_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
3294671:3294730	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
AUZ65843.1|3294835_3295855_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.7	1.3e-93
AUZ65844.1|3295855_3296080_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUZ65845.1|3296045_3296243_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
AUZ65846.1|3296292_3296475_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ65847.1|3296476_3297031_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.0	2.8e-50
AUZ67797.1|3298942_3299476_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65848.1|3299488_3299899_+	hypothetical protein	NA	Q7Y4D3	Escherichia_virus	47.9	3.1e-14
AUZ65849.1|3300069_3301290_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
3308973:3309039	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAA	NA	NA	NA	NA
>prophage 9
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	3329518	3362369	5246201	plate,transposase,tail,head	Vibrio_phage(67.65%)	45	NA	NA
AUZ65873.1|3329518_3329755_+	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	58.7	1.9e-13
AUZ65874.1|3329755_3331741_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	51.7	6.0e-188
AUZ65875.1|3331819_3332758_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	48.7	1.3e-76
AUZ65876.1|3332762_3333002_+	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	55.4	2.8e-15
AUZ65877.1|3333004_3333256_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65878.1|3333263_3333791_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.7	3.7e-44
AUZ65879.1|3334486_3334708_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65880.1|3334704_3335232_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	48.1	3.8e-41
AUZ65881.1|3335228_3335639_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	1.8e-38
AUZ65882.1|3335642_3336152_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65883.1|3336262_3336853_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	45.1	7.0e-36
AUZ65884.1|3336854_3337073_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	72.2	3.2e-26
AUZ65885.1|3337065_3337473_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65886.1|3337460_3338069_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65887.1|3338065_3338272_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUZ65888.1|3338272_3338578_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	36.2	1.3e-12
AUZ65889.1|3338589_3338877_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	1.1e-26
AUZ65890.1|3338879_3339257_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65891.1|3339246_3339519_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65892.1|3339508_3340087_+	hypothetical protein	NA	M4MCR3	Vibrio_phage	51.8	6.4e-42
AUZ65893.1|3340083_3341667_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	7.8e-199
AUZ65894.1|3341666_3343235_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	54.8	8.1e-156
AUZ65895.1|3343227_3344022_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.5	3.9e-90
AUZ65896.1|3344225_3345182_+	peptidase	NA	M1Q578	Vibrio_phage	51.4	1.4e-81
AUZ65897.1|3345185_3346079_+|head	phage head protein	head	M4MB71	Vibrio_phage	55.4	1.5e-93
AUZ65898.1|3346162_3346765_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65899.1|3346764_3347205_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	48.6	4.9e-34
AUZ65900.1|3347204_3347747_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	60.3	2.1e-55
AUZ65901.1|3347743_3348355_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	43.5	8.0e-35
AUZ65902.1|3348347_3348536_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ65903.1|3348535_3350014_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	54.4	2.1e-153
AUZ65904.1|3350023_3350380_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	43.8	5.9e-22
AUZ65905.1|3350383_3350779_+	hypothetical protein	NA	M4MB64	Vibrio_phage	42.9	3.1e-19
AUZ65906.1|3350865_3352785_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	34.6	3.4e-55
AUZ65907.1|3352784_3354116_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	36.8	7.0e-76
AUZ65908.1|3354115_3355207_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	45.9	7.8e-89
AUZ65909.1|3355197_3355740_+|plate	phage baseplate protein	plate	M1Q572	Vibrio_phage	40.4	4.9e-28
AUZ65910.1|3355736_3356189_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
AUZ65911.1|3356178_3357255_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.7	3.3e-100
AUZ65912.1|3357239_3357830_+	hypothetical protein	NA	M1NVS6	Vibrio_phage	51.3	1.6e-51
AUZ65913.1|3358499_3358916_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	50.0	8.5e-12
AUZ65914.1|3358887_3359313_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	38.0	4.0e-17
AUZ65915.1|3359732_3360287_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	83.5	4.4e-80
AUZ67800.1|3360949_3361210_+	acyl carrier protein	NA	NA	NA	NA	NA
AUZ65916.1|3361196_3362369_+	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	29.2	1.7e-36
>prophage 10
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	4109024	4173237	5246201	transposase,tail,plate,protease,head	Shigella_phage(46.51%)	80	NA	NA
AUZ66584.1|4109024_4110101_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUZ66585.1|4110075_4110312_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AUZ66586.1|4110515_4111250_+	flagellar brake protein	NA	NA	NA	NA	NA
AUZ66587.1|4111250_4111862_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
AUZ66588.1|4112000_4112915_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
AUZ66589.1|4113012_4114749_+	potassium/proton antiporter	NA	NA	NA	NA	NA
AUZ66590.1|4114858_4115929_-	alanine racemase	NA	NA	NA	NA	NA
AUZ66591.1|4115941_4117240_-	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUZ66592.1|4117568_4119101_+	SpoVR family protein	NA	NA	NA	NA	NA
AUZ66593.1|4119134_4119854_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AUZ66594.1|4120076_4121621_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
AUZ66595.1|4121762_4122293_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AUZ66596.1|4122516_4122978_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUZ66597.1|4123055_4123715_-	isomerase/hydrolase	NA	NA	NA	NA	NA
AUZ66598.1|4123783_4124077_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66599.1|4124203_4124911_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUZ66600.1|4124934_4125747_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUZ66601.1|4125750_4126017_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUZ66602.1|4126121_4126922_-	aminoglycoside nucleotidyltransferase ANT9	NA	NA	NA	NA	NA
AUZ66603.1|4126999_4127650_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUZ66604.1|4127815_4128244_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	47.9	1.6e-26
AUZ66605.1|4128273_4129134_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ66606.1|4129325_4130210_+	SED family class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	70.6	7.4e-106
AUZ66607.1|4130522_4131152_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ66608.1|4131204_4132185_-	serine dehydratase	NA	NA	NA	NA	NA
AUZ66609.1|4132216_4132606_-	RidA family protein	NA	NA	NA	NA	NA
AUZ66610.1|4132834_4133671_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUZ66611.1|4133735_4135001_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.5	3.8e-204
AUZ66612.1|4135390_4135810_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	2.2e-36
AUZ66613.1|4136063_4136246_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AUZ66614.1|4136248_4136611_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AUZ66615.1|4136778_4138056_-	hypothetical protein	NA	A0A1R3Y5Q6	Salmonella_virus	38.1	4.2e-09
AUZ66616.1|4138256_4138835_-	DNA-invertase	NA	K7PJT4	Enterobacteria_phage	72.0	8.3e-74
AUZ66617.1|4139335_4139710_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	51.2	5.3e-13
AUZ66618.1|4139681_4140113_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	43.4	1.3e-23
AUZ66619.1|4140114_4140873_-	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	45.5	1.2e-16
AUZ66620.1|4140885_4141470_-	hypothetical protein	NA	C9DGQ7	Escherichia_phage	40.6	3.8e-34
AUZ66621.1|4141460_4142543_-	hypothetical protein	NA	C9DGQ6	Escherichia_phage	57.1	2.0e-113
AUZ66622.1|4142544_4142982_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	68.3	6.8e-52
AUZ67841.1|4142978_4143530_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	63.9	8.5e-60
AUZ66623.1|4143565_4144699_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	68.2	2.2e-142
AUZ66624.1|4144691_4146119_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	45.7	2.2e-91
AUZ66625.1|4146130_4148164_-	hypothetical protein	NA	C9DGQ1	Escherichia_phage	49.1	8.7e-126
AUZ66626.1|4148293_4148749_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	62.0	7.3e-41
AUZ66627.1|4148758_4149115_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	72.0	3.2e-44
AUZ66628.1|4149124_4150639_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	66.3	3.3e-186
AUZ66629.1|4150635_4150887_-	hypothetical protein	NA	A0A0C4UR31	Shigella_phage	54.5	6.2e-10
AUZ66630.1|4150883_4151417_-	hypothetical protein	NA	A0A0C4UQU7	Shigella_phage	69.9	6.5e-73
AUZ66631.1|4151416_4151839_-	hypothetical protein	NA	A0A0C4UR02	Shigella_phage	62.1	4.2e-43
AUZ67842.1|4151838_4152279_-	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	52.4	3.3e-22
AUZ66632.1|4152382_4153303_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	72.5	3.1e-131
AUZ67843.1|4153299_4154415_-|protease	protease	protease	C9DGP0	Escherichia_phage	64.2	4.9e-123
AUZ66633.1|4154613_4155072_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	62.6	7.3e-49
AUZ66634.1|4155191_4156523_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	71.7	7.3e-182
AUZ66635.1|4156506_4158051_-	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	74.5	5.4e-221
AUZ66636.1|4158050_4159715_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	81.6	3.6e-263
AUZ66637.1|4159716_4160295_-	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	87.0	2.8e-85
AUZ66638.1|4160304_4160592_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	87.4	3.0e-40
AUZ66639.1|4160591_4160888_-	DUF2730 domain-containing protein	NA	C9DGN2	Escherichia_phage	68.4	1.6e-33
AUZ66640.1|4161058_4161346_-	peptidase	NA	NA	NA	NA	NA
AUZ66641.1|4161618_4162122_-	lysozyme	NA	C9DGM9	Escherichia_phage	74.1	3.5e-68
AUZ66642.1|4162236_4162656_-	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	66.7	2.6e-45
AUZ66643.1|4162727_4163162_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66644.1|4163272_4163689_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AUZ66645.1|4163671_4163989_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66646.1|4163991_4164498_-	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	46.7	4.5e-31
AUZ66647.1|4164487_4164934_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66648.1|4164933_4165740_-	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	40.0	1.1e-10
AUZ66649.1|4165736_4165985_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66650.1|4165981_4166422_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66651.1|4166418_4166901_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66652.1|4166893_4167160_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66653.1|4167243_4167861_-	sulfate transporter	NA	A0A2I7S9B0	Vibrio_phage	61.0	4.7e-67
AUZ66654.1|4167871_4168114_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67844.1|4168123_4168324_-	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	51.5	1.5e-11
AUZ66655.1|4168403_4169345_-	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	42.1	2.2e-55
AUZ67845.1|4169410_4171399_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	49.4	1.9e-165
AUZ66656.1|4171394_4171640_-	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	49.2	6.7e-09
AUZ66657.1|4171791_4172313_+	CI repressor protein	NA	A0A0A7DJB4	Pseudomonas_phage	37.8	5.3e-11
AUZ66658.1|4172619_4173237_-	hypothetical protein	NA	W6MVL2	Pseudomonas_phage	38.0	1.6e-30
>prophage 11
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	4202246	4289836	5246201	transposase,tRNA,holin,capsid,tail,terminase,portal,protease,head	Enterobacteria_phage(32.2%)	104	NA	NA
AUZ66690.1|4202246_4203128_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUZ66691.1|4203320_4205369_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.1	9.8e-85
AUZ66692.1|4205388_4206075_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUZ66693.1|4206172_4206670_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AUZ66694.1|4206800_4208084_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUZ66695.1|4208052_4210686_+	MCE family protein	NA	NA	NA	NA	NA
AUZ66696.1|4210661_4212203_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUZ66697.1|4212314_4212554_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AUZ66698.1|4212655_4212847_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUZ66699.1|4212847_4213510_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.5	9.0e-56
AUZ66700.1|4213918_4214257_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUZ66701.1|4214273_4215146_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66702.1|4215148_4215523_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUZ66703.1|4215660_4215891_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	2.9e-14
AUZ66704.1|4215999_4216662_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUZ66705.1|4216685_4217348_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	39.3	1.0e-06
AUZ66706.1|4217329_4219405_-	oligopeptidase B	NA	NA	NA	NA	NA
AUZ66707.1|4219493_4220153_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AUZ66708.1|4220247_4220601_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66709.1|4220674_4220965_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AUZ66710.1|4221025_4222246_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AUZ66711.1|4222420_4223599_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUZ66712.1|4223704_4224346_-	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AUZ66713.1|4224381_4226193_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AUZ66714.1|4226425_4227901_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	2.2e-78
AUZ66715.1|4228231_4229101_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
AUZ66716.1|4229348_4230791_+	pyruvate kinase	NA	NA	NA	NA	NA
AUZ66717.1|4230835_4231807_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUZ66718.1|4231929_4233252_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	39.1	5.8e-14
AUZ66719.1|4233267_4234227_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ66720.1|4234290_4235046_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	27.8	1.1e-17
AUZ66721.1|4235042_4235828_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUZ66722.1|4235914_4236925_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	1.3e-08
AUZ66723.1|4236933_4237545_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUZ66724.1|4237622_4238144_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AUZ66725.1|4238178_4238922_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUZ67847.1|4238950_4239403_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUZ66726.1|4239520_4241293_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUZ66727.1|4241365_4241653_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66728.1|4241558_4242125_+	hydrolase	NA	NA	NA	NA	NA
AUZ66729.1|4242490_4242730_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	87.3	4.2e-32
AUZ66730.1|4242859_4243477_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUZ66731.1|4244385_4245342_-	hypothetical protein	NA	I6S634	Salmonella_phage	61.6	4.0e-105
AUZ66732.1|4245349_4248061_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	84.3	0.0e+00
AUZ66733.1|4248060_4248459_-	hypothetical protein	NA	S4TR39	Salmonella_phage	80.3	8.9e-59
AUZ66734.1|4248465_4249050_-	hypothetical protein	NA	S4TND4	Salmonella_phage	88.7	7.1e-97
AUZ66735.1|4249049_4249643_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	87.8	9.7e-102
AUZ66736.1|4249657_4252987_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	69.4	0.0e+00
AUZ66737.1|4253045_4253459_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	49.6	4.2e-35
AUZ66738.1|4253513_4253792_-	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	87.0	8.7e-37
AUZ66739.1|4253815_4254184_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	76.9	1.8e-50
AUZ66740.1|4254194_4254638_-	hypothetical protein	NA	S4TNM8	Salmonella_phage	94.6	2.4e-73
AUZ66741.1|4254694_4255042_-	hypothetical protein	NA	K7P7Q9	Enterobacteria_phage	96.5	7.2e-57
AUZ66742.1|4255038_4255488_-	hypothetical protein	NA	K7PH84	Enterobacterial_phage	98.0	7.6e-75
AUZ66743.1|4255484_4255823_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.7e-40
AUZ66744.1|4255832_4256159_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	96.3	4.9e-55
AUZ66745.1|4256158_4256383_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	84.8	7.5e-15
AUZ66746.1|4256422_4257634_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	9.9e-194
AUZ66747.1|4257643_4258492_-	peptidase S14	NA	K7PH05	Enterobacteria_phage	92.1	5.4e-138
AUZ66748.1|4258505_4259810_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.0	2.5e-235
AUZ66749.1|4259809_4261546_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
AUZ66750.1|4261545_4262019_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	97.5	3.3e-84
AUZ66751.1|4262174_4262711_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66752.1|4262839_4263196_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.9	4.4e-49
AUZ66753.1|4263195_4263783_-	hypothetical protein	NA	S4TR53	Salmonella_phage	77.8	1.1e-89
AUZ66754.1|4263767_4265225_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	85.2	4.4e-249
AUZ66755.1|4265243_4265471_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66756.1|4266303_4266639_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	76.6	8.0e-45
AUZ66757.1|4266715_4267261_+	hypothetical protein	NA	S4TR57	Salmonella_phage	97.8	4.7e-95
AUZ66758.1|4267308_4267533_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	59.7	1.1e-18
AUZ66759.1|4267581_4267998_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66760.1|4268006_4268279_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66761.1|4268399_4268852_-	hypothetical protein	NA	H9C186	Pectobacterium_phage	79.3	3.7e-53
AUZ66762.1|4268870_4269398_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	54.5	1.2e-13
AUZ66763.1|4269394_4269844_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	3.2e-65
AUZ66764.1|4269827_4270151_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	84.5	3.6e-42
AUZ66765.1|4270371_4270818_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66766.1|4270735_4270993_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	76.5	1.9e-30
AUZ66767.1|4271148_4271964_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.1	5.2e-114
AUZ66768.1|4271963_4272329_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.3	1.8e-37
AUZ66769.1|4272315_4273698_-	helicase	NA	Q8W640	Enterobacteria_phage	69.8	6.2e-176
AUZ66770.1|4273694_4274576_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	65.7	7.2e-85
AUZ66771.1|4274590_4275532_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	71.2	9.6e-104
AUZ66772.1|4275528_4275825_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ66773.1|4275850_4276069_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66774.1|4276182_4276890_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.5	3.3e-96
AUZ66775.1|4277262_4277466_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66776.1|4278071_4278272_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66777.1|4278261_4278618_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	48.7	1.2e-22
AUZ66778.1|4278617_4278872_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	67.9	7.4e-27
AUZ66779.1|4279061_4279469_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	52.9	2.2e-28
AUZ66780.1|4279465_4280044_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	60.5	6.6e-63
AUZ66781.1|4280055_4280886_+	DNA-binding protein	NA	A0A2L1IV39	Escherichia_phage	67.3	1.9e-31
AUZ66782.1|4280882_4281107_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	68.5	8.6e-19
AUZ66783.1|4281207_4281669_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	52.4	1.5e-41
AUZ66784.1|4281824_4282061_+	excisionase	NA	Q8W657	Enterobacteria_phage	93.6	9.3e-40
AUZ66785.1|4282116_4283430_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	88.1	7.3e-227
AUZ66786.1|4283408_4284182_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	81.1	5.5e-57
AUZ66787.1|4284233_4284629_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66788.1|4284669_4285413_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	2.3e-23
AUZ66789.1|4285409_4286378_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUZ66790.1|4286545_4287292_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUZ66791.1|4287294_4287864_-	VOC family protein	NA	NA	NA	NA	NA
AUZ66792.1|4288102_4289836_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.1	6.8e-87
>prophage 12
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	4357662	4406096	5246201	integrase,tail,terminase,lysis,coat	Enterobacteria_phage(25.93%)	70	4357407:4357428	4406121:4406142
4357407:4357428	attL	ACCTAAACCTGCATGGACATCA	NA	NA	NA	NA
AUZ67852.1|4357662_4358436_-	phage antirepressor Ant	NA	H6WRU9	Salmonella_phage	78.5	3.1e-92
AUZ66856.1|4358504_4359218_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	46.5	5.1e-41
AUZ66857.1|4360014_4360197_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66858.1|4360227_4360551_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.9	1.9e-27
AUZ66859.1|4360870_4361110_+	virulence protein MsgA	NA	K7PKR6	Enterobacteria_phage	93.7	2.0e-34
AUZ66860.1|4361239_4361857_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUZ66861.1|4362765_4363722_-	hypothetical protein	NA	I6S634	Salmonella_phage	61.6	4.0e-105
AUZ66862.1|4363729_4366441_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	84.3	0.0e+00
AUZ66863.1|4366440_4366839_-	hypothetical protein	NA	S4TR39	Salmonella_phage	80.3	8.9e-59
AUZ66864.1|4366845_4367430_-	hypothetical protein	NA	S4TND4	Salmonella_phage	88.1	1.2e-96
AUZ66865.1|4367429_4368023_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	58.8	1.8e-60
AUZ66866.1|4368026_4370843_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.0	7.1e-110
AUZ66867.1|4371015_4371273_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66868.1|4371256_4371481_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66869.1|4372002_4372224_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66870.1|4372319_4372787_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66871.1|4372849_4374010_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	41.2	2.8e-60
AUZ66872.1|4374036_4374429_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUZ66873.1|4374425_4375058_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.0	7.6e-12
AUZ66874.1|4375050_4375257_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66875.1|4375256_4375640_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	42.9	1.1e-18
AUZ66876.1|4375641_4376034_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	43.8	3.2e-13
AUZ66877.1|4376037_4376346_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66878.1|4376393_4377530_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.7	2.3e-160
AUZ66879.1|4377616_4378381_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	69.3	6.9e-92
AUZ66880.1|4378485_4379598_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.8	9.0e-117
AUZ66881.1|4379584_4380988_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	73.0	6.5e-197
AUZ66882.1|4380991_4382563_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	95.0	0.0e+00
AUZ66883.1|4382559_4383210_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	90.3	3.3e-103
AUZ66884.1|4383213_4383417_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66885.1|4383525_4383990_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	61.8	3.3e-41
AUZ66886.1|4383986_4384481_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	80.2	7.8e-73
AUZ66887.1|4384452_4384656_-	hypothetical protein	NA	O80287	Bacteriophage	77.6	1.9e-25
AUZ66888.1|4385223_4385907_-	DUF1133 domain-containing protein	NA	Q8HA89	Salmonella_phage	42.2	2.3e-38
AUZ66889.1|4385903_4386491_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	50.3	1.6e-48
AUZ66890.1|4386483_4387152_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	93.2	1.0e-123
AUZ66891.1|4387148_4387319_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	60.7	1.3e-11
AUZ66892.1|4387311_4387761_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	1.8e-36
AUZ66893.1|4388127_4388385_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.8	1.1e-25
AUZ66894.1|4388394_4388595_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66895.1|4389012_4389297_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	78.0	2.1e-09
AUZ66896.1|4390116_4390347_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66897.1|4390346_4390751_-	hypothetical protein	NA	F1C5B5	Cronobacter_phage	59.2	3.5e-18
AUZ66898.1|4390747_4390993_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66899.1|4391498_4391909_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ66900.1|4391910_4392600_-	phage replication protein	NA	G8C7U6	Escherichia_phage	91.3	7.0e-120
AUZ66901.1|4392596_4393562_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	91.3	1.3e-71
AUZ66902.1|4393745_4394288_-	regulator	NA	M9NZI6	Enterobacteria_phage	91.1	3.6e-87
AUZ66903.1|4394305_4394539_-	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
AUZ67853.1|4394580_4395333_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	64.0	1.6e-72
AUZ67854.1|4395775_4396048_+	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	47.0	6.5e-13
AUZ66904.1|4396199_4397165_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	79.7	5.3e-65
AUZ66905.1|4397157_4397346_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	94.0	3.8e-20
AUZ66906.1|4397320_4397524_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	80.9	9.5e-25
AUZ66907.1|4397594_4398566_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	81.4	6.3e-66
AUZ66908.1|4398573_4398858_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	95.7	7.7e-49
AUZ66909.1|4398876_4399722_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	6.9e-69
AUZ66910.1|4399718_4400399_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	93.8	4.2e-125
AUZ66911.1|4400859_4401411_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.1	9.1e-54
AUZ66912.1|4401407_4401902_+	hypothetical protein	NA	A0A291AXJ6	Shigella_phage	48.4	3.1e-29
AUZ66913.1|4401898_4402117_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66914.1|4402113_4402410_+	nucleoside 2-deoxyribosyltransferase	NA	A0A0U2SAZ1	Escherichia_phage	67.7	1.1e-29
AUZ66915.1|4402406_4402598_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	2.1e-13
AUZ66916.1|4402689_4402962_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ66917.1|4402964_4403183_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	61.4	7.8e-17
AUZ66918.1|4403179_4403851_+	hypothetical protein	NA	R9VWB9	Serratia_phage	38.5	4.5e-31
AUZ66919.1|4403828_4404068_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	8.3e-28
AUZ66920.1|4404077_4404404_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	80.0	3.3e-43
AUZ66921.1|4404509_4404755_+	excisionase	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
AUZ66922.1|4404800_4406096_+|integrase	integrase	integrase	Q20GI2	Phage_258-320	69.1	1.0e-180
4406121:4406142	attR	ACCTAAACCTGCATGGACATCA	NA	NA	NA	NA
>prophage 13
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	4610584	4619007	5246201	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AUZ67104.1|4610584_4612618_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
AUZ67105.1|4612821_4613280_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	66.7	1.1e-49
AUZ67865.1|4613324_4613795_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.8	3.1e-63
AUZ67106.1|4613841_4614561_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUZ67107.1|4614553_4616242_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.5	2.4e-278
AUZ67108.1|4616465_4617197_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.9	8.3e-103
AUZ67109.1|4617256_4617364_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ67110.1|4617344_4618076_-	ABC transporter permease	NA	NA	NA	NA	NA
AUZ67111.1|4618059_4619007_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.7e-07
>prophage 14
CP026216	Citrobacter sp. CFNIH10 chromosome, complete genome	5246201	4821378	4904914	5246201	tRNA,holin,integrase,capsid,tail,terminase,portal,plate,protease,head	Shigella_phage(32.73%)	101	4865123:4865143	4905110:4905130
AUZ67283.1|4821378_4822191_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUZ67284.1|4822190_4823204_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUZ67285.1|4823270_4824407_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	4.0e-19
AUZ67878.1|4824510_4825512_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUZ67286.1|4825508_4826687_-	arabinose transporter	NA	NA	NA	NA	NA
AUZ67287.1|4826863_4827238_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67288.1|4827408_4827660_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	55.4	2.1e-13
AUZ67289.1|4827818_4828184_+	hypothetical protein	NA	D5GW25	Campylobacter_virus	35.0	1.9e-07
AUZ67290.1|4828186_4828717_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AUZ67291.1|4828757_4829975_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUZ67292.1|4830133_4832134_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUZ67293.1|4832290_4834741_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67294.1|4834954_4835314_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67295.1|4835354_4835882_-	GTP-binding protein	NA	NA	NA	NA	NA
AUZ67296.1|4836223_4836880_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUZ67297.1|4836945_4838667_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67298.1|4838708_4839395_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67299.1|4839603_4840116_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67300.1|4840117_4840552_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67301.1|4840600_4841095_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67302.1|4841113_4841623_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67303.1|4841724_4842087_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67304.1|4842221_4843502_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67305.1|4843495_4844353_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67306.1|4844354_4845269_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67307.1|4845265_4846555_-	CpaF family protein	NA	NA	NA	NA	NA
AUZ67308.1|4846615_4847761_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67309.1|4847776_4849192_-	tight adherence secretin RcpA	NA	NA	NA	NA	NA
AUZ67310.1|4849239_4850184_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67311.1|4850521_4850752_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
AUZ67312.1|4851189_4851474_-	YfcL family protein	NA	NA	NA	NA	NA
AUZ67313.1|4851505_4852054_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUZ67314.1|4852053_4852863_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67315.1|4852862_4853687_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUZ67316.1|4853690_4854776_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
AUZ67317.1|4854802_4855735_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUZ67318.1|4855903_4856455_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUZ67319.1|4856671_4857157_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUZ67320.1|4857349_4859509_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUZ67321.1|4859508_4860819_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUZ67322.1|4860999_4861284_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AUZ67323.1|4861657_4862998_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUZ67324.1|4863059_4863815_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUZ67879.1|4864105_4865047_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	90.2	1.9e-152
4865123:4865143	attL	GTCCCCTTAGTTAAATGGATA	NA	NA	NA	NA
AUZ67325.1|4865239_4865629_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	71.9	2.4e-48
AUZ67326.1|4865711_4865951_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	87.3	7.2e-32
AUZ67327.1|4866075_4866630_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	77.3	6.5e-76
AUZ67328.1|4866712_4867060_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	44.9	9.2e-12
AUZ67329.1|4867061_4867493_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	43.4	1.3e-23
AUZ67330.1|4867464_4867839_-|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	51.2	5.3e-13
AUZ67331.1|4868529_4869114_-	hypothetical protein	NA	O22003	Shigella_phage	80.9	3.3e-94
AUZ67332.1|4869104_4870163_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	76.6	6.9e-159
AUZ67333.1|4870149_4870578_-|tail	phage tail protein	tail	S5FNR6	Shigella_phage	81.7	1.1e-65
AUZ67334.1|4870574_4871123_-|plate	baseplate assembly protein	plate	U5P081	Shigella_phage	71.1	4.0e-70
AUZ67335.1|4871122_4872202_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	80.5	8.9e-170
AUZ67336.1|4872198_4873500_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	72.4	4.2e-182
AUZ67337.1|4873592_4874030_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ67338.1|4874044_4875835_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	80.5	5.3e-244
AUZ67339.1|4875827_4876010_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67340.1|4875976_4876246_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	83.0	2.4e-36
AUZ67341.1|4876245_4876602_-|tail	phage tail protein	tail	U5P076	Shigella_phage	90.7	1.8e-58
AUZ67342.1|4876601_4878098_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	85.5	3.3e-239
AUZ67343.1|4878087_4878252_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	88.9	1.8e-21
AUZ67344.1|4878260_4878821_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	82.3	7.5e-88
AUZ67345.1|4878820_4879324_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	85.6	3.1e-77
AUZ67346.1|4879298_4879712_-|head,tail	head-tail adaptor protein	head,tail	U5P0R0	Shigella_phage	71.5	7.8e-50
AUZ67347.1|4879708_4880032_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	64.2	3.2e-35
AUZ67348.1|4880106_4881330_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	72.5	1.8e-163
AUZ67349.1|4881339_4881939_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.0	2.3e-90
AUZ67350.1|4881931_4883158_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	88.9	1.6e-215
AUZ67351.1|4883305_4885039_-|terminase	terminase	terminase	Q8HAD6	Salmonella_phage	93.6	0.0e+00
AUZ67352.1|4885035_4885533_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.7	1.9e-82
AUZ67880.1|4885658_4886009_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	80.2	3.5e-51
AUZ67353.1|4886073_4886598_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	95.4	1.8e-88
AUZ67354.1|4886620_4886806_+	hypothetical protein	NA	H6WRZ7	Salmonella_phage	92.0	6.0e-18
AUZ67355.1|4886757_4887288_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.5	9.5e-08
AUZ67356.1|4887284_4887734_-	muraminidase	NA	A0A0M4R365	Salmonella_phage	79.9	9.3e-65
AUZ67357.1|4887717_4888041_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	83.8	6.1e-42
AUZ67358.1|4888195_4889101_-|protease	serine protease	protease	NA	NA	NA	NA
AUZ67359.1|4889745_4890504_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	63.5	2.2e-82
AUZ67881.1|4890517_4891507_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	73.6	1.9e-150
AUZ67360.1|4891503_4891782_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67882.1|4891774_4892650_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	46.1	1.1e-61
AUZ67361.1|4892753_4893140_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	84.0	4.0e-56
AUZ67362.1|4893136_4893484_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	47.2	5.4e-20
AUZ67363.1|4893453_4895319_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.8	1.0e-210
AUZ67364.1|4895311_4896190_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	86.0	2.4e-149
AUZ67365.1|4896189_4897122_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	50.8	6.2e-79
AUZ67366.1|4897105_4897291_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	9.5e-16
AUZ67367.1|4897454_4898009_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	54.6	5.7e-48
AUZ67368.1|4898053_4898248_-	cell division protein	NA	NA	NA	NA	NA
AUZ67369.1|4898349_4898976_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	47.8	1.4e-45
AUZ67884.1|4899187_4899406_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ67883.1|4899380_4899614_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ67370.1|4899989_4900172_+	hypothetical protein	NA	U5P4J6	Shigella_phage	88.6	7.4e-13
AUZ67371.1|4900263_4900803_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	86.6	4.4e-85
AUZ67372.1|4900963_4901218_+	hypothetical protein	NA	A0A0A7NV47	Enterobacteria_phage	40.0	6.3e-10
AUZ67373.1|4901214_4901943_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	64.8	1.0e-84
AUZ67374.1|4902994_4903555_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.1	5.7e-88
AUZ67375.1|4903575_4903761_+	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	61.4	6.2e-15
AUZ67376.1|4903744_4904914_-|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	82.8	1.1e-194
4905110:4905130	attR	GTCCCCTTAGTTAAATGGATA	NA	NA	NA	NA
>prophage 1
CP026212	Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence	126940	0	98534	126940	integrase,protease,transposase	Escherichia_phage(13.04%)	113	18424:18439	81264:81279
AUZ62529.1|1493_3803_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AUZ62661.1|3928_4315_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62530.1|4811_5345_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62662.1|5355_8025_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUZ62531.1|8312_9389_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUZ62532.1|9602_10973_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AUZ62533.1|10959_11388_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AUZ62534.1|11380_11953_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AUZ62535.1|11924_12164_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
AUZ62536.1|12174_12927_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AUZ62537.1|12947_13274_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62538.1|13286_13535_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62539.1|13512_13767_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AUZ62540.1|13798_15754_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AUZ62541.1|15812_16460_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AUZ62542.1|16603_17206_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62543.1|17262_17952_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62544.1|17926_18475_-	hypothetical protein	NA	NA	NA	NA	NA
18424:18439	attL	GACTGATATTGTGTAA	NA	NA	NA	NA
AUZ62545.1|18489_19482_-	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AUZ62546.1|19492_20119_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AUZ62547.1|20118_20511_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AUZ62548.1|20507_23147_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AUZ62549.1|23218_23611_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62550.1|23624_23915_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62551.1|23911_24316_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62552.1|24382_24694_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62553.1|24694_24913_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62663.1|24936_25221_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62554.1|25225_25636_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62555.1|25767_26337_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AUZ62556.1|26359_26956_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AUZ62557.1|26948_28373_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AUZ62558.1|28372_29113_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AUZ62559.1|29099_29666_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AUZ62560.1|29685_29991_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AUZ62561.1|30004_30373_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AUZ62562.1|30422_30605_-	TraY domain-containing protein	NA	NA	NA	NA	NA
AUZ62563.1|30790_31465_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62564.1|31703_32093_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUZ62565.1|32525_33011_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUZ62566.1|33043_33373_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62567.1|33405_34227_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AUZ62568.1|35046_35880_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.8e-21
AUZ62569.1|35930_36077_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUZ62570.1|36171_36519_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62571.1|36575_36929_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	64.2	5.0e-29
AUZ62572.1|36930_37050_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUZ62573.1|37558_37909_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62574.1|37905_38178_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62575.1|38225_38585_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62576.1|38695_39019_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	34.2	2.3e-09
AUZ62577.1|39022_39745_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUZ62578.1|39741_40173_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AUZ62579.1|40218_42228_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
AUZ62580.1|42296_42539_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUZ62581.1|42586_43099_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
AUZ62582.1|43838_44156_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62583.1|44190_44451_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.7	2.0e-11
AUZ62584.1|44632_44824_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62585.1|44866_45373_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.1	7.7e-07
AUZ62586.1|45415_45844_-	antirestriction protein	NA	NA	NA	NA	NA
AUZ62587.1|46524_47292_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62588.1|47345_47765_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUZ62589.1|47774_47996_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62590.1|47995_48697_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	3.2e-27
AUZ62591.1|49133_49364_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62592.1|49427_50099_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUZ62593.1|50101_51073_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUZ62594.1|51306_51738_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUZ62595.1|51737_53009_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
AUZ62596.1|53420_54296_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AUZ62597.1|54928_55555_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AUZ62664.1|55674_55854_+	Par-like protein	NA	NA	NA	NA	NA
AUZ62598.1|56357_57152_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AUZ62599.1|57349_58366_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62600.1|58376_58691_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62665.1|58717_59077_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62601.1|59281_59587_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUZ62602.1|59588_59807_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AUZ62603.1|59858_60086_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62666.1|59976_60351_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62604.1|60403_60634_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUZ62605.1|60630_61047_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUZ62606.1|61087_61966_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
AUZ62607.1|62627_63905_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AUZ62608.1|63894_66003_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	3.2e-38
AUZ62609.1|66002_66638_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUZ62610.1|66745_67087_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62611.1|68536_68977_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62667.1|68995_69589_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62612.1|69880_70111_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUZ62613.1|70107_70524_+	PIN domain nuclease	NA	NA	NA	NA	NA
AUZ62614.1|70597_72157_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUZ62615.1|72198_73167_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUZ62616.1|73210_74233_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUZ62668.1|74776_75685_+	HNH endonuclease	NA	NA	NA	NA	NA
AUZ62617.1|75870_76221_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AUZ62618.1|76368_76800_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUZ62619.1|77386_78355_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AUZ62620.1|78727_80920_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUZ62621.1|81049_82333_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
81264:81279	attR	TTACACAATATCAGTC	NA	NA	NA	NA
AUZ62622.1|82421_83855_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUZ62623.1|83873_86321_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
AUZ62624.1|86434_88078_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AUZ62625.1|88202_88769_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ62626.1|89103_89382_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62627.1|89621_91019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUZ62628.1|91129_92662_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUZ62629.1|92809_93205_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUZ62669.1|93253_94600_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ62670.1|94825_95458_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62630.1|95486_96890_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUZ62631.1|97001_98534_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
>prophage 2
CP026212	Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence	126940	102820	107129	126940		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
AUZ62639.1|102820_103171_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
AUZ62640.1|103222_103585_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUZ62641.1|103602_105354_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUZ62642.1|105401_106691_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
AUZ62643.1|106703_107129_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	6.6e-52
>prophage 3
CP026212	Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence	126940	110646	112170	126940		Pseudomonas_phage(100.0%)	1	NA	NA
AUZ62647.1|110646_112170_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
>prophage 4
CP026212	Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence	126940	118498	123096	126940		Wolbachia_phage(33.33%)	7	NA	NA
AUZ62672.1|118498_119050_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.8e-17
AUZ62655.1|119153_119462_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
AUZ62656.1|119458_120109_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUZ62657.1|120164_120809_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62658.1|120858_121455_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62659.1|121621_122215_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUZ62660.1|122370_123096_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
>prophage 1
CP026211	Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence	51267	25988	31156	51267	transposase	Escherichia_phage(66.67%)	8	NA	NA
AUZ62497.1|25988_26546_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AUZ62498.1|26630_27335_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUZ62499.1|27368_27503_-	ABC transporter	NA	NA	NA	NA	NA
AUZ62500.1|27655_28156_-	ferritin	NA	NA	NA	NA	NA
AUZ62501.1|28482_29187_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUZ62502.1|29306_30287_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUZ62503.1|30564_30846_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUZ62504.1|30826_31156_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
>prophage 1
CP026210	Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence	77585	28088	48205	77585	transposase,protease,integrase	Escherichia_phage(37.5%)	20	34084:34143	35393:35534
AUZ62425.1|28088_28742_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUZ62465.1|28821_29205_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AUZ62426.1|29309_29705_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUZ62466.1|29749_31012_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AUZ62427.1|31022_31973_+	DsbC family protein	NA	NA	NA	NA	NA
AUZ62428.1|31985_34073_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
34084:34143	attL	AGGGGTCTGAAGGCCAATAGAACGAAAACGTACGTTAGTGAAGTAACTGTCTGATATATC	NA	NA	NA	NA
AUZ62429.1|34256_34604_-|integrase	class 1 integron integrase IntI1	integrase	NA	NA	NA	NA
AUZ62467.1|34752_35286_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUZ62430.1|35681_36542_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
35393:35534	attR	AGGGGTCTGAAGGCCAATAGAACGAAAACGTACGTTAGTGAAGTAACTGTCTGATATATCGAAACATAATGTACATTGGAAAACGCCATCAAAACGGTGTCTTTTTAATCGAAAATTGGCACTTAACGGACTTTCTTGTCTA	NA	NA	NA	NA
AUZ62431.1|37241_38066_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AUZ62432.1|38125_38914_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUZ62468.1|38983_39538_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AUZ62433.1|39771_40329_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUZ62434.1|40686_41391_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ62435.1|42367_42973_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUZ62436.1|43286_44606_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUZ62437.1|44855_45737_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUZ62438.1|46261_46966_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ62439.1|47330_47510_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62440.1|47500_48205_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP026213	Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence	221962	142860	160637	221962	integrase,transposase	Escherichia_phage(40.0%)	23	143462:143521	156894:157714
AUZ62918.1|142860_143475_-	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	52.5	1.9e-60
143462:143521	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AUZ62824.1|143525_144230_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ62825.1|144451_144766_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ62826.1|144704_145718_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUZ62827.1|145864_146347_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUZ62828.1|146567_146834_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUZ62829.1|146976_147741_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUZ62830.1|147782_147995_+	resolvase	NA	NA	NA	NA	NA
AUZ62831.1|148007_149216_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
AUZ62832.1|149249_150683_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUZ62833.1|151064_151271_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62919.1|151275_151764_-	restriction endonuclease	NA	NA	NA	NA	NA
AUZ62834.1|151972_152284_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62835.1|152319_152634_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AUZ62836.1|152630_152975_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62920.1|152990_153341_-	KorB	NA	NA	NA	NA	NA
AUZ62837.1|153404_154139_+	traL protein	NA	NA	NA	NA	NA
AUZ62921.1|154147_154429_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ62838.1|154438_154732_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUZ62839.1|154781_155099_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AUZ62840.1|156957_157662_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ62841.1|158186_159068_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
156894:157714	attR	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AUZ62842.1|159317_160637_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 2
CP026213	Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence	221962	171901	202879	221962	transposase	Salmonella_phage(27.27%)	35	NA	NA
AUZ62852.1|171901_172606_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ62853.1|174502_175507_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUZ62854.1|175688_175865_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUZ62855.1|176194_177010_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUZ62856.1|177070_177874_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AUZ62857.1|177873_178710_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUZ62858.1|179636_180641_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUZ62859.1|180719_183692_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUZ62860.1|183694_184252_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUZ62861.1|184381_184594_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUZ62922.1|184556_184676_+	mercury resistance protein	NA	NA	NA	NA	NA
AUZ62862.1|184659_184896_-	mercury resistance protein	NA	NA	NA	NA	NA
AUZ62863.1|184892_185258_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ62864.1|185275_186958_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUZ62865.1|186996_187404_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUZ62866.1|187431_187707_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUZ62867.1|187722_188073_-	mercuric transporter	NA	NA	NA	NA	NA
AUZ62868.1|188144_188600_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUZ62869.1|188964_189255_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUZ62870.1|189251_189653_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62871.1|189642_189999_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUZ62872.1|190253_190568_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62873.1|190740_191274_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUZ62874.1|191273_192269_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUZ62875.1|192310_193471_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AUZ62876.1|193470_194292_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AUZ62877.1|194365_195064_-	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AUZ62923.1|195053_195167_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AUZ62878.1|195288_196056_-	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
AUZ62879.1|196224_196839_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ62880.1|196879_197587_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ62881.1|197614_198181_-	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
AUZ62882.1|198732_199437_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AUZ62883.1|199798_201481_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	3.8e-10
AUZ62884.1|201856_202879_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
